Plant Specific Insert protein and paclitaxel conjugate as well as preparation method and application of plant Specific Insert protein and paclitaxel conjugate

Abstract

The invention provides a conjugate of a Plant Specific Insert protein and paclitaxel as well as a preparation method and application of the conjugate, and belongs to the technical field of preparation of antitumor drugs. The paclitaxel conjugate disclosed by the invention is obtained by coupling PVGLIG polypeptide and PSI protein with paclitaxel. By virtue of the advantage that the PSI protein has a targeting effect on a cancer cell microenvironment, the targeting property of the paclitaxel is improved, and the toxic and side effects of the paclitaxel are reduced. According to the invention, PVGLIG polypeptide can only be subjected to enzyme digestion by metal matrix protease 2 generated on the surface of cancer cells, so that selective uptake of paclitaxel in tumor cells can be improved. Besides, the paclitaxel is coupled with the water-soluble PSI protein, so that the solubility of the paclitaxel is improved, and the utilization efficiency of the medicine is improved. The paclitaxel conjugate provided by the invention has dual targeting to tumor cells, and has the advantages of high targeting, good solubility, small toxic and side effects and the like.

Description

Technical Field

[0001] The present invention belongs to the technical field of anti-tumor drug preparation, and specifically relates to a conjugate of Plant Specific Insert protein and paclitaxel, and a preparation method and application thereof. Background Art

[0002] Today, the incidence of cancer is increasing, and the disease is becoming more common among younger patients. Therefore, strengthening cancer prevention and control is crucial. While many different anticancer drugs are available, such as paclitaxel (PTX), cisplatin, imatinib, and PD-1 inhibitors, these drugs also have significant drawbacks. These drugs can have significant side effects, be expensive, or only be effective against certain cancers.

[0003] Paclitaxel, a classic anticancer drug, exhibits significant antitumor activity and is primarily used to treat various solid tumors, including breast cancer, ovarian cancer, and lung cancer. However, because its mechanism of action is to inhibit tumor cell division by interfering with microtubule function, its targeting is poor. Consequently, it can also affect normal cells, leading to side effects such as myelosuppression and neurotoxicity. It also produces toxicity to normal tissues (such as the bone marrow, hair follicles, and gastrointestinal tract), limiting its dosage and duration of treatment. Furthermore, paclitaxel is a hydrophobic drug with extremely low solubility in water. This property severely limits its dispersion and transport in aqueous solutions, making it difficult to achieve effective drug delivery via conventional intravenous administration. To overcome this problem, currently commonly used paclitaxel formulations in clinical practice, such as paclitaxel injection, require large amounts of solubilizers such as polyoxyethylene castor oil and ethanol to increase its solubility. However, these solubilizers themselves can also cause a range of adverse reactions. For example, polyoxyethylene castor oil can cause severe allergic reactions, including hypotension, dyspnea, and rashes. This forces some patients to preemptively use antiallergic medications when using paclitaxel formulations, increasing the complexity and cost of treatment. In addition, solubilizers may also change the pharmacokinetic behavior of drugs in the body, affecting the efficacy and safety of drugs. For example, solubilizers may interact with plasma proteins, changing the distribution volume and elimination half-life of drugs, making it difficult to accurately control the concentration of drugs in the body, further affecting the therapeutic effect. Therefore, improving the targeting and solubility of paclitaxel is a key issue that needs to be urgently addressed in the current field of tumor treatment. The development of new paclitaxel formulations with higher targeting and good solubility has important clinical significance and application prospects. Plant Specific Insert (PSI) protein can specifically target phosphatidylserine on the surface of tumor cells, but there are currently no reports on coupling PSI protein to paclitaxel to improve the targeting of paclitaxel. Summary of the Invention

[0004] In view of this, the object of the present invention is to provide a paclitaxel conjugate with high targeting property, good solubility, and low toxicity and side effects, and its preparation method and application.

[0005] In order to achieve the above object of the invention, the present invention provides the following technical solutions:

[0006] The present invention provides a paclitaxel conjugate obtained by conjugating PVGLIG polypeptide and Plant Specific Insert protein (PSI protein) with paclitaxel.

[0007] Preferably, the PSI protein is GL-GGSGGS-PSI with a GGSGGS cofactor tag, and the amino acid sequence of GL-GGSGGS-PSI is shown in SEQ ID NO.1.

[0008] Preferably, the paclitaxel conjugate further comprises succinyl and PEG4-NGL; the succinyl is used as a spacer to connect paclitaxel with the PVGLIG polypeptide to obtain paclitaxel-2’OH-succinyl-PVGLIG; the PEG4-NGL is used as a linker to connect paclitaxel-2’OH-succinyl-PVGLIG with GL-GGSGGS-PSI.

[0009] Preferably, the structural general formula of the paclitaxel conjugate is paclitaxel-2’OH-succinyl-PVGLIG-PEG4-NGL-GL-GGSGGS-PSI.

[0010] The present invention also provides a preparation method of the above paclitaxel conjugate, comprising the following steps: conjugating paclitaxel, PVGLIG polypeptide and PSI protein.

