Preparation method of microbial selenium-enriched Fuzhuan tea

By using selenium-rich and domesticated Guantusan compost in the preparation process of Fu brick tea, the inorganic selenium is converted into organic selenium, which solves the problem of uncontrollable quality of Fu brick tea, improves the nutritional value and quality of tea, and achieves the improvement of stability and production efficiency between batches.

CN120391541APending Publication Date: 2025-08-01NORTHWEST UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510749456.6
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-06-06
Publication Date
2025-08-01

AI Technical Summary

Technical Problem

The existing Fu brick tea processing technology has problems such as large differences between product batches and uncontrollable quality, and natural fermentation is difficult to accurately regulate the flowering process, which affects the flavor and functional activity of the tea.

Method used

The selenium-rich and domesticated Guantusan Compass is used to convert inorganic selenium into organic selenium. By controlling the fermentation process parameters and inoculation amount, the fermentation process of Fu brick tea is accurately regulated, and the nutritional value and quality of the tea are enhanced.

Benefits of technology

The nutritional value of Fu brick tea has been improved, the quality is improved, the stability between batches is improved, and the production efficiency is enhanced. The organic selenium content in the tea is controllable, and it has antioxidant, anti-tumor, and lowering glycemic activities.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120391541A_ABST
    Figure CN120391541A_ABST
Patent Text Reader

Abstract

The invention belongs to the technical field of biological fermentation, and particularly discloses a preparation method of microbial selenium-enriched Fuzhuan tea, which comprises the following steps: S1, performing withering, fixation, rolling, primary pile fermentation and drying on fresh tea leaves to obtain a raw dark green tea raw material; s2, the raw dark green tea raw materials obtained in the S1 are selected, blended, steamed and subjected to secondary pile fermentation, a spore solution of selenium-rich eurotium cristatum is inoculated for fermentation, and a fermented material is obtained; and S3, pressing and shaping the fermented material, culturing selenium-rich eurotium cristatum through eurotium cristatum growing, drying after the eurotium cristatum growing is finished, and aging to obtain the selenium-rich Fuzhuan tea. According to the preparation method of the microbial selenium-enriched Fuzhuan tea, inorganic selenium is converted into organic selenium in the forms of selenium polysaccharide, selenoamino acid and the like through the selenium-enriched domesticated eurotium cristatum, the nutritional value of the Fuzhuan tea is improved, the quality of the Fuzhuan tea is improved, and the microbial selenium-enriched Fuzhuan tea is prepared by controlling selenium-enriched domestication conditions and fermentation process parameters. The floating period is shortened, the production efficiency is improved, and the quality is more stable.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the technical field of microbial fermentation, and particularly to a method for preparing a microbial selenium-enriched Fuzhuan tea. Background Art

[0002] Selenium is a trace element with a unique role in the human genome. Selenocysteine (SeCys) is considered the 21st naturally occurring genetically encoded amino acid. Selenium enters the food chain and participates in a series of cell metabolism processes in the human body. It has powerful functional activities, including antioxidant, anti-diabetic, anti-cancer and other effects.

[0003] The Chinese Nutrition Society stipulates that the selenium intake standard for adults is 50 - 250 μg / d. However, 72% of the land area in China lacks selenium in the soil. Therefore, safely supplementing selenium is the main issue in current research. Microorganisms can convert inorganic selenium into organic selenium. Eurotium cristatum is the dominant microorganism during the fermentation process of Fuzhuan tea. After selenium-enriched domestication of Eurotium cristatum, it can convert toxic and poorly absorbable inorganic selenium into selenium polysaccharides, selenium proteins, etc. that are easily absorbed by the human body.

