Fluorescent quantitative PCR (Polymerase Chain Reaction) detection method for mouse K virus

Abstract

The invention discloses a mouse K virus fluorescent quantitative PCR (polymerase chain reaction) detection method, and relates to the technical field of biology, the technical key points are as follows: the method comprises the following steps: S1, designing specific primers and a probe, the specific primers being a forward primer and a reverse primer; s2, plasmid preparation; s3, carrying out fluorescent quantitative PCR amplification; and S4, validity verification and result detection judgment. The lowest detection limit of the detection method established by the invention is 10 copies / mu L, and the detection method has good specificity and relatively high sensitivity.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and particularly to a fluorescence quantitative PCR detection method for mouse K virus. Background Art

[0002] Mouse K Virus (MKV) belongs to the Polyomaviridae family and the Polyomavirus genus in terms of classification, and its nucleic acid is double-stranded DNA. Mice are the only natural hosts of MKV. In weaned mice and adult mice, it mostly shows latent infection. Experimental mice and wild mice of different strains and ages are susceptible to MKV, but only neonatal suckling mice within 8 days old can have lethal infection. It can enhance the pathogenicity of mouse hepatitis virus (MHV) and is a common contaminant of biological materials and transplanted tumors.

[0003] Currently, the conventional PCR detection technology for detecting viruses has good sensitivity, specificity, stability and operability. However, there is cross-contamination in the post-treatment of conventional PCR reactions, and false positive results are relatively easy to appear, and the experimental time is also relatively long.

[0004] Therefore, the present invention aims to provide a fluorescence quantitative PCR detection method for mouse K virus to solve the above problems. Summary of the Invention

[0005] The purpose of the present invention is to solve the above problems and provide a fluorescence quantitative PCR detection method for mouse K virus. The minimum detection limit of this detection method is 10 copies / μL, and it has good specificity and high sensitivity.

[0006] In order to achieve the above purpose, the technical solution of the present invention is as follows:

[0007] The present invention provides a fluorescence quantitative PCR detection method for mouse K virus, including the following steps:

[0008] S1: Design of specific primers and probes. The specific primers are forward primers and reverse primers;

[0009] The sequence of the forward primer is:

[0010] GCAGAGTGACAATTTGTTAGAGAGGAA;

[0011] The sequence of the reverse primer is:

[0012] CATGTGATACAATACTTATGTGGGAAGCT;

[0013] The sequence of the probe is: 5′-(FAM)CCCCGACAACCTCT(NFQ)-3′;

[0014] S2: Plasmid preparation;

[0015] Synthesize an MKV sequence artificially and insert the sequence into the pUC57 - KANA plasmid as the plasmid standard of MKV; serially dilute the standard plasmid from 10 8 dilute to 10 0 copies / μL as the positive standard;

[0016] The sequence is as follows:

[0017] >MKV:

[0018] AGACCTTGAACAGGAAAGCCTGCACCTTCATTATCATACAACCTTTTTACAGCAGAGTGACAATTTGTTAGAGAGGAAACCCCGACAACCTCTGTCTTACAACTTATAGCTTCCCACATAAGTATTGTATCACATGTCATGTCCTCATTCAACATTGGGAGGGAAATTTTGGCCATACTATAGCATGGCAGTTCTTTAATGCGGGGCATG;

[0019] S3: Fluorescent quantitative PCR amplification;

[0020] The fluorescent quantitative PCR reaction system is: 10 μl GoTaq Probe qPCR Master Mix, 0.4 μl upstream primer, 0.4 μl downstream primer, 0.2 μl probe, 7 μl RNase - free water, 2 μl template;

[0021] The fluorescent quantitative PCR reaction conditions are carried out according to the following cycling program: ① 95°C for 10 min; ② 95°C for 15 s, 60°C for 1 min; cycle "① - ②" 45 times;

[0022] S4: Validation of effectiveness and detection and determination of results.

[0023] Compared with the prior art, the beneficial effects of this solution are:

[0024] 1. In the present invention, MKV, Poly, MVM, KRV, and MAd are used as templates for specific detection. The results show that when using Poly, MVM, KRV, and MAd as templates, the amplification curves are all straight lines without amplification, while when using MKV as the template, the amplification curve is obvious, indicating that the fluorescent quantitative PCR detection method established in the present invention has good specificity;

[0025] 2. In the present invention, the standard product is diluted to 1.0×10 1There was an obvious amplification curve at 10 copies / μL, so the lowest detection limit was 10 copies / μL, indicating that the fluorescence quantitative PCR method established in this invention had high sensitivity. Brief Description of the Drawings

[0026] Figure 1 It is a schematic diagram of the MKV specificity result in the embodiment of the present invention;

[0027] Figure 2 It is a schematic diagram of the standard curve of the MKV fluorescence PCR method in the embodiment of the present invention;

[0028] Figure 3 It is a schematic diagram of the MKV sensitivity result in the embodiment of the present invention;