[0011] Preferably, when conjugating paclitaxel and PVGLIG polypeptide, the following steps are included: adding succinyl as a spacer to the 2’OH at the C-terminus of paclitaxel to connect paclitaxel with the PVGLIG polypeptide to obtain paclitaxel-2’OH-succinyl-PVGLIG; connecting paclitaxel-2’OH-succinyl-PVGLIG with PEG4-NGL to obtain paclitaxel-2’OH-succinyl-PVGLIG-PEG4-NGL.

[0012] Preferably, the following steps are further included: adding a TEV protease cleavage site and a GGSGGS cofactor tag to the N-terminus of the PSI protein, and obtaining GL-GGSGGS-PSI after TEV protease cleavage; using AEP enzyme to connect paclitaxel-2’OH-succinyl-PVGLIG-PEG4-NGL and GL-GGSGGS-PSI to obtain the paclitaxel conjugate.

[0013] Preferably, the weight ratio of GL-GGSGGS-PSI, paclitaxel-2’OH-succinyl-PVGLIG-PEG4-NGL, and AEP enzyme is 1:(2.5-5):0.5; the temperature for ligation is 25°C, and the time for ligation is 15 min.

[0014] The present invention also provides the use of the above-mentioned paclitaxel conjugate or the above-mentioned preparation method in the preparation of anti-tumor drugs.

[0015] Preferably, the tumors include lung cancer, glioblastoma, or liver cancer.

[0016] Advantages of the present invention:

[0017] The paclitaxel conjugate provided by the present invention has the advantages of high targeting, good solubility, and low toxicity and side effects. By virtue of the advantage that the PSI protein has a targeting effect on the cancer cell microenvironment, the targeting of paclitaxel is improved, and the toxicity and side effects of paclitaxel are reduced. By virtue of the fact that the PVGLIG polypeptide can only be cleaved by the matrix metalloproteinase 2 (MMP2) produced on the surface of cancer cells, the selective uptake of paclitaxel in tumor cells can be improved.

[0018] In addition, the present invention conjugates paclitaxel with the water-soluble PSI protein, improving the solubility of paclitaxel, thereby improving the utilization efficiency of the drug. Description of the Drawings

[0019] Figure 1 is a recombinant plasmid containing GL-GGSGGS-PSI protein;

[0020] Figure 2 is the sequencing result diagram of the recombinant Escherichia coli strain Rosetta-gami B(DE3)pLysS containing the recombinant plasmid;

[0021] Figure 3 is the protein purification result, where the left figure is the SDS PAGE result of the purification of Trx tag - cleavage site - PSI protein at each stage, and the right figure is the SDS PAGE result of the purification of GL-GGSGGS-PSI protein at each stage;

[0022] Figure 4 is the SDS PAGE result of some tube samples collected by AKTA, where M is the marker, and each number from 1 to 23 represents the tube label;

[0023] Figure 5 is the SDS PAGE result of the concentrated GL-GGSGGS-PSI protein sample. The left column in the figure is the marker, and the right column is the concentrated GL-GGSGGS-PSI protein (abbreviated as PSI);

[0024] Figure 6 Tricine-SDS-PAGE results of the ligation products for different groups;

[0025] Figure 7 Flow cytometry results of the co-localization of A549 cells and PSI. The left figure shows the flow cytometry results, and the right figure shows the statistical results, where **** indicates P < 0.0001;

[0026] Figure 8 Flow cytometry results of the co-localization of U87MG cells and PSI. The left figure shows the flow cytometry results, and the right figure shows the statistical results, where **** indicates P < 0.0001;

[0027] Figure 9 Flow cytometry results of the co-localization of HepG2 cells and PSI. The left figure shows the flow cytometry results, and the right figure shows the statistical results, where **** indicates P < 0.0001;

[0028] Figure 10 Flow cytometry results of the co-localization of 293T cells and PSI;

[0029] Figure 11 Fluorescence microscopy results of the co-localization of A549 and PSI;

[0030] Figure 12 Fluorescence microscopy results of the co-localization of U87MG and PSI;

[0031] Figure 13 Fluorescence microscopy results of the co-localization of HepG2 and PSI;

[0032] Figure 14 Fluorescence microscopy results of the co-localization of 293T cells and PSI;

[0033] Figure 15 Results of the effect of paclitaxel (PTX) on the proliferation of A549 cells;

[0034] Figure 16 Results of the effect of paclitaxel on the proliferation of U87MG cells;

[0035] Figure 17 Results of the effect of paclitaxel on the proliferation of HepG2 cells;

[0036] Figure 18 Effect of paclitaxel and PPP on the proliferation of A549 cells;

[0037] Figure 19 Effect of paclitaxel and PPP on the proliferation of U87MG cells;

[0038] Figure 20Effects of paclitaxel and PPP on the proliferation of HepG2 cells;

[0039] Figure 21 Results of scratch assays of U87MG cells in different groups. From top to bottom, the upper figure shows the photographed results of the scratch assay, and the lower figure shows the migration statistics results at 12 h and 24 h. Among them, ns indicates P≥0.05, ** indicates P<0.01, *** indicates P<0.001, and **** indicates P<0.0001. Detailed implementation manners

[0040] The present invention provides a paclitaxel conjugate obtained by conjugating PVGLIG polypeptide (amino acid sequence as shown in SEQ ID NO.3) and PSI protein with paclitaxel.