[0004] The existing processing technology of Fuzhuan tea is generally prepared through steps such as withering, fixation, rolling, the first pile-fermentation, drying, sorting, blending, steam treatment, the second pile-fermentation, pressing, shaping, flower formation and aging. However, natural fermentation will have problems of large differences between product batches and uncontrollable quality. After quantitatively inoculating selenium-enriched Eurotium cristatum, the flower formation process can be precisely regulated, the flavor of Fuzhuan tea can be improved, and Fuzhuan tea can be endowed with various functional activities such as antioxidant, anti-tumor, hypoglycemic, and lipid-lowering. Summary of the Invention

[0005] The purpose of the present invention is to provide a method for preparing a microbial selenium-enriched Fuzhuan tea, which converts inorganic selenium into organic selenium in the form of selenium polysaccharides, selenoamino acids, etc. by selenium-enriched domesticated Eurotium cristatum, improves the nutritional value of Fuzhuan tea, improves the quality of Fuzhuan tea, shortens the flower formation cycle and improves production efficiency by controlling the selenium-enriched domestication conditions and fermentation process parameters, and the quality is more stable.

[0006] To achieve the above purpose, the present invention provides a method for preparing a microbial selenium-enriched Fuzhuan tea, including the following steps:

[0007] S1 Obtaining raw material of dark tea by subjecting fresh tea leaves to withering, fixation, rolling, the first pile-fermentation and drying steps;

[0008] S2 selects, blends, steams, and performs secondary fermentation on the raw dark tea obtained in S1, and after cooling, adds a spore solution of selenium-enriched Eurotium cristatum to the mixture for fermentation to obtain a fermentation material; the selenium-enriched Eurotium cristatum is deposited in the China Center for Type Culture Collection with a deposit number of CCTCC NO: M 2025845, a classification name of SXFCD.8, a deposit date of April 21, 2025, and a deposit address of Wuhan University, Wuhan, China;

[0009] S3 presses and shapes the fermented material, and cultures the selenium-rich Eurotium cristatum through flowering. After the flowering is completed, the material is dried and aged to obtain the selenium-rich Fuzhuan tea.

[0010] Preferably, in step S1, the fixing temperature is maintained at 260°C-280°C, the grass smell disappears, the tea stems become soft and not easy to break.

[0011] Preferably, in step S1, the kneading is performed for 20-40 minutes, and then the pile fermentation can be performed.

[0012] Preferably, in step S1, the fermentation time is 8-10 hours, the pile temperature is 28-40°C, and the drying temperature is 120-130°C, and the moisture content is 10-13%.

[0013] Preferably, in step S2, the sorting includes air sorting and color sorting, removing diseased leaves and non-tea inclusions, and selecting tea stems and tea leaves for blending.

[0014] Preferably, in step S2, the steaming time is 5-10 minutes, and a second fermentation is performed, during which tea glaze is added and stirred evenly to make the final moisture content of the tea leaves 20-30%.

[0015] Preferably, in step S2, after the pile is fermented, a selenium-rich suspension of Eurotium cristatum spores is added to the tea leaves at a concentration of 1×10 7 CFU / mL, and the inoculum volume was 20mL / kg.

[0016] Preferably, in step S2, the nucleotide sequence of the ITS of Eurotium cristatum SXFCD.8 is as shown in SEQ ID NO.1.

[0017] Preferably, in step S3, the tea leaves are pressed into bricks for blooming at a blooming temperature of 26-30° C., a relative humidity of 60-80%, and a time of 10-14 days. After blooming, the tea bricks are dried to a moisture content of 9%-10%.

[0018] The advantages and beneficial effects of the method for preparing the microbial selenium-enriched Fuzhuan tea of the present invention are:

[0019] 1. The present invention enhances the nutritional value of Fuzhuan tea: The Eurotium cristatum that has been domesticated with selenium can convert inorganic selenium into organic selenium in the forms of selenium polysaccharides and selenoamino acids, etc., and enrich it in the tea leaves, making it a natural, safe and stable source of organic selenium supplement, with various health care effects such as antioxidation, immune enhancement, and cancer prevention.

