Heart patch containing tenascin-c, and method of making and use thereof

Abstract

The application provides use of tenascin C in preparation of a drug for promoting controllable regeneration of myocardium or myocardial repair. The application also provides a heart patch containing tenascin C. The application further provides a preparation method of the heart patch. The application also provides use of the heart patch in preparation of a drug for preventing controllable regeneration or myocardial repair. The method of the application can improve the safety of myocardial regeneration and avoid the burden on the body caused by excessive enlargement of the heart.

Description

Technical Field

[0001] This invention belongs to the field of biomedicine and relates to a patch, specifically a cardiac patch containing tendinin C, its preparation method, and its uses. Background Technology

[0002] The number of patients with cardiovascular diseases is showing a rapid upward trend, putting a heavy burden on the public health system (PMID:31746111). Cardiac cardiomyocytes in adult mammals are terminally differentiated cells with extremely limited proliferative capacity. It is difficult to effectively replenish dead cardiomyocytes, resulting in the permanent loss of myocardial functional units and ultimately leading to the development of heart failure (PMID:31587963).

[0003] Current clinical diagnosis and disease management measures have not fundamentally addressed the core issues of heart failure, namely insufficient cardiomyocyte numbers and functional failure (PMID: 34794691). Reactivating cardiomyocyte proliferation can initiate a powerful myocardial regeneration process, with regenerated cardiomyocytes capable of completely replacing damaged myocardial tissue (PMID: 31120819). Hippo / YAP (Yes-associated protein) plays a crucial role in regulating cardiac development and cardiomyocyte proliferation (PMID: 25313964; PMID: 31511517; PMID: 29727635). Activating YAP activity can extend the myocardial regeneration window into adulthood, initiating the proliferation and regeneration of adult cardiomyocytes (PMID: 28581498). However, excessive activation of YAP carries potential risks, potentially leading to abnormally large heart volume and death (PMID: 30773489). YAP activity decreases under space constraints, thus preventing excessive proliferation of organ parenchymal cells and maintaining normal organ size (PMID: 37339629). Therefore, a safe and feasible strategy is urgently needed to effectively constrain the spatial activity of YAP while promoting myocardial regeneration and repair based on YAP activation, thereby achieving controllable cardiac regeneration. Currently, there is no mature method to prevent uncontrolled activation of YAP signals while activating adult cardiac regeneration. This invention proposes a solution to this technological gap.

[0004] Tenasin-C is a large hexameric protein with a capacity of 1.5 million Daltons. Each chain contains different domains, including the assembly domain (TA), EGF-like repeats (EGF-L), fibronectin type III-like repeats (TNIII), and fibrinogen-like globules (FBG). Tenasin C (TNC) is an extracellular matrix glycoprotein. During early embryonic development, TNC is transiently expressed in multiple sites, but its expression level is low in normal adult tissues. The expression distribution and function of TNC during embryonic and adult stages have been reported in the literature (PMID: 21712412), but the expression and function of TNC during myocardial regeneration are unclear, and the role of epicardial-expressed TNC in myocardial regeneration has not been reported. Summary of the Invention

[0005] To address the aforementioned technical problems in the prior art, the present invention provides a cardiac patch containing tendinin C, its preparation method, and its uses. This cardiac patch containing tendinin C, its preparation method, and its uses aim to solve the technical problem that the prior art lacks a suitable method to prevent the uncontrolled activation of YAP signals while promoting adult heart regeneration through activation of the YAP signaling pathway.

[0006] This invention provides the use of tendinin C in the preparation of drugs that promote controlled regeneration or repair of myocardium.

[0007] The present invention also provides the use of tendinin C in the preparation of medicaments for preventing excessive myocardial regeneration or for treating myocardial damage, including myocardial infarction.

[0008] The present invention also provides a cardiac patch containing tendinin C.

[0009] Furthermore, the carrier of the cardiac patch is a mixture of polylactic acid-caprolactone copolymer and chitosan, hydrogel, or biodegradable polymer film.

[0010] The present invention also provides a method for preparing the above-mentioned cardiac patch, comprising the following steps:

[0011] 1) Weigh out polylactic acid-caprolactone copolymer and chitosan, wherein the mass ratio of polylactic acid-caprolactone copolymer to chitosan is 6:(2-6), and then dissolve the mixture of polylactic acid-caprolactone copolymer and chitosan in a mixed solvent of hexafluoroisopropanol and trifluoroacetic acid, wherein the volume ratio of hexafluoroisopropanol and trifluoroacetic acid is (7-12):1, and the mass-volume ratio of the mixture of polylactic acid-caprolactone copolymer and chitosan to the mixed solvent is (5-7) g:100 ml;

[0012] 2) A nanofiber membrane of the material described in step 1) was prepared by electrospinning under the parameters of 15kV working voltage, 50μL / min extrusion rate and 10cm receiving distance, and then the carrier material was obtained by ventilation drying.