[0029] Figure 4 It is a schematic diagram of the result of detecting 95 mouse fecal samples by the MKV fluorescence PCR method in the embodiment of the present invention;

[0030] Figure 5 It is a schematic diagram of the result of detecting 95 mouse fecal samples by the MKV conventional PCR method in the embodiment of the present invention. Detailed Embodiments

[0031] In order to enable those skilled in the art to better understand the solution of the present invention, the technical solution of the present invention will be further described in detail below in conjunction with the embodiments and drawings of the present invention. Obviously, the described embodiments are only a part of the embodiments of the present invention, rather than all the embodiments. All other embodiments obtained by those of ordinary skill in the art based on the embodiments of the present invention without making creative efforts shall fall within the scope of protection of the present invention.

[0032] It should be noted that, without conflict, the embodiments in the present invention and the features in the embodiments can be combined with each other. The present invention will be described in detail below in conjunction with the embodiments.

[0033] Embodiment:

[0034] 1. Materials and Methods

[0035] 1.1 Materials

[0036] 1.1.1 Virus

[0037] Mouse K virus (MKV) was purchased from ATCC (No.: 45028), and mouse polyomavirus (Poly), mouse minute virus (MVM), rat parvovirus KRV strain and mouse adenovirus (MAd) were all stored in our laboratory.

[0038] 1.1.2 Main Reagents

[0039] Nucleic acid extraction kit: cador Pathogen 96 QIAcube HT Kit, QIAGEN; The MKV-pUC57-KANA plasmid standard connected with the MKV target sequence was synthesized by Sangon Biotech; GoTaq Probe qPCR Master Mix: Promega; PrimeSTAR HS(Premix), 100bp DNA Marker were purchased from Takara.

[0040] Automatic nucleic acid extractor: Model: QIAcube HT, QIAGEN; Fluorescent quantitative PCR instrument: Applied Biosystems, USA, Model: QuantStudio 6; PCR instrument: Applied Biosystems, USA, Model: VeritiTM 96; Nucleic acid agarose gel electrophoresis instrument: Bio-RAD, USA, Model: PwerPac Basic; Gel imaging analyzer: Kodak, USA, Model: GL212Pro.

[0041] 1.2 Methods

[0042] 1.2.1 Design of primers and probes

[0043] According to the MKV (EF186666) genome sequence published on NCBI, conserved specific regions were selected by BLAST alignment analysis to design primers and probes. See Table 1.

[0044] Table 1 Primers and probes for MKV fluorescent quantitative PCR

[0045]

[0046] *EF186666

[0047] 1.2.2 Preparation of standard plasmid

[0048] A MKV sequence was artificially synthesized and inserted into the pUC57-KANA plasmid as the plasmid standard of MKV. The standard plasmid was serially diluted from 10 8 diluted to 10 0 copies / μL as the positive standard.

[0049] The sequence is as follows:

[0050] >MKV:

[0051] AGACCTTGAACAGGAAAGCCTGCACCTTCATTATCATACAACCTTTTTACAGCAGAGTGACAATTTGTTAGAGAGGAAACCCCGACAACCTCTGTCTTACAACTTATAGCTTCCCACATAAGTATTGTATCACATGTCATGTCCTCATTCAACATTGGGAGGGAAATTTTGGCCATACTATAGCATGGCAGTTCTTTAATGCGGGGCATG

[0052] 1.2.3 Reaction system and reaction conditions of fluorescence quantitative PCR method

[0053] The PCR reaction system is as follows: 10 μL of GoTaq Probe qPCR Master Mix (CXR Reference Dye plus), 0.4 μL each of upstream and downstream primers (10 μM), 0.2 μL of probe (10 μM), 7 μL of RNase-free water, and 2 μL of template. Reaction conditions: 95°C for 10 min; 95°C for 15 s, 60°C for 1 min, 45 cycles.

[0054] 1.2.4 Specificity experiment

[0055] Detect MKV, poly, MVM, KRV, MAd to verify the specificity of the MKV real-time fluorescence quantitative PCR detection method.

[0056] 1.2.5 Sensitivity experiment

[0057] Take 10 8 ~10 0 copies / μL standard products for real-time fluorescence quantitative PCR detection. Each concentration of the standard product is prepared in 3 replicates to test the detection sensitivity of the method.

[0058] 1.2.6 Repeatability verification of the method

[0059] Apply the optimized reaction conditions to perform FQ-PCR amplification using plasmid standard products at different concentrations (10 6 , 10 4 and 10 2 copies / μL) as templates. Each concentration is set with 3 replicates, and at the same time, 3 different time points are selected for detection. Calculate the mean, standard deviation, and coefficient of variation of Ct values within and between groups.

[0060] 1.2.7 Method application

[0061] 1.2.7.1 Detection of clinical samples

[0062] The established MKV fluorescence PCR method was used to detect 95 mouse fecal samples from the quality sampling inspection of laboratory animals in Beijing in June 2022.