[0020] 2. The present invention improves the quality of Fuzhuan tea: The Eurotium cristatum domesticated with selenium can better decompose substances such as tea polyphenols in the tea leaves and further oxidize them into theaflavins, thearubigins, theabrownins, etc., making the soup color orange - red and bright, reducing the astringency of the tea soup, and being mellow in the mouth. At the same time, the Fuzhuan tea after two - time pile - fermentation contains higher alcohols, ketones and esters, presenting an obvious floral aroma of the fungus.

[0021] 3. The present invention improves production efficiency and has more stable quality: By controlling the selenium - enrichment domestication conditions and fermentation process parameters, the flowering period can be shortened, the composition of the bacterial flora during the fermentation of Fuzhuan tea can be effectively controlled, the selenium content in Fuzhuan tea can be accurately controlled, and the stability between batches can be improved.

[0022] The technical solution of the present invention will be further described in detail below through the accompanying drawings and embodiments.

[0023] Depository Information

[0024] The Eurotium cristatum is deposited in the China Center for Type Culture Collection, with the deposit number CCTCC NO: M 2025845, the taxonomic name Eurotium cristatum SXFCD.8, the deposit date April 21, 2025, and the deposit address Wuhan University, China. Brief Description of the Drawings

[0025] Figure 1 Shows the selenium content of the selenium - enriched Eurotium cristatum of the present invention;

[0026] Figure 2 Shows the biomass of the selenium - enriched Eurotium cristatum of the present invention;

[0027] Figure 3 Shows the comparison diagram of the growth of the selenium - enriched Eurotium cristatum and the non - selenium - enriched Eurotium cristatum on the PDA medium. Among them, A is the comparison diagram of the colony growth of the selenium - enriched Eurotium cristatum at 3, 4, 5, and 7 days, and B is the comparison diagram of the colony growth of the non - selenium - enriched Eurotium cristatum at 3, 4, and 7 days;

[0028] Figure 4 Shows the line graph of the change in selenium content during the tea fermentation process of the present invention. Detailed Embodiments

[0029] The technical solution of the present invention will be further described below through the accompanying drawings and embodiments.

[0030] Unless otherwise defined, the technical terms or scientific terms used in the present invention shall have the ordinary meanings understood by those of ordinary skill in the field to which the present invention pertains.

[0031] Unless otherwise defined, the reagents, equipment and other materials used in the present invention are all obtained from regular commercial sources.

[0032] Example 1

[0033] Eurotium cristatum is deposited in the China Center for Type Culture Collection with the deposit number CCTCC M 2025845, the taxonomic name is Eurotium cristatum SXFCD.8, the strain is, the deposit time is April 21, 2025, and the deposit address is Wuhan University, China.

[0034] Selenium enrichment domestication of Eurotium cristatum (FCD.8).

[0035] After sterilizing the prepared PDA medium (potato dextrose agar medium), add the sterilized sodium selenite solution in the sterile environment of the laminar flow hood to make the selenium concentration of the medium 30 μg / mL. Shake the medium well and wait for it to solidify naturally. Pick the activated Eurotium cristatum colony onto the surface of the selenium-enriched PDA medium, mark it and place it in an incubator at 28 °C for cultivation. Observe the growth status of the colony during this period. Select the medium with better growth at 5 - 7 days for subculture, and repeat the above steps for 3 subcultures.

[0036] Five strains of Eurotium cristatum were screened from tea: FCC.1, FCC.8, FCD.7, FCD.8, FCE.7. As Figure 1 shown, after domestication of strain FCD.8 and strain FCC.1 in the medium with the addition amount of sodium selenite of 30 μg / mL, the total selenium content of the strains both exceeded 1000 μg / g, and the selenium content of strain FCD.8 was the highest, reaching 1390.13 ± 90.97 μg / g. At the same time, the biomass of the mycelial pellets after liquid culture of the strains was measured, and it was found that the biomass of strain FCD.8 and strain FCC.1 both exceeded 25 mg / 100 mL, among which the biomass of strain FCC.1 reached 29.59 ± 0.99 mg / 100 mL, and the biomass of strain FCD.8 also reached 25.95 ± 1.39 mg / 100 mL, indicating that these two strains can still maintain good colony viability in the selenium-added environment and can better resist the inhibitory effect of sodium selenite on the growth of the strains. By analyzing the determination results of the inorganic selenium content of the five strains, the organic selenium conversion rate of the strains was obtained. The strain with the highest conversion rate was FCD.8, and the organic selenium conversion rate reached 87.46 ± 2.25%. Considering the results of the total selenium content, the biomass of the strains and the organic selenium conversion rate comprehensively, strain FCD.8 is the strain with the strongest ability to enrich selenium to the greatest extent while tolerating the inhibitory effect of selenium on its growth.