[0041] The present invention uses the polypeptide PVGLIG containing a specific cleavage site of MMP2 as a targeting vector and PSI as a targeting protein, and conjugates them with paclitaxel to finally obtain a paclitaxel conjugate with dual targeting to tumor cells, which helps paclitaxel target cancer cells, thereby improving the specificity of paclitaxel and reducing the toxic side effects on other normal cells. In addition, conjugating the water-soluble PSI protein can also increase the solubility of paclitaxel. The paclitaxel conjugate provided by the present invention can specifically release paclitaxel by hydrolysis in the presence of MMP2, has good anti-cancer activity, effectively enhances the drug efficacy, and reduces toxicity. The present invention has no special limitation on the specific sources of the PVGLIG polypeptide, PSI protein, and paclitaxel.

[0042] In the present invention, the PSI protein is GL-GGSGGS-PSI with a GGSGGS cofactor tag, and the amino acid sequence of GL-GGSGGS-PSI is GLGGSGGSSAMAIVSMECKTIVSQYGEMIWDLLVSGVRPDQVCSQAGLCFVDGAQHVSSNIKTVVERETEGSSVGEAPLCTACEMAVVWMQNQLKQEGTKEKVLEYVNQLCEKIP (as shown in SEQ ID NO.1). It has a total of 115 amino acids, a molecular weight of 12.27 kDa, and a theoretical isoelectric point of 4.558. In the present invention, the nucleotide sequence encoding GL-GGSGGS-PSI is GGGCTGGGCGGCAGCGGCGGCAGCAGCGCGATGGCGATCGTTTCCATGGAATGCAAGACTATTGTTTCTCAGTATGGTGAGATGATCTGGGACCTGCTGGTGTCTGGTGTGCGTCCGGACCAGGTGTGTTCTCAGGCAGGTCTGTGCTTCGTGGACGGCGCGCAGCACGTATCCTCCAACATCAAAACCGTTGTTGAGCGCGAGACTGAAGGTTCCAGCGTTGGCGAGGCCCCGCTGTGCACCGCATGCGAGATGGCCGTGGTTTGGATGCAGAACCAGCTGAAACAGGAGGGTACTAAGGAGAAAGTCCTGGAGTACGTTAACCAGCTGTGCGAAAAAATTCCG (as shown in SEQ ID NO.2).

[0043] In the present invention, the paclitaxel conjugate preferably further includes succinyl and PEG4-NGL; succinyl is used as a spacer to connect paclitaxel with the PVGLIG polypeptide to obtain paclitaxel-2’OH-succinyl-PVGLIG; PEG4-NGL is used as a linker to connect paclitaxel-2’OH-succinyl-PVGLIG with GL-GGSGGS-PSI. In the present invention, the structural general formula of the paclitaxel conjugate is paclitaxel-2’OH-succinyl-PVGLIG-PEG4-NGL-GL-GGSGGS-PSI.

[0044] The present invention also provides a method for preparing the above-mentioned paclitaxel conjugate, which includes the following steps: conjugating paclitaxel, the PVGLIG polypeptide, and the PSI protein.

[0045] In the present invention, when coupling paclitaxel and PVGLIG polypeptide, the preferred steps include: adding succinyl as a spacer to the 2'-OH at the C-terminus of paclitaxel, connecting paclitaxel with PVGLIG polypeptide to obtain paclitaxel-2'-OH-succinyl-PVGLIG; connecting paclitaxel-2'-OH-succinyl-PVGLIG with PEG4-NGL to obtain paclitaxel-2'-OH-succinyl-PVGLIG-PEG4-NGL. The specific linking bonds of each part are as follows: the methyl group of butadienyl forms an ester bond with the 2'-OH of paclitaxel through an esterification reaction; the amino group of butadienyl and the carboxyl group of P amino acid form an amide bond; the combination of amino acids between PVGLIG is also through an amide bond; the amino group (-NH2) of G amino acid condenses with the carboxyl group (-COOH) at the end of PEG4 to form an amide bond; the carboxyl group (-COOH) at the end of PEG4 condenses with the α-amino group (-NH2) of N amino acid to form a stable amide bond. The chemical structural formula of paclitaxel-2'-OH-succinyl-PVGLIG-PEG4-NGL is

[0046]

[0047] In the preparation method of the present invention, preferably, the following steps are further included: adding a TEV protease cleavage site and a GGSGGS co-folding tag to the N-terminus of the PSI protein, and obtaining GL-GGSGGS-PSI after cleavage by TEV protease. Specifically, the expression vector is pET-32a(+), with ampicillin resistance, and fusion expression is carried out using the Thioredoxins (Trx) tag carried by the vector itself. The upstream cleavage site is selected as Msc I (to prevent frameshift mutation, a base T is added before the gene sequence of the protein), and the His·Tag and TEV protease cleavage site (the protein sequence is MHHHHHHSSGENLYFQGLGGSGGS, SEQ ID NO. 4) behind the Msc I cleavage site are inserted into the target protein for purification and cleavage, and the gene of the full-length sequence of the PSI protein is inserted behind this sequence. Therefore, the protein obtained after expression is a full-length protein: Trx tag-6xHis-cleavage site-PSI protein, and the GL-GGSGGS-PSI protein can be obtained after cleavage by TEV protease.