[0013] 3) Cut the dried carrier material into 10mm diameter discs, sterilize them by soaking them in a 75% ethanol solution for 20-30 hours, and wash them thoroughly with sterile PBS to remove organic solvent residues, finally obtaining a biocompatible carrier patch.

[0014] 4) The above-mentioned carrier patch is immersed in TNC recombinant protein solution and incubated to achieve effective protein loading, thereby constructing a biologically active functional cardiac patch.

[0015] The present invention also provides the use of the above-mentioned cardiac patch in the preparation of a drug that promotes controlled regeneration or repair of myocardium.

[0016] The present invention also provides the use of the aforementioned cardiac patch in the preparation of medicaments for preventing excessive myocardial regeneration or for treating myocardial damage, including myocardial infarction.

[0017] The present invention also provides the use of AAV9-cTNT-YAP5SA-GFP virus and tendinin C in the preparation of a drug that promotes controlled regeneration or repair of myocardium.

[0018] The present invention also provides the use of AAV9-cTNT-YAP5SA-GFP virus and tendinin C in the preparation of medicaments for preventing excessive myocardial regeneration or for treating myocardial damage, including myocardial infarction.

[0019] The present invention also provides the use of AAV9-cTNT-YAP5SA-GFP virus and tendinin C recombinant protein (TNC recombinant protein) in the preparation of a drug that promotes controlled regeneration or repair of myocardium.

[0020] The present invention also provides the use of AAV9-cTNT-YAP5SA-GFP virus and tendinin C recombinant protein (TNC recombinant protein) in the preparation of a medicament to prevent excessive myocardial regeneration or to treat myocardial injury, including myocardial infarction.

[0021] Furthermore, the sequence of the recombinant tendonin C protein is shown in SEQ ID NO.1.

[0022] The cardiac carrier of the present invention is a biomaterial loaded with the aforementioned TNC protein, including but not limited to mixtures of polylactic acid-caprolactone copolymer (PLCL) and chitosan, hydrogels, and biodegradable polymer films. This biomaterial possesses good biocompatibility and sustained-release properties, enabling stable release and sustained action of the TNC protein. The prepared TNC protein-biomaterial complex is attached to the outer surface of the heart as a coating or dressing, continuously and slowly releasing the TNC protein during cardiac regeneration, and continuously inhibiting local YAP signaling pathway activity. Through the above steps, the present invention can effectively control the rate of cardiomyocyte proliferation and the scale of cardiac regeneration, maintaining the size of the regenerated heart within a normal or near-normal range, and avoiding abnormal myocardial tissue proliferation that could lead to tumor formation or increased mortality.

[0023] The innovation of this invention lies in the fact that it is the first time that the TNC protein, a regulatory factor that inhibits myocardial regeneration, is administered locally to the surface of the heart. By inhibiting the YAP signaling pathway and acting directly on the epicardial region, the controlled regeneration of the heart is achieved. This effectively avoids the side effects that may occur with systemic application of TNC protein and has extremely high safety, targeting, and spatial specificity. It prevents the risk of abnormal cardiac enlargement or cancer and even death caused by excessive cardiac proliferation.

[0024] This invention provides a method for regulating cardiac regeneration using tendinin C and its derivatives. This invention is the first to discover that TNC is an extracellular matrix glycoprotein capable of downregulating the activity of the YAP signaling pathway. Through interaction with ANXA2 or its cofactors, it inhibits YAP entry into the cell nucleus or reduces its transcriptional activity. The core of this method lies in delivering TNC (or its polypeptide fragments, functional analogs, etc.) to the surface of the heart using biomaterials, thereby effectively inhibiting the activity of the local YAP signaling pathway. In this way, YAP activity can be spatially and precisely controlled during cardiac regeneration, avoiding excessive cardiac proliferation and death caused by excessive YAP activity.

[0025] Compared with existing technologies, the beneficial effects of this invention are as follows: by extrinsic regulation of the YAP pathway through tendinin C and its derivatives, the rate and extent of cardiac regeneration are controlled. This method promotes necessary YAP activity and its activated myocardial regeneration while preventing excessive myocardial regeneration, thereby reducing the risk of abnormal cardiac proliferation and death. Particularly in the treatment of acute and chronic heart failure, myocardial strain, myocardial infarction, myocardial fibrosis, myocarditis, and ischemia-reperfusion injury, the method of this invention can improve the safety of myocardial regeneration and avoid the burden on the body caused by excessive cardiac enlargement. The strategy provided by this invention is safe and feasible, offering a new intervention for patients with myocardial injury to prevent uncontrolled myocardial regeneration. Attached Figure Description

[0026] Figure 1 The results showed that TNC was mainly expressed in the epicardium one day after myocardial injury in newborn mice, but not in other cells. Immunofluorescence staining of cardiac tissue from newborn mice on day 3 after myocardial infarction surgery: Sham: sham-operated group; MI: myocardial infarction surgery group; DAPI: blue; TNC: green; WT1: epicardial marker, red; Vimentin: fibroblast marker, red; scale bar = 50 μm.