[0037] The ITS gene sequence of Eurotium cristatum (FCD.8) is shown in SEQ ID NO.1:

[0038] CCTGCGGAAGGATCATTACCGAGTGCGGGCCCTCTGGGTCCAACCTCCCATCCGTGTCTATCTGTACCCTGTTGCTTCGGCGTGGCCACGGCCCGCCGGAGACTAACATTTGAACGCTGTCTGAAGTTTGCAGTCTGAGTTTTTAGTTAAACAATCGTTAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAATTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCACGGCTTGTGTGTTGGGCTTCCGTCCCTGGCAACGGGGACGGGCCCAAAAGGCAGTGGCGGCACCATGTCTGGTCCTCGAGCGTATGGGGCTTTGTCACCCGCTCCCGTAGGTCCAGCTGGCAGCTAGCCTCGCAACCAATCTTTTTAACCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATC。

[0039] Figure 3 The figure shows the colony morphology of Eurotium cristatum at a sodium selenite concentration of 30 μg / mL on PDA medium for FCD.8. Figure 3 In it, A is the colony grown for 3 days. At this time, it can be observed that the colony has grown light yellow hyphae and a small amount of yellow cleistothecia. The selenium-rich colony has more notches at the edge compared to the non-selenium-rich colony, and the edge of the non-selenium-rich colony is not as complete. Figure 3Figure B shows a colony grown for 5 days. At this time, both colonies showed a significant increase in yellow cleistothecia. The center of the selenium-enriched colony was slightly redder than that of the unenriched colony. The colony was significantly smaller, and the number of hyphae and scattered yellow cleistothecia at the edges was significantly less than that of the unenriched colony. At 7 days of growth, the selenium-enriched colony exhibited an overall orange-red coloration due to the addition of selenium. This indicates that the fungus reduced sodium selenite to amorphous selenium (SeO), which accumulated within the colony cells and significantly inhibited its growth. Measurements revealed that the selenium-enriched colonies were approximately 25-30 mm in diameter, with irregular edges and fewer yellow cleistothecia. The unenriched colonies were approximately 75-80 mm in diameter, covered in numerous yellow cleistothecia, and had a darker coloration due to the secretion of a dark-brown pigment in the center.

[0040] Example 2

[0041] A method for preparing microbial selenium-enriched Fuzhuan tea comprises the following steps:

[0042] S1: Dark tea raw material is obtained by withering, withering, rolling, piling, and drying fresh tea leaves. The withering temperature is maintained at 260-280°C, eliminating the grassy smell and softening the tea stems, making them less susceptible to breaking. After rolling for 20-40 minutes, piling can proceed. The piling lasts for 8-10 hours at a temperature of 28-40°C. The drying temperature is 120-130°C, and the moisture content is dried to 10-13%.

[0043] S2 sorts, blends, steams, and ferments the raw dark tea obtained in S1 for a second time. After cooling, a selenium-rich spore solution of Eurotium cristatum is added for fermentation to obtain a fermented material. Sorting includes air separation and color sorting, removing diseased leaves and non-tea inclusions, and selecting an appropriate amount of tea stems for blending with the tea leaves. The steaming time is 5-10 minutes, and a second fermentation is performed. During the fermentation, tea glaze is added and stirred evenly to achieve a final moisture content of 20-30%. After the fermentation, a selenium-rich spore suspension of Eurotium cristatum is added to the tea leaves at a concentration of 1×10 7 CFU / mL, and the inoculum volume was 20mL / kg.