[0063] 1.2.7.2 Comparison with the ordinary PCR method

[0064] The same 95 mouse fecal samples were detected by the MKV ordinary PCR method to compare the differences in the results between the fluorescence PCR method established in this study and the ordinary PCR method. The primer information of the MKV ordinary PCR method is shown in Table 2, synthesized by Sangon Biotech (Shanghai). Reaction system: PrimeSTAR HS (Premix) 12.5 μL, upstream and downstream primers (10 μM) 1 μL each, template to be detected 2 μL, nuclease-free water added to make up to 25 μL; Reaction conditions: denaturation at 98 °C for 10 s, annealing at 55 °C for 5 s, extension at 72 °C for 30 s, for a total of 40 cycles.

[0065] Table 2 Primers for MKV ordinary PCR

[0066]

[0067] 2. Results

[0068] 2.1 Results of the specificity experiment

[0069] For the specificity detection of the real-time fluorescence quantitative PCR detection method, MKV, Poly, MVM, KRV, and MAd were used as templates for detection respectively, and the results are as Figure 1 shown. It can be seen that when using Poly, MVM, KRV, and MAd as templates, the amplification curves are all straight lines without amplification, while the amplification curve is obvious when using MKV as the template. This shows that the established fluorescence quantitative PCR detection method has good specificity.

[0070] 2.2 Results of the sensitivity experiment

[0071] As Figure 2 , Figure 3 shows, the intervals between the dilution gradients of the amplification curves are uniform, the linear range (1×10 1 ~1×10 8 copies / μL) is good, the slope of the standard curve Slope is -3.493, the correlation coefficient R2 value is 0.999 (>0.99), and the amplification efficiency Eff% is 93.34% (between 90% - 110%). When the standard product was diluted to 1.0×10 1 copies / μL, there was an obvious amplification curve, and the average CT value was 36.29. Therefore, the lowest detection limit was 10 copies / μL. This shows that the established fluorescence quantitative PCR method has high sensitivity ( Figure 3 ).

[0072] 2.3 Verification of the repeatability of the method

[0073] Detect plasmid standard products at three concentrations of 10 6 , 10 4 and 10 2 copies / μL by the established FQ-PCR method. As can be seen from Table 3, the within-group coefficient of variation of the Ct values is 0.346% - 2.441%, and the between-group coefficient of variation is 0.791% - 1.435%, indicating good repeat stability of the method.

[0074] Table 3 Results of repeat verification of the method

[0075]

[0076] 2.4 Method application

[0077] 2.4.1 Detect 95 fecal samples of laboratory animals in Beijing in June 2022 by the established MKV fluorescence PCR method. The results show that all MKV are negative ( Figure 4 ).

[0078] 2.4.2 Comparison with the ordinary PCR method: Detect the same 95 mouse fecal samples by the MKV ordinary PCR method. The results are all negative ( Figure 5 ).

[0079] The above specific embodiments are only explanations of the present invention, and they do not limit the present invention. Those skilled in the art can make modifications without creative contributions to this embodiment according to needs after reading this specification, but as long as they are within the scope of the claims of the present invention, they are protected by the patent law.

Claims

1. A method for detecting mouse K virus by fluorescent quantitative PCR, characterized by: The following steps are involved: S1: Design of specific primers and probes, wherein the specific primers are forward primers and reverse primers; The sequence of the forward primer is: GCAGAGTGACAATTTGTTAGAGAGGAA; The sequence of the reverse primer is: CATGTGATACAATACTTATGTGGGAAGCT; The sequence of the probe is: 5′-(FAM)CCCCGACAACCTCT(NFQ)-3′; S2: plasmid preparation; An MKV sequence was artificially synthesized and inserted into the pUC57-KANA plasmid as a plasmid standard for MKV. The standard plasmid was diluted from 10 8 Dilute to 10 0 copies / μL, as positive standards; The sequence is as follows: >MKV: AGACCTTGAACAGGAAAGCCTGCACCTTCATTATCATACAACCTTTTTACAGCAGAGTGACAATTTGTTAGAGAGGAAACCCCGACAACCTCTGTCTTACAACTTATAGCTTCCCACATAAGTATTGTATCACATGTCATGTCCTCATTCAACATTGGGAGGGAAATTTTGGCCATACTATAGCATGGCAGTTCTTTAATGCGGGGCATG; S3: Fluorescence quantitative PCR amplification; The fluorescent quantitative PCR reaction system is as follows: 10 μl GoTaq Probe qPCR Master Mix, 0.4 μl upstream primer, 0.4 μl downstream primer, 0.2 μl probe, 7 μl RNase-free water, and 2 μl template; The fluorescent quantitative PCR reaction conditions were as follows: ① 95°C for 10 min; ② 95°C for 15 s, 60°C for 1 min; cycle "① to ②" 45 times; S4: Validation and result detection and judgment.

Images