Preparation and application of Fc synergistic tilapia mossambica streptococcus bigeminy nanocellulose immersion vaccine
By preparing a dichotomous nanocellulose immersion vaccine, combined with the recombinant protein rSSF of S. agalactiae and S. iniae, the prevention and control problems of tilapia streptococci disease were solved and efficient immune protection effect was achieved.
Patent Information
- Application Number
- CN202510740144.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-06-05
- Publication Date
- 2025-08-01
AI Technical Summary
The prior art is difficult to effectively prevent and control streptococci disease caused by Streptococcus alactis and Streptococcus dolphin in tilapia farming, and traditional vaccines cannot meet the needs of cross-infection of multiple pathogens.
A Fc-stimulated Streptococcus tilapia di-nanocellulose immersion vaccine was prepared, and the di-recombinant protein rSSF was constructed by screening S. agalactiae's Sip protein and S. iniae's Srr protein fragments were used to construct the di-recombinant recombinant protein rSSF, and combined with bacterial nanocellulose to form a di-subunit nanocarrier vaccine, achieving large-scale simple and rapid immunization.
This vaccine has a good protective effect after immunizing tilapia, significantly improves serum antibody levels, reduces infection mortality, provides effective prevention and control of streptococcal disease, and has good cross-immunogenicity and protective performance.
Smart Images

Figure CN120399095A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the field of biotechnology, and particularly to the preparation and application of an Fc-enhanced tilapia streptococcus bivalent nanocellulose immersion vaccine. Background Art
[0002] As a farmed variety strongly recommended by the Food and Agriculture Organization of the United Nations and an important source of animal protein, tilapia has become the second largest farmed fish in the world. As the largest tilapia farming and supplying country in the world, China's annual output accounts for about one-third of the world's total output. However, with the increase in farming scale and density, streptococcosis mainly caused by Streptococcus agalactiae and Streptococcus iniae has a mortality rate of over 80%, which has the greatest impact on the tilapia farming industry. Vaccination is a greener, safer, and more effective method for preventing and treating fish diseases as an alternative to antibiotics and chemical drugs.
[0003] Fish streptococci have characteristics such as a large number of serotypes and high variability. Traditional vaccines prepared based on whole bacteria can no longer meet the prevention and control requirements. On the contrary, genetic engineering vaccines based on screening protective antigens with strong immunogenicity and high conservation have received increasing attention and favor. In aquaculture, there are multiple pathogen cross-infections. Centered on fish, the development of combined vaccines for multiple diseases can better meet the immunoprevention and control needs of aquatic animals. Summary of the Invention
[0004] The purpose of the present invention is to provide the preparation and application of an Fc-enhanced tilapia streptococcus bivalent nanocellulose immersion vaccine to solve the problems existing in the above-mentioned prior art.
[0005] To achieve the above purpose, the present invention provides the following solutions: One of the technical solutions of the present invention is a bivalent recombinant protein rSSF of Streptococcus agalactiae and Streptococcus iniae, and the amino acid sequence of the recombinant protein rSSF is shown in SEQ ID NO.1.
[0006] Another technical solution of the present invention is a DNA molecule encoding the bivalent recombinant protein rSSF, and the nucleotide sequence of the DNA molecule is shown in SEQ ID NO.2.
[0007] Another technical solution of the present invention is a recombinant expression vector, including the DNA molecule.
[0008] Another technical solution of the present invention is a recombinant strain, containing the recombinant expression vector.
[0009] Another technical solution of the present invention is the application of the bivalent recombinant protein rSSF in the preparation of a vaccine for preventing and / or treating streptococcosis.
[0010] Sixth technical solution of the present invention, a dual subunit nano - carrier vaccine for preventing and / or treating streptococcal disease, including the dual recombinant protein rSSF.
[0011] Seventh technical solution of the present invention, a preparation method of the dual subunit nano - carrier vaccine, comprising the following steps: mixing and reacting the recombinant protein rSSF with a cellulose nano - suspension, centrifuging to collect the precipitate after the reaction, and dissolving the precipitate to prepare the nano - carrier vaccine.
[0012] Based on the above - mentioned technical solutions, the present invention has the following technical effects: First, on the basis of a large number of analyses and tests, the present invention screened a protein fragment SSF with good immunogenicity and high consistency from the Sip protein of S. agalactiae and the Srr protein of S. iniae. It has better cross - immunogenicity and cross - protection performance compared with the whole Sip and Srr proteins. After immunizing tilapia with the dual - subunit nano - carrier vaccine prepared based on the rSSF protein for 28 days and then challenging them with suspensions of Streptococcus agalactiae and Streptococcus iniae, the relative immune protection rates are 71.43% and 64.29% respectively.
[0013] Second, the constructed bacterial nano - cellulose - based vaccine delivery system can achieve the goal of large - scale, simple and rapid vaccination of fry through immersion immunization, greatly improving the effect of immersion immunization, realizing the industrialization of commercial fishery vaccines represented by tilapia streptococcal vaccines, and also laying a theoretical foundation and providing new research ideas for the research and application of nano - delivery genetic engineering vaccines for other aquatic animals, which is of great significance for the sustainable development of fishery and the safe production of aquatic products.
[0014] On the basis of a large number of analyses and tests, the present invention screened a protein fragment SSF with good immunogenicity and high consistency from the Sip protein of S. agalactiae and the Srr protein of S. iniae, obtained the dual recombinant protein rSSF through prokaryotic expression, and connected it with bacterial nano - cellulose to prepare a tilapia streptococcal dual - subunit nano - carrier vaccine. Research shows that the vaccine is safe and effective and can produce good protective effects after immunizing tilapia. Brief Description of the Drawings
[0015] In order to more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required in the embodiments. Obviously, the drawings in the following description are only some embodiments of the present invention. For those of ordinary skill in the art, without creative efforts, other drawings can be obtained based on these drawings.