[0027] Figure 2 A method for constructing epicardial-specific Tnc gene knockout mice was developed. RNA levels were used to validate the knockout efficiency of epicardial cell-specific Tnc gene knockout mice. N=3, P<0.05 indicated statistical significance.

[0028] Figure 3 Epicardial cell-specific knockout of the Tnc gene promotes cardiomyocyte proliferation after myocardial infarction in newborn mice. Compared with wild-type mice, mice with epicardial cell-specific Tnc gene knockout showed enhanced cardiomyocyte proliferation after myocardial infarction. WT (Wild type): wild-type mouse; Wt1-CreERT2-Tnc fl / fl (Wt1-Tnc fl / fl ): Epicardial cell-specific Tnc gene knockout mice. DAPI: blue; α-SA (α-sarcomeric actinin): green, cardiomyocyte marker; Ki67: red, cell proliferation marker; PH3 (Phospho-Histone H3): red, cell mitosis marker; Edu: red, used to detect cell proliferation. N=3, scale bar=50μm, P<0.05 indicates statistical significance.

[0029] Figure 4 The knockout of the Tnc gene specifically targeting epicardial cells resulted in abnormal cardiac enlargement following myocardial injury. H&E staining images represent the abnormal cardiac enlargement after myocardial infarction in epicardial cell-specific Tnc gene knockout mice compared to wild-type mice. Compared to wild-type mice, epicardial cell-specific Tnc gene knockout mice showed a significantly increased heart-to-body weight ratio after myocardial infarction. WT: Wild-type mouse; Wt1-CreERT2-Tnc fl / fl (Wt1-Tnc fl / fl ): Epicardial cell-specific Tnc gene knockout mice; HW / BW: heart weight / body weight. Scale bar = 2 mm. N = 3, P < 0.05 indicates statistical significance.

[0030] Figure 5 Number of cardiomyocytes in a section of myocardial tissue at the largest cross-section of the heart. WT: Wild-type mouse; Wt1-CreERT2-Tncfl / fl (Wt1-Tnc fl / fl ): Epicardial cell-specific Tnc gene knockout mice. CMs: Cardiac cardiomyocytes; N=3, P<0.05 indicates statistical significance.

[0031] Figure 6 Epicardial cell-specific knockout of the Tnc gene leads to disordered cardiomyocyte arrangement after myocardial injury. Representative immunofluorescence images show that, compared to wild-type mice, mice with epicardial cell-specific Tnc gene knockout exhibit more disordered cardiomyocyte arrangement after myocardial infarction. WT: Wild-type mouse; Wt1-CreERT2-Tnc fl / fl (Wt1-Tnc fl / fl ): Epicardial cell-specific Tnc gene knockout mice. DAPI: blue; α-SA: green; WGA (wheat germ agglutinin): red, for myocardial cell membrane staining; scale bar = 50 μm. N = 3, P < 0.05 indicates statistical significance.

[0032] Figure 7 TNC inhibits YAP nuclear translocation. A, Western blot shows that TNC significantly inhibits YAP nuclear translocation. N=3. B, Immunofluorescence staining shows that TNC significantly inhibits YAP nuclear translocation. Control: PBS-treated group; TNC: TNC recombinant protein-stimulated group. DAPI: blue; α-SA: green; Active-YAP: red. Scale bar = 20 μm. N=5, P<0.05 indicates statistical significance.

[0033] Figure 8 The TNC group was shown to inhibit cardiomyocyte proliferation. Immunofluorescence images show that, compared to the control group, the TNC recombinant protein treatment group exhibited a significant decrease in cardiomyocyte proliferation. DAPI: blue; α-SA: green; Ki67: red. Control: PBS-treated group; TNC: TNC recombinant protein-stimulated group. Scale bar = 50 μm. N = 4, P < 0.05 indicates statistical significance.

[0034] Figure 9 Epicardial cell-specific knockout of the Tnc gene resulted in a significant increase in YAP signaling within the cardiomyocyte nucleus. Representative immunofluorescence images show the significantly enhanced YAP signaling in the cardiomyocyte nucleus of mice with epicardial cell-specific Tnc gene knockout compared to wild-type mice. WT: Wild-type mouse; Wt1-CreERT2-Tnc fl / fl (Wt1-Tnc fl / fl ): Epicardial cell-specific Tnc gene knockout mice. DAPI: blue; α-SA: green; Active-YAP: red; Scale bar = 50 μm.