[0048] In the present invention, preferably, AEP enzyme is used to ligate paclitaxel-2’OH-succinyl-PVGLIG-PEG4-NGL and GL-GGSGGS-PSI to obtain the paclitaxel conjugate paclitaxel-2’OH-succinyl-PVGLIG-PEG4-NGL-GL-GGSGGS-PSI. In the present invention, the three amino acids of NGL in the PEG4-NGL linker serve as the site for AEP enzyme cleavage and ligation. AEP enzyme can specifically recognize and cleave the carboxyl terminus of asparagine (N) residue, that is, cleave paclitaxel-2’OH-succinyl-PVGLIG-PEG4-NGL-, leaving paclitaxel-2’OH-succinyl-PVGLIG-PEG4-N-. Ligation occurs at the carboxyl terminus of N residue, that is, ligate the N of paclitaxel-2’OH-succinyl-PVGLIG-PEG4-N- and the N-terminal GL of GL-GGSGGS-PSI, thereby obtaining the conjugate paclitaxel-2’OH-succinyl-PVGLIG-PEG4-NGL-GL-GGSGGS-PSI. In short, AEP enzyme first hydrolyzes the C-terminus of N to make NGL become N- and -GL, and AEP enzyme will also form an amide bond between N- and -GL-GGSGGS-PSI through an amide reaction, thereby obtaining the conjugate paclitaxel-2’OH-succinyl-PVGLIG-PEG4-NGL-GL-GGSGGS-PSI.

[0049] In the present invention, the weight ratio of GL-GGSGGS-PSI, paclitaxel-2’OH-succinyl-PVGLIG-PEG4-NGL and AEP enzyme is preferably 1:(2.5 - 5):0.5; the temperature of the ligation is preferably 25°C, and the time of the ligation is preferably 15 min.

[0050] The present invention also provides the application of the above paclitaxel conjugate or the above preparation method in the preparation of anti-tumor drugs. In the present invention, the tumors preferably include lung cancer, glioblastoma or liver cancer.

[0051] The technical solutions provided by the present invention will be described in detail below with reference to the examples, but they should not be construed as limiting the protection scope of the present invention.

[0052] In the following examples, unless otherwise specified, all are conventional methods.

[0053] In the following examples, the materials, reagents, etc. used, unless otherwise specified, can be obtained from commercial channels.

[0054] Example 1

[0055] Preparation of paclitaxel conjugate (paclitaxel-2’OH-succinyl-PVGLIG-PEG4-NGL-GL-GGSGGS-PSI)

[0056] 1. Preparation of recombinant Escherichia coli strain Rosetta-gami B(DE3)pLysS

[0057] Add a TEV protease cleavage site and a GGSGGS folding-assisting tag to the N-terminus of the PSI protein. After TEV protease cleavage, GL-GGSGGS-PSI is obtained. The specific preparation method is as follows: Use pET-32a(+) with ampicillin resistance as the backbone vector, and perform fusion expression using the Thioredoxins (Trx) tag carried by the vector itself. Select Msc I as the upstream cleavage site (add a base T in front of the gene sequence of the protein to prevent frameshift mutation). Connect the His·Tag and TEV protease cleavage site (protein sequence: MHHHHHHSSGENLYFQGLGGSGGS) behind the Msc I cleavage site into the target protein for purification and cleavage, and then connect the gene of the full-length PSI protein sequence behind this sequence. Therefore, the protein obtained after expression is the full-length protein: Trx tag-6xHis-cleavage site-PSI protein. After TEV protease cleavage, the GL-GGSGGS-PSI protein can be obtained. The above process was entrusted to Nanjing Genscript Corporation to synthesize a recombinant plasmid (pET32a-TEV-LGGSGGS-PSI-WT-Ihx, see Figure 1 , order number: C5359QUSG0, backbone vector: pET-32a(+)) containing the GL-GGSGGS-PSI protein (amino acid sequence as shown in SEQ ID NO.1, nucleotide sequence as shown in SEQ ID NO.2).

[0058] Use the heat shock transformation method to transform Figure 1 the recombinant plasmid shown into competent Escherichia coli DH5α cells, spread evenly on a plate containing Ampicillin resistance, and invert the plate and culture it overnight in a 37°C incubator. Sequence the obtained positive clones, and after correct sequencing, obtain a recombinant Escherichia coli strain containing Figure 1 the recombinant plasmid shown.

[0059] After correct sequencing, extract the recombinant plasmid from DH5α and transform it into competent Escherichia coli Rosetta-gami B(DE3)pLysS cells by heat shock method. Specifically: Add Figure 1The recombinant plasmid shown was placed on ice for 30 min, heat-shocked at 42 °C for 90 s, and then placed on ice again for 2 min. Subsequently, 450 μL of LB liquid medium was added, and the mixture was cultured on a shaker at 37 °C for 45 min. After recovery, it was spread on LB solid medium (containing 50 μg / mL ampicillin, 15 μg / mL kanamycin, 34 μg / mL chloramphenicol, and 12.5 μg / mL tetracycline), and cultured in a constant temperature incubator at 37 °C for 48 h. The obtained positive clones were sequenced to obtain the recombinant Escherichia coli strain Rosetta-gami B(DE3)pLysS containing the recombinant plasmid. The sequencing results are shown in Figure 2 .