[0044] S3 presses and shapes the fermented material, and cultivates selenium-rich Eurotium cristatum for flowering. After flowering, it is dried and aged to obtain selenium-rich Fuzhuan tea. The tea leaves are pressed into bricks for flowering at a temperature of 26-30°C and a relative humidity of 60-80% for 10-14 days. After flowering, the tea bricks are dried to a moisture content of 9%-10%.

[0045] By adding a pure culture of selenium-rich Eurotium cristatum spore suspension to the first-fermented dark tea, the second-fermentation is carried out. 50 g of dark tea is placed into a fermentation flask, sealed, and sterilized in a high-pressure steam sterilizer at 121 °C for 20 min. Then it is transferred to a laminar flow hood, and the water content is adjusted to 30% with sterile water under a sterile environment. The fermentation flask is placed in a constant temperature and humidity incubator for piling fermentation at 40 °C for 4 h. After the piling fermentation is completed, a suspension of Eurotium cristatum spores at a concentration of 1×10 7 CFU / mL is inoculated under a sterile environment, and the inoculation volume gradient is 100 μL. After inoculation, it is placed in a constant temperature and humidity incubator and fermented for 7 d at 28 °C and a relative humidity of 80%. Then the number of Eurotium cristatum spores and the selenium content of the tea leaves are measured.

[0046] Example 3

[0047] The difference from Example 2 is as follows:

[0048] By adding a pure culture of selenium-rich Eurotium cristatum spore suspension to the first-fermented dark tea, the second-fermentation is carried out. 50 g of dark tea is placed into a fermentation flask, sealed, and sterilized in a high-pressure steam sterilizer at 121 °C for 20 min. Then it is transferred to a laminar flow hood, and the water content is adjusted to 30% with sterile water under a sterile environment. The fermentation flask is placed in a constant temperature and humidity incubator for piling fermentation at 40 °C for 4 h. After the piling fermentation is completed, a suspension of Eurotium cristatum spores at a concentration of 1×10 7 CFU / mL is inoculated under a sterile environment, and the inoculation volume gradient is 200 μL. After inoculation, it is placed in a constant temperature and humidity incubator and fermented for 7 d at 28 °C and a relative humidity of 80%. Then the number of Eurotium cristatum spores and the selenium content of the tea leaves are measured. The rest of the content is the same as that in Example 2.

[0049] Example 4

[0050] The difference from Example 2 is as follows:

[0051] By adding a pure culture of selenium-rich Eurotium cristatum spore suspension to the first-fermented dark tea, the second-fermentation is carried out. 50 g of dark tea is placed into a fermentation flask, sealed, and sterilized in a high-pressure steam sterilizer at 121 °C for 20 min. Then it is transferred to a laminar flow hood, and the water content is adjusted to 30% with sterile water under a sterile environment. The fermentation flask is placed in a constant temperature and humidity incubator for piling fermentation at 40 °C for 4 h. After the piling fermentation is completed, a suspension of Eurotium cristatum spores at a concentration of 1×10 7 CFU / mL is inoculated under a sterile environment, and the inoculation volume gradient is 500 μL. After inoculation, it is placed in a constant temperature and humidity incubator and fermented for 7 d at 28 °C and a relative humidity of 80%. Then the number of Eurotium cristatum spores and the selenium content of the tea leaves are measured. The rest of the content is the same as that in Example 2.