[0035] Figure 10 ANXA2 is an interacting protein of TNC. A, The protein identification table indicates that ANXA2 is one of the interacting proteins of TNC. B, Secondary structure of the ANXA2 protein profile.

[0036] Figure 11 To verify in Co-IP experiments that ANXA2 is an interacting protein of TNC. TNC O / E: TNC gene overexpression.

[0037] Figure 12 TNC can promote the accumulation of ANXA2 on the cardiomyocyte membrane. N=3, P<0.05 indicates that the difference is statistically significant.

[0038] Figure 13 Knocking down Anxa2 can reverse the reduction in YAP nuclear translocation caused by TNC. A. Western blot showed that TNC significantly inhibited YAP nuclear translocation, while gene silencing Anxa2 significantly reversed this effect. N=3. B. Immunofluorescence staining showed that TNC significantly inhibited YAP nuclear translocation, while gene silencing Anxa2 significantly reversed this effect. DAPI: blue; α-SA: green; Active-YAP: red. Control: PBS-treated group; TNC: TNC recombinant protein-stimulated group; TNC+Anxa2 siRNA: TNC recombinant protein-stimulated group plus Anxa2 gene silencing group. Scale bar = 20 μm. N=5, P<0.05 indicates statistical significance.

[0039] Figure 14 Knockdown of Anxa2 reverses the ability of TNC to inhibit cardiomyocyte proliferation. Immunofluorescence images illustrate that knockdown of Anxa2 reverses the ability of TNC to inhibit cardiomyocyte proliferation. DAPI: blue; α-SA: green; Ki67: red. Control: PBS-treated group; TNC: TNC recombinant protein-stimulated group; TNC+Anxa2 siRNA: TNC recombinant protein-stimulated group plus Anxa2 gene silencing group. Scale bar = 50 μm. N = 3, P < 0.05 indicates statistical significance.

[0040] Figure 15 To cover the surface of the heart with a heart patch after myocardial infarction surgery in mice.

[0041] Figure 16 A diagram showing the construction of AAV9-cTNT-YAP5SA-GFP for cardiomyocyte-specific expression of YAP5SA.

[0042] Figure 17YAP5SA overexpression and YAP5SA overexpression combined with TNC cardiac patch promoted cardiomyocyte proliferation in adult mice: compared with the AAV9-cTNT-GFP group, the AAV9-cTNT-YAP5SA-GFP group and the AAV9-cTNT-YAP5SA-GFP+TNC group showed significantly increased cardiomyocyte proliferation after myocardial infarction. AAV9-cTNT-GFP: intravenously injected AAV9-cTNT-GFP group; AAV9-cTNT-YAP5SA-GFP: intravenously injected AAV9-cTNT-YAP5SA-GFP group; AAV9-cTNT-YAP5SA-GFP+TNC: intravenously injected AAV9-cTNT-YAP5SA-GFP combined with TNC recombinant protein patch group. DAPI: blue; α-SA: green; Ki67: red. N=5, five independent fields of view were randomly selected; P<0.05 indicated statistical significance. Scale bar = 50 μm.

[0043] Figure 18 WGA staining was used to visualize the degree of cardiomyocyte disorder. Representative immunofluorescence images show that, compared to AAV9-cTNT-GFP mice, AAV9-cTNT-YAP5SA-GFP mice exhibited significantly increased cardiomyocyte disorder after myocardial infarction. However, the degree of cardiomyocyte disorder was significantly decreased in the AAV9-cTNT-YAP5SA-GFP+TNC group compared to the AAV9-cTNT-YAP5SA-GFP group. AAV9-cTNT-GFP: intravenously injected AAV9-cTNT-GFP group; AAV9-cTNT-YAP5SA-GFP: intravenously injected AAV9-cTNT-YAP5SA-GFP group; AAV9-cTNT-YAP5SA-GFP+TNC: intravenously injected AAV9-cTNT-YAP5SA-GFP group supplemented with a TNC recombinant protein patch. DAPI: blue; WGA: green; scale bar = 50 μm. N = 5, five independent fields of view were randomly selected, and P < 0.05 indicated statistical significance.

[0044] Figure 19 Representative images of H&E staining are shown. Compared with mice in the AAV9-cTNT-GFP group, mice in the AAV9-cTNT-YAP5SA-GFP+TNC group showed a significant decrease in infarct area one week after myocardial infarction surgery. AAV9-cTNT-GFP: intravenously injected AAV9-cTNT-GFP group; AAV9-cTNT-YAP5SA-GFP+TNC: intravenously injected AAV9-cTNT-YAP5SA-GFP group supplemented with TNC recombinant protein patch group, scale bar is 2mm.