[0060] 2. Expression of the target protein

[0061] Single clone strains were picked into 5 mL of LB liquid medium and cultured overnight at 37 °C. Then, 4 mL of the bacterial solution was added with glycerol at a final concentration of 20% and stored as a bacterial strain at -80 °C. The remaining bacterial solution was transferred into 50 mL of LB liquid medium and continued to be cultured. When the OD 600 (optical density value at a wavelength of 600 nm) reached 0.6 - 0.8, isopropyl-β-D-thiogalactoside (IPTG) with a final concentration of 500 μM was added to the bacterial solution. After standing and cooling on ice for 10 min, induction expression was carried out overnight at 30 °C, and the expression of the protein was analyzed by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS PAGE).

[0062] After small-scale expression verification, 1 L of culture of the strain was carried out. The bacterial strain stored at -80 °C was taken into 50 mL of LB liquid medium and cultured overnight at 37 °C, then transferred into 1 L of LB liquid medium. When the OD 600 reached 0.6 - 0.8, IPTG with a final concentration of 500 μM was added for induction. After standing on ice for 10 min, induction expression was carried out overnight at 30 °C. After the expression ended, the bacterial solution was centrifuged (4000×g, 10 min, 4 °C), the supernatant liquid medium was poured into the waste liquid recovery bucket, and the bacterial cell precipitate was frozen at -20 °C. All the LB liquid media used above contained four antibiotics: ampicillin (50 μg / mL), kanamycin (15 μg / mL), chloramphenicol (34 μg / mL), and tetracycline (12.5 μg / mL).

[0063] 3. Purification of the target protein

[0064] The cells stored at -20°C were thawed at room temperature. Then, 30 mL of buffer solution A (20 mM Tris, 300 mM NaCl, pH 8.0) was added to every 1 L of cells to resuspend the cells. After that, a high-pressure homogenizer (ATS Industrial Systems) was used to lyse the cells (1000 bar, 3 min). The lysed cell suspension was centrifuged (12,000×g, 35 min, 4°C), and the supernatant was taken and purified using a Ni-NTA affinity chromatography column (Qiagen). The Ni-NTA affinity chromatography column was first equilibrated with buffer solution A (20 mM Tris, 300 mM NaCl, pH 8.0). Then, the sample was added and allowed to bind for 3 h. After washing away non-specifically adsorbed proteins with buffer solution A, elution buffer solution B (20 mM Tris, 300 mM NaCl, 300 mM imidazole, pH 8.0) and buffer solution A were used to prepare imidazole eluents with different concentrations (0, 10, 20, 30, 50, 70, 150, 300 mM) to elute the target protein. The protein obtained at this time was the full-length Trx tag - cleavage site - PSI protein. The SDS-PAGE results of the samples before and after IPTG induction, the supernatant, the precipitate, the flow-through fraction, and the imidazole eluents with different concentrations are shown in Figure 3 the left figure in

[0065] To obtain the target PSI protein (GL-GGSGGS-PSI protein), next, the full-length Trx tag - cleavage site - PSI protein was dialyzed into a solution suitable for TEV enzyme. The dialysis solution was buffer solution C (50 mM Tris, 50 mM NaCl, pH 8.0). After dialysis, TEV enzyme was added at a rate of 25 μL per milligram of protein, and the mixture was left standing in a 30°C incubator for 5 h for enzymatic cleavage. After the protein solution after enzymatic cleavage was allowed to bind to the Ni-NTA affinity chromatography column for another 3 h, the Trx tag protein with His·Tag would bind to the Ni-NTA affinity chromatography column, and the collected effluent was the GL-GGSGGS-PSI protein solution. The SDS-PAGE results of the samples before and after enzymatic cleavage, the flow-through fraction, and the eluents with different concentrations (the eluents were prepared by mixing elution buffer solution B (20 mM Tris, 300 mM NaCl, 300 mM imidazole, pH 8.0) and buffer solution A (20 mM Tris, 300 mM NaCl, pH 8.0) into imidazole eluents with different concentrations (0, 300 mM)) are shown in Figure 3 the right figure in

[0066] The GL-GGSGGS-PSI protein solution was dialyzed using PBS, and then an AKTA protein purifier (Suzhou Ensaisi Intelligent Technology Co., Ltd.) was used to separate and purify proteins with different molecular weights. The AKTA collected 23 tubes of samples, and the SDS-PAGE results of some of the tube samples are shown in Figure 4As shown. The pure GL-GGSGGS-PSI protein was collected and concentrated. The SDS PAGE result of the concentrated GL-GGSGGS-PSI protein sample is as Figure 5 shown. Then it was quickly frozen in liquid nitrogen and the sample was freeze-dried using a vacuum dryer. The freeze-dried powder sample was stored at -80 °C. In subsequent experiments, the GL-GGSGGS-PSI protein was dissolved in ultrapure water, and the absorbance value of the GL-GGSGGS-PSI protein solution at 280 nm was measured using an ultraviolet-visible ultraspectrophotometer (NanoDrop 2000c) to quantify the protein.