[0052] Example 5

[0053] The difference from Example 2 is as follows:

[0054] By adding the pure culture of selenium-rich Eurotium cristatum spore suspension to the first-piled dark tea, the second-piling fermentation is carried out. 50 g of dark tea is put into a fermentation bottle, sealed, sterilized in a high-pressure steam sterilizer at 121 °C for 20 min, transferred to a laminar flow hood, and the water content is adjusted to 30% with sterile water under a sterile environment. Then the fermentation bottle is placed in a constant temperature and humidity incubator for piling at 40 °C for 4 h. After the piling is completed, the spore suspension of Eurotium cristatum is inoculated at a concentration of 1×10 7 CFU / mL with an inoculation volume gradient of 1000 μL. After inoculation, it is placed in a constant temperature and humidity incubator and fermented for 7 d at 28 °C and a relative humidity of 80%. Then the spore number of Eurotium cristatum and the selenium content of the tea are measured. The rest of the content is the same as that in Example 2.

[0055] Example 6

[0056] The difference from Example 2 is as follows:

[0057] By adding the pure culture of selenium-rich Eurotium cristatum spore suspension to the first-piled dark tea, the second-piling fermentation is carried out. 50 g of dark tea is put into a fermentation bottle, sealed, sterilized in a high-pressure steam sterilizer at 121 °C for 20 min, transferred to a laminar flow hood, and the water content is adjusted to 30% with sterile water under a sterile environment. Then the fermentation bottle is placed in a constant temperature and humidity incubator for piling at 40 °C for 4 h. After the piling is completed, the spore suspension of Eurotium cristatum is inoculated at a concentration of 1×10 7 CFU / mL with an inoculation volume gradient of 2000 μL. After inoculation, it is placed in a constant temperature and humidity incubator and fermented for 7 d at 28 °C and a relative humidity of 80%. Then the spore number of Eurotium cristatum and the selenium content of the tea are measured. The rest of the content is the same as that in Example 2.

[0058] A large inoculation amount of Eurotium cristatum can accelerate the fermentation process and improve the tea quality. However, the inoculation amount should not be too large, otherwise the growth of Eurotium cristatum will be inhibited by competition and there will be a strong mold smell. In addition, the influence of the added selenium source on the selenium content of the tea needs to be considered. Excessive selenium content is likely to bring the risk of excessive selenium intake. As can be seen from Table 1, both the spore number and the selenium content show an upward trend with the increase of the inoculation amount. However, when the inoculation amount is 2000 μL, the selenium content reaches 6.38±0.8 μg / g, exceeding the range of 0.25 - 4.00 μg / g in the agricultural industry standard for selenium-rich tea NY / T 600 - 2002 issued by the People's Republic of China. Therefore, the optimal result is an inoculation amount of 1000 μL / 50 g of tea.

[0059] Table 1 Selenium content and spore number of tea under different inoculation amounts

[0060] Inoculation volume (μL) Selenium content (μg / g) <![CDATA[Sporulation count (10 4 CFU / g)]]> 100 <![CDATA[0.54±0.11 d > <![CDATA[48.33±1.53 d > 200 <![CDATA[0.92±0.04 d > <![CDATA[143.33±5.77 cd > 500 <![CDATA[1.63±0.12 c > <![CDATA[199.33±25.72 c > 1000 <![CDATA[2.51±0.16 b > <![CDATA[433.33±50.33 b > 2000 <![CDATA[6.38±0.80 a > <![CDATA[1362.67±187.09 a >

[0061] According to the characteristics presented during the processing of Fucha tea, the processing process of Fucha tea is divided into four stages: the completion of dark green tea and piling, the initial fermentation stage (0 - 4 days), the middle fermentation stage (4 - 10 days), and the late fermentation stage (10 - 22 days). Samples are taken at 4, 10, and 22 days of fermentation respectively to measure the selenium content in the tea leaves. The selenium content in the fermented tea leaves measured by atomic fluorescence spectrometry can reach 2.123 ± 0.26 μg / g, meeting the standard of selenium-enriched tea. Through subtraction, the conversion rate of the tea leaves to organic selenium is calculated to be 73%, and finally the organic selenium content in the tea leaves is 1.55 ± 0.19 μg / g. From Figure 4 It can be seen that the selenium content is basically stable in the late fermentation stage, while it is relatively high in the early stage. This may be because the spore suspension of Eurotium cristatum added has not been fully absorbed and converted by the tea leaves in the initial fermentation stage.