[0045] Figure 20The representative Masson's staining diagram shows that, compared with the AAV9-cTNT-GFP group, the cardiac scar area was significantly reduced in the AAV9-cTNT-YAP5SA-GFP+TNC group one week after myocardial infarction. AAV9-cTNT-GFP: intravenously injected AAV9-cTNT-GFP group; AAV9-cTNT-YAP5SA-GFP+TNC: intravenously injected AAV9-cTNT-YAP5SA-GFP group supplemented with TNC recombinant protein patch group. Scale bar is 2 mm. Detailed Implementation

[0046] Example 1: Study on the effects of epicardial TNC expression on myocardial regeneration and myocardial repair

[0047] (1.1) Experimental animals: Wt1-CreERT2-Tnc fl / fl Newborn mice (epidermal-specific Tnc knockout mice) (WT1-CreERT2 purchased from Shanghai Southern Model Biotechnology Co., Ltd.; catalog number: NM-KI-200127; Tnc) fl / fl Mice (purchased from Jicui Pharmaceutical Biotechnology Co., Ltd.; catalog number: T009233) and the corresponding Wt1-CreERT2-Tnc wt / wt Library mice (same as above) and Wt1-CreERT2; RFP ki / wt Epicardial cell-traced mice (RFP-traced mice); R26-CAG-LSL-tdTomato mice (purchased from Hainan Nanfang Model Biotechnology Co., Ltd.; catalog number: NM-KI-225042).

[0048] (1.2) Experimental model: Tamoxifen-inducible gene knockout of Wt1-CreERT2-Tnc was used. fl / fl Mice. After birth, the Tnc gene was specifically knocked out in epicardial cells by administration of Tamoxifen. The newborn mice underwent left coronary artery ligation 3 days after birth.

[0049] (1.3) Experimental grouping: WT sham surgery group; Wt1-CreERT2-Tnc fl / fl Sham surgery group; WT myocardial infarction surgery group; Wt1-CreERT2-Tnc fl / fl Myocardial infarction surgery group.

[0050] (1.4) Detection indicators

[0051] (1.4.1) Analysis of TNC expression during myocardial regeneration: Wt1-CreERT2 and RFP were used. ki / wtEpicardial cell tracing mice were used. Left coronary artery ligation was performed on neonatal and adult mice. Heart tissues were collected from the post-myocardial infarction and sham-operated groups. The spatial distribution characteristics of TNCs during myocardial regeneration were observed by immunofluorescence staining with TNCs and WT1.

[0052] (1.4.2) Measurement of heart weight and total number of cardiomyocytes: Heart tissue was collected from each group 4 weeks after left coronary artery ligation, and the ratio of heart weight to body weight was calculated to assess heart weight. Heart tissue sections from different heart cross sections were stained with α-SA and DAPI. The number of cardiomyocytes was quantitatively analyzed by full-slice scanning combined with CellPose image automatic segmentation technology based on deep machine learning.

[0053] (1.4.3) Assessment of cardiomyocyte hypertrophy: Cardiac tissues were collected from each group 4 weeks after left coronary artery ligation, and the degree of cardiomyocyte hypertrophy was assessed by WGA staining.

[0054] (1.4.4) Assessment of cardiomyocyte proliferation capacity: Cardiac tissues were collected from each group one week after left coronary artery ligation, and cardiomyocyte proliferation was assessed by Ki67, BrdU and pH3 immunofluorescence staining.

[0055] (1.4.5) Assessment of myocardial repair degree and scar tissue condition: Cardiac tissue was collected from each group 4 weeks after left coronary artery ligation. The degree of myocardial repair and scar tissue ratio after left coronary artery ligation were assessed by H&E and Masson's staining.

[0056] (1.4.6) Assessment of cardiomyocyte disorder: Cardiac tissue was collected from each group 4 weeks after left coronary artery ligation. The degree of cardiomyocyte disorder was assessed by α-SA and WGA immunofluorescence staining. The average cardiomyocyte orientation was analyzed using the FibrilTool tool in Image J software to assess the degree of cardiomyocyte disorder.