[0067] 4. Preparation of Paclitaxel-2’OH-succinyl-PVGLIG-PEG4-NGL

[0068] Succinyl was added to the 2’OH at the C-terminus of paclitaxel as a spacer, and paclitaxel was linked to the PVGLIG polypeptide to obtain paclitaxel-2’OH-succinyl-PVGLIG; paclitaxel-2’OH-succinyl-PVGLIG was linked to PEG4-NGL to obtain paclitaxel-2’OH-succinyl-PVGLIG-PEG4-NGL. The specific method is as follows: The methyl group of butadienyl forms an ester bond with the 2’OH of paclitaxel through an esterification reaction; the amino group of butadienyl and the carboxyl group of P amino acid form an amide bond; the combination of amino acids between PVGLIG is also through an amide bond; the amino group (-NH2) of G amino acid condenses with the carboxyl group (-COOH) at the end of PEG4 to form an amide bond; the carboxyl group (-COOH) at the end of PEG4 condenses with the α-amino group (-NH2) of N amino acid to form a stable amide bond, obtaining paclitaxel-2’OH-succinyl-PVGLIG-PEG4-NGL. Suzhou Kangming Yongrui Biotechnology Co., Ltd. was commissioned to synthesize PTX-2’OH-succinyl-PVGLIG-PEG4-NGL-, and the order number is KMYR2025032121.

[0069] 5. Linking the two parts of GL-GGSGGS-PSI protein (labeled as PSI) and PTX-2’OH-succinyl-PVGLIG-PEG4-NGL (labeled as polypeptide) using AEP enzyme

[0070] The AEP enzyme was used to ligate PTX-2’OH-succinyl-PVGLIG-PEG4-NGL- and GL-GGSGGS-PSI protein. The mass ratio of GL-GGSGGS-PSI protein (abbreviated as PSI): PTX-2’OH-succinyl-PVGLIG-PEG4-NGL- (polypeptide): AEP enzyme was 1:5:0.5, and the ligation condition was 25 °C for 15 min. The successful ligation of the ligation product PTX-2’OH-succinyl-PVGLIG-PEG4-NGL-GL-GGSGGS-PSI (subsequently referred to as PPP) was verified by Tricine-SDS-PAGE.

[0071] Example 2

[0072] The difference from Example 1 was that in step 5, the weight ratios of PSI: polypeptide: AEP were 1:2.5:0.1, 1:2.5:0.25, 1:2.5:0.5, 1:5:0.1, 1:5:0.25, 1:5:0.5 respectively. At the same time, PSI: polypeptide: ddH2O with corresponding dosage ratios was set as the control group, and the rest were the same as Example 1. The Tricine-SDS-PAGE results of the ligation products obtained in Example 1 and this Example 2 were as Figure 6 shown.

[0073] Example 3

[0074] Targeting experiment of the GL-GGSGGS-PSI protein (abbreviated as PSI) obtained in Example 1

[0075] 1. FITC-labeled PSI

[0076] (1) Prepare FITC: Dissolve 1 mg of FITC powder with 1 mL of FITC diluent and mix well to fully dissolve;

[0077] (2) Dissolve 2 mg of PSI with the dissolved 1 mL of FITC powder and mix quickly;

[0078] (3) React in the dark in a 37 °C incubator for 90 min;

[0079] (4) Add 0.5 mL - 1 mL of FITC coupling buffer to the column and centrifuge at 1000 g for 2 min to remove the storage buffer. Repeat the above steps five times, and discard the lower layer liquid after each centrifugation;

[0080] (5) Place the desalting column in a new centrifuge tube, slowly drip PSI onto the middle of the resin, and centrifuge at 1000 g for 6 min. The solution in the centrifuge tube collected is the FITC-labeled PSI with a concentration of 2 mg / mL.

[0081] 2. Quantitative analysis of the co-localization behavior of FITC-labeled PSI on the cell membrane by flow cytometry

[0082] Digest the human alveolar basal epithelial cells of lung cancer (A549), human brain astroglioblastoma cells (U87MG), and human hepatoma cells (HepG2) in the logarithmic growth phase into single cells with 0.25% trypsin digestion solution, resuspend them with complete medium, and adjust the cell density to 5×10 5 / mL. Inoculate 1 mL of cell suspension into each well, that is, 5×10 5 cells into a 6-well plate.

[0083] Place A549, U87MG, and HepG2 in a 6-well plate and culture them overnight in a carbon dioxide incubator. Dilute the successfully FITC-labeled PSI to a final concentration of 5 μM with F12K (corresponding to A549 cells), MEM (corresponding to U87MG cells), and DMEM (corresponding to HepG2 cells) media containing 10% FBS at two pH values (7.4 and 6.5). The blank control is PSI without FITC labeling. Incubate for 0.5 h. After washing with PBS, collect the cells and analyze the co-localization behavior of PSI protein using a flow cytometer.

[0084] The results are as Figures 7 - 9 shown. It can be seen that the three types of tumor cells, A549, U87MG, and HepG2, can target the surface of PSI on the tumor cell membrane under the conditions of pH = 6.5 and pH = 7.4.