[0062] Therefore, the present invention adopts the above-mentioned preparation method of a kind of selenium-enriched Fucha brick tea. The inorganic selenium is converted into organic selenium in the form of selenium polysaccharides, selenoamino acids, etc. by the selenium-enriched domesticated Eurotium cristatum, which improves the nutritional value of the Fucha brick tea and the quality of the Fucha brick tea. By controlling the selenium-enriched domestication conditions and fermentation process parameters, the flowering cycle is shortened and the production efficiency is improved, and the quality is more stable.

[0063] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit them. Although the present invention has been described in detail with reference to the preferred embodiments, those of ordinary skill in the art should understand that they can still modify the technical solutions of the present invention or make equivalent replacements, and these modifications or equivalent replacements cannot make the modified technical solutions deviate from the spirit and scope of the technical solutions of the present invention.

Claims

1. A preparation method of selenium-enriched microbial Fuzhuan tea, characterized in that: It includes the following steps: S1: Obtain the raw material of dark tea by subjecting fresh tea leaves to withering, fixation, rolling, the first pile-fermentation, and drying steps; S2: Conduct sorting, blending, steam distillation, and the second pile-fermentation on the raw material of dark tea obtained in S1. After cooling, inoculate with the spore solution of Eurotium cristatum rich in selenium for fermentation to obtain the fermented material. Eurotium cristatum rich in selenium is preserved in the China Center for Type Culture Collection, with the preservation number CCTCC M 2025845, named SXFCD.8, the preservation time is April 21, 2025, and the preservation address is Wuhan University, Wuhan, China; S3: Press and shape the fermented material, cultivate Eurotium cristatum rich in selenium during the flowering process, and after the flowering ends, dry it and age it to obtain the selenium-rich Fuzhuan tea.

2. The preparation method of a microbial selenium-rich Fuzhuan tea according to claim 1, characterized in that: In step S1, the fixation temperature is maintained at 260°C - 280°C until the grassy smell disappears, the tea stalks become soft and are not easily broken.

3. The preparation method of a microbial selenium-enriched Fuzhuan tea according to claim 1, characterized in that: In step S1, roll for 20 - 40 min, and then pile-fermentation can be carried out.

4. The preparation method of a microbial selenium-rich Fuzhuan tea according to claim 1, characterized in that: In step S1, the time of the first pile-fermentation is 8 - 10 h, and the pile temperature is 28 - 40°C; the drying temperature is 120 - 130°C, and dry until the moisture content is 10 - 13%.

5. The preparation method of a microbial selenium-enriched Fuzhuan tea according to claim 1, characterized in that: In step S2, sorting includes winnowing and color sorting, removing diseased leaves and non-tea impurities, and selecting and blending tea stalks and tea leaves.

6. The preparation method of a microbial selenium-rich Fuzhuan tea according to claim 1, characterized in that: In step S2, the steam distillation time is 5 - 10 min, and the second pile-fermentation is carried out. During the pile-fermentation, add tea glaze and stir evenly to make the final moisture content of the tea leaves 20 - 30%.

7. The preparation method of a microbial selenium-enriched Fuzhuan tea according to claim 1, characterized in that: In step S2, after piling up and moistening, a spore suspension of Eurotium cristatum rich in selenium is inoculated into the tea leaves, with a concentration of 1×10 7 CFU / mL and an inoculation amount of 20 mL / kg.

8. The preparation method of a microbial selenium-enriched Fuzhuan tea according to claim 1, characterized in that: In step S2, the nucleotide sequence of the ITS of Eurotium cristatum SXFCD.8 is as shown in SEQ ID NO.

1.

9. The preparation method of a microbial selenium-enriched Fuzhuan tea according to claim 1, characterized in that: In step S3, press the tea into bricks for flowering. The flowering temperature is 26 - 30°C, the relative humidity is 60 - 80%, and the time is 10 - 14 d. After the flowering ends, dry until the moisture content of the tea brick is 9% - 10%.