[0057] (1.5) Experimental results: Immunofluorescence staining showed that one day after myocardial injury, TNC was specifically highly expressed in the epicardium, but not in other cardiac cells. Figure 1 ). Specific Tnc gene knockout mice (Wt1-CreERT2-Tnc) fl / fl ()( Figure 2 The results showed that epicardial-specific knockout of the Tnc gene led to enhanced cardiomyocyte proliferation in newborn mice after myocardial infarction. Figure 3 This also caused an abnormal increase in the weight and volume of the heart. Figure 4 Epicardiac-specific knockout of the Tnc gene leads to an increase in the total number of cardiomyocytes. Figure 5The heart exhibits excessive proliferation. Cardiac cell disorder was assessed by analyzing the average alignment of the long axis of cardiomyocytes. Results showed that the absence of epicardial Tnc led to increased cardiomyocyte disorder. Figure 6 This indicates that epicardial-specific knockout of the Tnc gene leads to abnormal and disordered myocardial proliferation.

[0058] Example 2: Molecular biological mechanism of the effect of epicardial TNC on myocardial regeneration and repair

[0059] (2.1) In vitro experiments.

[0060] (2.1.1) Cells: Primary neonatal rat cardiomyocytes

[0061] Method for extracting primary neonatal rat cardiomyocytes:

[0062] 1) Use sterile scissors to quickly remove the heart from P1–P3 mice (purchased from Shanghai Jessjet Laboratory Animal Co., Ltd.) and rinse it in ice-cold PBS to remove blood.

[0063] 2) Remove the pericardium and excess tissue, preserving the ventricles, and cut the heart into pieces approximately 1mm in size. 3 Small pieces, for later use.

[0064] 3) Place the myocardial tissue block in a digestion solution containing 100 mg / ml collagenase IV and 60 u / ml DNase, and place it in a 37°C water bath for 8–10 minutes each time, gently blowing it over.

[0065] 4) After each round of digestion, collect the supernatant and immediately add culture medium containing 10% FBS to terminate the reaction. Repeat the digestion 5–6 times and combine all supernatants.

[0066] 5) After filtering the combined cell suspension through a 70μm sieve, centrifuge and resuspend in DMEM containing 10% FBS.

[0067] 6) Place the cell suspension in a culture dish and incubate at 37°C for 2 hours to encourage fibroblasts to adhere to the dish.

[0068] 7) Transfer the cardiomyocytes from the supernatant to a culture plate pre-coated with 10 μg / mL Laminin and continue culturing.

[0069] (2.1.2) siRNA used in the experiment:

[0070] ANXA2 siRNA and its control empty vector siRNA (purchased from Jiman Biotechnology Co., Ltd.);

[0071] ANXA2 siRNA positive strand: CCAGUAUGAUGCUUCGGAA(dT)(dT)(SEQ ID NO.5);

[0072] ANXA2 siRNA antisense strand: UUCCGAAGCAUCAUACUGG(dT)(dT)(SEQ ID NO.6).

[0073] (2.1.3) Identification of the interaction between TNC and ANXA2: Proteomics analysis was performed using liquid chromatography-tandem mass spectrometry (LC-MS / MS) to screen for potential interacting proteins of TNC; the interaction between TNC and ANXA2 was verified by co-immunoprecipitation (Co-IP) experiment.

[0074] (2.1.4) Study on TNC / ANXA2 / YAP signaling axis: Using recombinant TNC protein (MCE, USA, catalog number: HY-P700833) (sequence shown in SEQ ID NO.1 (EGF superfamily domain)), primary mouse neonatal cardiomyocytes were co-cultured, and the expression level, activity status and subcellular localization of ANXA2 / YAP in each group were analyzed by Western blot.

[0075] (2.1.5) Analysis of whether TNC regulates cardiomyocyte proliferation under the mediation of ANXA2 / YAP: Using recombinant TNC protein, cardiomyocytes from primary mice were co-cultured, and the proliferation of cardiomyocytes in each group was analyzed by immunofluorescence staining Ki67.

[0076] (2.2) In vivo experimental section

[0077] (2.2.1) Laboratory animals: Same as (1.1)

[0078] (2.2.2) Experimental model: Same as (1.2)

[0079] (2.2.3) Experimental groups: WT myocardial infarction surgery group; Wt1-CreERT2-Tnc group. fl / fl Ten patients underwent surgery for myocardial infarction; Wt1-CreERT2-Tnc fl / fl Myocardial infarction surgery group.

[0080] (2.2.4) Detection indicators

[0081] (2.2.4.1) Analysis of YAP signaling pathway: The subcellular localization and activity level of YAP signaling pathway in cardiomyocytes were analyzed by Western-Blotting and immunofluorescence staining.