[0085] Digest the somatic cell 293T in the logarithmic growth phase into single cells with 0.25% trypsin digestion solution, resuspend them with complete medium, and adjust the cell density to 5×10 5 / mL. Inoculate 1 mL of cell suspension into each well, that is, 5×10 5 cells into a 6-well plate.

[0086] Place 293T in a 6-well plate and culture it overnight in a carbon dioxide incubator. Dilute the successfully FITC-labeled PSI to a final concentration of 5 μM with DMEM medium containing 10% FBS at pH 7.4. The blank control is PSI without FITC labeling. Incubate for 0.5 h. After washing with PBS, collect the cells and analyze the co-localization behavior of PSI protein using a flow cytometer.

[0087] The results are as Figure 10 shown. It can be seen that 293T cells cannot target the surface of PSI on the tumor cell membrane under the condition of pH = 7.4.

[0088] 3. Qualitative analysis of the co-localization behavior of PSI protein on the cell membrane by fluorescence microscopy

[0089] Digest the U87MG, A549, and HepG2 cells in the logarithmic growth phase with 0.25% trypsin digestion solution into single cells, resuspend them with complete medium, and adjust the cell density to 1×10 5 / mL. Inoculate 500 μL of cell suspension into each well, that is, 5×10 4 cells into a 24-well plate.

[0090] Place A549, U87MG, and HepG2 in a 24-well plate and incubate overnight in a carbon dioxide incubator. Dilute the successfully FITC-labeled PSI to a final concentration of 5 μM using two pH (7.4 and 6.5) F12K, MEM, and DMEM media containing 10% FBS. The blank control is PSI without FITC labeling. Incubate for 0.5 h. Fix with formaldehyde at room temperature for 15 min. After washing with PBS, incubate the cells with Dil at 37 °C for 5 min. After washing with PBS, incubate with DAPI at room temperature for 5 min. After washing with PBS, observe and collect images of each treatment group through an immunofluorescence microscope.

[0091] The results are as Figures 11 - 13 shown. It can be seen that the three types of tumor cells, A549, U87MG, and HepG2, can target the surface of PSI on the tumor cell membrane under the conditions of pH = 6.5 and pH = 7.4.

[0092] Digest the somatic cell 293T in the logarithmic growth phase with 0.25% trypsin digestion solution into single cells, resuspend them with complete medium, and adjust the cell density to 1×10 5 / mL. Inoculate 500 μL of cell suspension into each well, that is, 5×10 4 cells into a 24-well plate.

[0093] Place the somatic cell 293T in a 24-well plate and incubate overnight in a carbon dioxide incubator. Dilute the successfully FITC-labeled PSI to a final concentration of 5 μM using DMEM medium with pH 7.4 containing 10% FBS. The blank control is PSI without FITC labeling. Incubate for 0.5 h. Fix with formaldehyde at room temperature for 15 min. After washing with PBS, incubate the cells with Dil at 37 °C for 5 min. After washing with PBS, incubate with DAPI at room temperature for 5 min. After washing with PBS, observe and collect images of the cells through an immunofluorescence microscope.

[0094] The results are as Figure 14 shown. It can be seen that the 293T cells cannot target the surface of PSI on the tumor cell membrane under the condition of pH = 7.4.

[0095] Example 4

[0096] PPP activity experiment obtained in Example 1

[0097] 1. Detection of the effect of paclitaxel on cell proliferation by CCK8 method

[0098] Digest the log-phase U87MG, A549, and HepG2 cells into single cells with 0.25% trypsin digestion solution, resuspend them with complete medium, and adjust the cell density to 5×10 4 / mL. Inoculate 100 μL of cell suspension per well, that is, 5×10 3 cells into a 96-well plate.

[0099] Incubate A549, U87MG, and HepG2 in a 96-well plate overnight. Dilute 10 mM paclitaxel to 2 μM with the corresponding cell medium containing 10% FBS (F12K medium for A549 cells, MEM medium for U87MG cells, and DMEM medium for HepG2 cells), and gradually dilute it 5-fold. Add 100 μL of the diluted paclitaxel to each well, place it in a carbon dioxide incubator and incubate for 24 h, then add 10 μL of CCK8 and incubate for 30 min. Take out the culture plate, put it into an enzyme-linked immunosorbent assay (ELISA) reader, set the parameters, and detect the OD value of each well at 450 nm. Draw the cell proliferation curve using Prism 10.1.2.

[0100] The results are as Figures 15 - 17 shown. The maximum concentration of PPP for the subsequent experiment was determined to be 0.5 μM by the IC 50 value of A549, U87MG, and HepG2.

[0101] 2. Detection of the effect of PPP obtained in Example 1 on cell proliferation by CCK8 method

[0102] Digest the log-phase U87MG, A549, and HepG2 cells into single cells with 0.25% trypsin digestion solution, resuspend them with complete medium, and adjust the cell density to 5×10 4 / mL. Inoculate 100 μL of cell suspension per well, that is, 5×10 3 cells into a 96-well plate.