[0082] (2.2.4.2) Other detection indicators: Same as (1.4)

[0083] (2.3) Experimental Results: In vitro experiments of this invention showed that TNC inhibited YAP activity and cell proliferation in cardiomyocytes. Figure 7-8 YAP fluorescence staining results of myocardial tissue showed Wt1-CreERT2-Tnc fl / fl Compared to wild-type control mice, YAP signaling was enhanced in the nuclei of cardiomyocytes. Figure 9 This suggests that epicardial TNC expression restricts YAP activity through specific spatiotemporal distribution, thereby anchoring the cardiac boundary and achieving a spatial constraint mechanism for myocardial regeneration. Mass spectrometry results identified Annexin A2 (ANXA2) binding to TNC. Figure 10 Immunoprecipitation experiments confirmed the interaction between TNC and ANXA2. Figure 11 This suggests that TNCs may regulate downstream signaling pathways mediated by ANXA2. TNCs can promote the accumulation of ANXA2 expressed in cardiomyocytes on the cell membrane. Figure 12 Furthermore, reducing YAP nuclear translocation and knocking down ANXA2 can reverse the reduction in YAP nuclear loading caused by TNC. Figure 13 Knocking down ANXA2 can reverse the inhibitory effect of TNC on cardiomyocyte proliferation. Figure 14 This demonstrates that epicardial TNC expression induces YAP aggregation to the cell membrane under the mediation of ANXA2, inhibits YAP nuclear translocation, downregulates YAP activity, and thus inhibits cardiomyocyte proliferation.

[0084] Example 3: Combining a myocardial-targeted YAP-activated AAV9 gene therapy with TNC-carrying cardiac patch technology to explore a novel approach for controlled regeneration of adult myocardium.

[0085] (3.1) Experimental animals: Wild-type C57BL / 6J mice were purchased from Shanghai Jiesjie Experimental Animal Co., Ltd., 8 weeks old, all male or all female.

[0086] (3.2) Construction of a cardiomyocyte-targeting AAV vector: A cardiomyocyte-targeting AAV9 vector was constructed and amplified. The cardiomyocyte-specific promoters cTNT and YAP5SA were cloned into the AAV9 vector, such as... Figure 16 AAV9-cTNT-YAP5SA-GFP and its control empty vector AAV9 (from Heyuan Biotechnology Co., Ltd.)

[0087] The preparation method of AAV9-cTNT-YAP5SA-GFP virus is as follows:

[0088] 1) The empty vector plasmid GL3058 pcAAV-cTNTo-ZsGreen1-WPRE (from Heyuan Biotechnology Co., Ltd.) containing AAV inverted terminal repeats (ITR) and carrying the myocardial specific promoter cTNT was selected as the viral packaging backbone.

[0089] 2) Using molecular cloning technology, a YAP gene fragment (SEQ ID NO.2) containing five serine mutations (S61A, S109A, S127A, S164A, S381A) was inserted downstream of the promoter. Simultaneously, GFP and YAP5SA were linked via the P2A sequence to achieve co-expression of the two proteins.

[0090] 3) After plasmid construction is completed, Sanger sequencing is used to confirm the correctness of the inserted fragment and the mutation site;

[0091] Forward sequencing primers for verifying Flag-YAP5SA overexpression: AGGTGTCCACTCCCAGTTCA (SEQ ID NO.3); Reverse sequencing primers for verifying Flag-YAP5SA overexpression: CACCACGCACAGGTTGAT (SEQ ID NO.4).

[0092] 4) Co-transfect the following three plasmids into HEK293T cells (purchased from ATCC, USA): the YAP5SA AAV plasmid constructed in steps 1)-3), pHelper (providing adenovirus helper function), and pAAV2 / 9 (providing the cap (capsid) and rep (replication) genes of AAV9);

[0093] 5) Collect cells and culture medium 72 hours after transfection, and obtain the total amount of virus by freeze-thaw lysis;

[0094] 6) Purification was performed by density gradient centrifugation of iodixanol;

[0095] 7) Use qPCR to detect viral titers.

[0096] (3.3) Construction of the cardiac patch: A cardiac patch carrying recombinant TNC protein was prepared by dissolving polylactic acid-caprolactone copolymer (PLCL) and chitosan at a mass ratio of 6:4 in a mixed solvent of hexafluoroisopropanol / trifluoroacetic acid (9:1, v / v) to prepare a 6% (w / v) (6g:100ml) PLCL / chitosan composite solution. Nanofiber membranes were prepared using electrospinning technology under optimized parameters of 15kV working voltage, 50μL / min extrusion rate, and 10cm receiving distance. The membranes were then dried to obtain the carrier material. The dried fiber membranes were cut into 10mm diameter discs, sterilized by immersion in 75% ethanol solution for 24 hours, and thoroughly washed with sterile PBS to remove residual organic solvents, ultimately obtaining a biocompatible carrier patch. In experimental applications, the patch is immersed in a TNC recombinant protein solution and incubated overnight at 4°C to achieve effective protein loading, thereby constructing a bioactive functional cardiac patch, such as... Figure 15 .

[0097] (3.4) Model and treatment: The acute myocardial infarction model was simulated by ligation of the left anterior descending coronary artery.

[0098] (3.5) Experimental groups: empty vector control group (intravenous or intramyocardial injection of different titers of empty vector adeno-associated virus AAV9); experimental group overexpressing YAP5SA (SEQ ID NO.2) (intravenous or intramyocardial injection of different titers of YAP5SA-expressing adeno-associated virus AAV9); experimental group overexpressing YAP5SA and fitted with a heart patch carrying TNC recombinant protein (intravenous or intramyocardial injection of different titers of YAP5SA-expressing adeno-associated virus AAV9 and fitted with a heart patch carrying TNC recombinant protein).

[0099] (3.6) Detection indicators: Same as (1.4)

[0100] (3.7) Experimental Results: The cardiac patch containing TNC prepared by electrospinning technology in this invention can firmly adhere to the outer surface of the heart. Figure 15 This invention constructs an AAV9 virus carrying the cardiomyocyte-specific promoter cTNT and the YAP5SA coding sequence. Figure 16 Immunofluorescence staining of myocardial tissue showed that, 3 days after myocardial infarction, the YAP5SA overexpression group and its combination with TNC cardiac patch promoted cardiomyocyte proliferation, while the control AAV9-cTNT-GFP group showed almost no detectable proliferating cardiomyocytes. Figure 17 The myocardial cells in the patch group were more neatly arranged, while those in the unpatched group were significantly disordered. Figure 18The results collected in this invention, one week after myocardial infarction, showed that the AAV9-cTNT-GFP group and the AAV9-cTNT-YAP5SA+TNC group had a smaller infarct area and scar area compared to the control AAV9-cTNT-GFP group. Figures 19-20 The results suggest that cardiac patches containing TNC combined with YAP5SA overexpression have the potential to promote myocardial regeneration and repair in adults, and reduce the risks associated with YAP overactivation.

[0101] Experimental conclusion:

[0102] The experimental results of this invention fully demonstrate its effectiveness and innovation. First, animal experiments confirmed that TNC expressed by epicardial cells spatially and specifically restricts the activity of the YAP signaling pathway, preventing excessive activation of YAP activity and contributing to the controllable regeneration of myocardium.

[0103] Compared with the AAV9-cTNT-GFP group, the AAV9-cTNT-YAP5SA-GFP group and the AAV9-cTNT-YAP5SA-GFP+TNC group promoted the proliferation of adult cardiomyocytes. The experimental results showed that the AAV9-cTNT-YAP5SA-GFP group exhibited excessive and disordered myocardial proliferation. More seriously, this group showed a high mortality rate, suggesting that excessive YAP activation placed a significant burden on the body. Compared to the AAV9-cTNT-YAP5SA-GFP group, the AAV9-cTNT-YAP5SA-GFP+TNC group (TNC-coated patches were prepared as follows: 10 circular patches with a diameter of 10 mm were placed in 1 ml of a 20 μg / ml TNC recombinant protein solution and incubated overnight at 4°C. After overnight incubation, the TNC recombinant protein solution was aspirated, and the concentration of residual TNC protein in the solution was measured to determine whether the TNC recombinant protein was completely adsorbed by the patch) showed a more stable and orderly myocardial regeneration process, with more neatly arranged myocardial tissue and a moderate volume of regenerated myocardial tissue. No animal deaths occurred during the experimental observation period.

[0104] The experimental data above demonstrate that the TNC protein and its domains spatially and specifically inhibit YAP signaling, thus significantly contributing to the controllable regeneration of myocardium. This method effectively avoids the adverse consequences of excessive YAP activation without significantly hindering the proliferation of adult cardiomyocytes induced by YAP activation to repair damaged and necrotic myocardium. Therefore, the feasibility and safety of this invention have been successfully verified experimentally. These data fully support the various limitations of the claims of this invention and provide strong scientific evidence for this invention.

Claims

1. The use of tendinin C in the preparation of drugs to prevent excessive myocardial regeneration.

2. Use of a cardiac patch in the preparation of a medicament for preventing excessive myocardial regeneration, wherein the cardiac patch contains tendinin C, and the carrier of the cardiac patch is any one of a mixture of polylactic acid-caprolactone copolymer and chitosan, hydrogel, or biodegradable polymer film.

3. The use of AAV9-cTNT-YAP5SA-GFP virus combined with tendinin C in the preparation of drugs for treating myocardial infarction.

4. The use of the combination of AAV9-cTNT-YAP5SA-GFP virus and tendinin C recombinant protein in the preparation of drugs for the treatment of myocardial infarction.

5. The use according to claim 4, characterized in that, The sequence of the recombinant tendonin C protein is shown in SEQ ID NO.1.

Images