[0103] Incubate A549, U87MG, and HepG2 in a 96-well plate overnight. Dilute 10 mM paclitaxel (PTX) and PPP to 0.5 μM with two pH values (7.4 and 6.5) of the corresponding cell medium containing 10% FBS (F12K medium for A549 cells, MEM medium for U87MG cells, and DMEM medium for HepG2 cells), and gradually dilute it 2-fold. Add 100 μL of the diluted complex to each well, place it in a carbon dioxide incubator and incubate for 24 h, then add 10 μL of CCK8 and incubate for 30 min. Take out the culture plate, put it into an ELISA reader, set the parameters, and detect the OD value of each well at 450 nm. Draw the cell proliferation curve using Prism 10.1.2.

[0104] The results are as Figures 18 - 20 shown. By comparing the IC 50 values of PTX and PPP, it can be found that the IC 50 values of PPP in all groups are less than those of PTX, proving that the efficacy and targeting of PPP are significantly better than those of PTX.

[0105] Example 5

[0106] Wound healing assay

[0107] Digest the U87MG cells in the logarithmic growth phase into single cells with 0.25% trypsin digestion solution, resuspend them with complete medium and adjust the cell density to 5×10 5 / mL. Inoculate 1 mL of cell suspension into each well, that is, 5×10 5 cells into a 6-well plate.

[0108] Incubate U87MG in a 6-well plate overnight. After the cells in the 6-well plate adhere to the wall, use a 10 μL sterile pipette tip to scratch vertically in the middle of each well. Then aspirate the culture medium, add PBS buffer to gently wash the cells three times to remove the scratched cell debris. The force during scratching should be uniform and the line should be as straight as possible. Dilute 10 mM paclitaxel, PSI (GL-GGSGGS-PSI protein obtained in Example 1), and PPP (obtained in Example 1) to 0.5 μM with a medium (MEM medium) containing 1% FBS at pH 7.4. Use a microscope to detect and photograph the migration phenomenon at 0 h, 12 h, and 24 h respectively. The group without adding exogenous substances to the medium was used as the control group (Control).

[0109] The results are as Figure 21 shown. The wound healing assay proves that PSI hardly hinders cell migration, and PPP has a stronger inhibitory effect on the metastasis of cancer cells U87MG compared with PTX.

[0110] The above are only the preferred embodiments of the present invention. It should be noted that for those of ordinary skill in the art, without departing from the principle of the present invention, several improvements and modifications can be made, and these improvements and modifications should also be regarded as the protection scope of the present invention.

Claims

1. A paclitaxel conjugate, characterized in that, It is obtained by conjugating PVGLIG polypeptide and PSI protein with paclitaxel.

2. The paclitaxel conjugate according to claim 1, wherein The PSI protein is GL-GGSGGS-PSI with a GGSGGS cofactor tag, and the amino acid sequence of GL-GGSGGS-PSI is shown in SEQ ID NO.

1.

3. The paclitaxel conjugate according to claim 2, wherein The paclitaxel conjugate also includes succinyl and PEG4-NGL; the succinyl serves as a spacer to connect paclitaxel with the PVGLIG polypeptide to obtain paclitaxel-2’OH-succinyl-PVGLIG; the PEG4-NGL serves as a linker to connect paclitaxel-2’OH-succinyl-PVGLIG with GL-GGSGGS-PSI.

4. The paclitaxel conjugate according to claim 3, wherein The structural general formula of the paclitaxel conjugate is paclitaxel-2’OH-succinyl-PVGLIG-PEG4-NGL-GL-GGSGGS-PSI.

5. The preparation method of the paclitaxel conjugate according to any one of claims 1 to 4, characterized in that, It includes the following steps: conjugating paclitaxel, PVGLIG polypeptide and PSI protein.

6. The preparation method according to claim 5, wherein When conjugating paclitaxel and PVGLIG polypeptide, it includes the following steps: adding succinyl as a spacer to the 2’OH at the C-terminus of paclitaxel to connect paclitaxel with the PVGLIG polypeptide to obtain paclitaxel-2’OH-succinyl-PVGLIG; connecting paclitaxel-2’OH-succinyl-PVGLIG with PEG4-NGL to obtain paclitaxel-2’OH-succinyl-PVGLIG-PEG4-NGL.

7. The preparation method according to claim 6, characterized in that, It also includes the following steps: adding a TEV protease cleavage site and a GGSGGS cofactor tag to the N-terminus of the PSI protein, and obtaining GL-GGSGGS-PSI after TEV protease cleavage; using AEP enzyme to connect paclitaxel-2’OH-succinyl-PVGLIG-PEG4-NGL and GL-GGSGGS-PSI to obtain the paclitaxel conjugate.

8. The preparation method according to claim 7, characterized in that The weight ratio of GL-GGSGGS-PSI, paclitaxel-2’OH-succinyl-PVGLIG-PEG4-NGL and AEP enzyme is 1:(2.5-5):0.5; the temperature of the conjugation is 25°C and the time of the conjugation is 15 min.

9. Use of the paclitaxel conjugate according to any one of claims 1-4 or the preparation method according to any one of claims 5-8 in the preparation of an anti-tumor drug.

10. The application according to claim 9, wherein The tumors include lung cancer, glioblastoma or liver cancer.

Images