[0016] Figure 1Identification results of the recombinant expression plasmid pET28a-SSF. Among them, M1: DL2000 Plus DNA Marker; 1: PCR result of the SSF gene; 2: Identification of the pET28a-SSF plasmid by double digestion with Nco I + Sac I; 3: Identification of the pET28a-SSF plasmid by double digestion with BamH I + Sac I; 4: Identification of the pET28a-SSF plasmid by double digestion with Nco I + BamH I; M2: DL10000 DNA Marker.
[0017] Figure 2 SDS-PAGE detection of the dual recombinant protein rSSF. Among them, M1: Protein Marker; 1: Supernatant of uninduced BL21(pET28a); 2: Precipitate of uninduced BL21(pET28a); 3: Supernatant of induced BL21(pET28a); 4: Precipitate of induced BL21(pET28a); 5: Supernatant of uninduced BL21(pET28a-SSF); 6: Precipitate of uninduced BL21(pET28a-SSF); 7: Supernatant of induced BL21(pET28a-SSF); 8: Precipitate of induced BL21(pET28a-SSF).
[0018] Figure 3 Western blot detection of the purified dual recombinant protein rSSF. Among them, A is the SDS-PAGE analysis of the rSSF protein; B is the specific binding reaction of the rSSF protein with mouse anti-His antibody; C is the specific binding reaction of the rSSF protein with rabbit anti-S.agalactiae antibody; D is the specific binding reaction of the rSSF protein with rabbit anti-S. iniae antibody. Among them, lane M is the Protein Marker; lane 1 is the purified rSSF protein.
[0019] Figure 4 Detection of the serum antibody levels of tilapia soaked and immunized in different groups. Different superscript letters indicate significant differences (p < 0.05).
[0020] Figure 5 Survival rates and relative protection rates of tilapia in different immunized groups after being challenged and infected with S. agalactiae and S. iniae. Among them, A is the survival rates and relative protection rates of tilapia in different groups after being challenged and infected with S. agalactiae; B is the survival rates and relative protection rates of tilapia in different groups after being challenged and infected with S. iniae. Specific implementation manners
[0021] The various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and implementation schemes of the present invention.
[0022] It should be understood that the terms described in the present invention are only for describing specific embodiments and are not used to limit the present invention. Additionally, for the numerical ranges in the present invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Each intermediate value within any stated value or stated range, as well as each smaller range between any other stated value or intermediate value within the stated range, is also included in the present invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.
[0023] Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by those of ordinary skill in the art to which the present invention pertains. Although the present invention only describes preferred methods and materials, any methods and materials similar or equivalent to those described herein can also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials related to the said documents. In case of conflict with any incorporated document, the content of this specification shall prevail.
[0024] Without departing from the scope or spirit of the present invention, various improvements and changes can be made to the specific embodiments of the present invention specification, which are obvious to those skilled in the art. Other embodiments obtained from the specification of the present invention are obvious to those skilled in the art. The specification and examples of this application are merely exemplary.
[0025] Regarding the use of "comprising", "including", "having", "containing", etc. herein, they are all open-ended terms, meaning including but not limited to.
[0026] The technical solutions described in the present invention are all conventional solutions in the art unless otherwise specified. The reagents or raw materials used are all purchased from commercial channels or have been publicly disclosed unless otherwise specified.
[0027] An embodiment of the present invention provides a dual recombinant protein rSSF of Streptococcus agalactiae and Streptococcus iniae, and the amino acid sequence of the recombinant protein rSSF is shown as SEQ ID NO.1.
[0028] An embodiment of the present invention also provides a DNA molecule encoding the dual recombinant protein rSSF, and the nucleotide sequence of the DNA molecule is shown as SEQ ID NO.2.
[0029] An embodiment of the present invention also provides a recombinant expression vector, including the DNA molecule.
[0030] In some specific embodiments, the recombinant vector is obtained by cloning and ligating the DNA molecule to the pET-28a expression vector to obtain the recombinant expression vector pET28a-SSF.
[0031] The embodiment of the present invention also provides a recombinant strain containing the recombinant expression vector.
[0032] The embodiment of the present invention also provides the application of the dual recombinant protein rSSF in the preparation of a vaccine for preventing and / or treating streptococcal disease.
[0033] In some specific embodiments, the streptococcal disease includes streptococcal disease caused by Streptococcus agalactiae and / or Streptococcus iniae.
[0034] The embodiment of the present invention also provides a dual subunit nano-vector vaccine for preventing and / or treating streptococcal disease, including the dual recombinant protein rSSF.
[0035] The embodiment of the present invention also provides a preparation method of the dual subunit nano-vector vaccine, including the following steps: mixing and reacting the recombinant protein rSSF with a cellulose nano-suspension, centrifuging to collect the precipitate after the reaction, and dissolving the precipitate to prepare the nano-vector vaccine.
[0036] In some specific embodiments, the concentration of the dual recombinant protein rSSF in the dual subunit nano-vector vaccine is 20 mg / ml.
[0037] In some specific embodiments, the main antigenic epitope regions of Sip and Srr proteins are screened by online antigenic epitope prediction, and fragments with higher consistency are selected according to the amino acid sequence alignment results. Targeting the Fc receptor on the surface of antigen-presenting cells, the recombinant Escherichia coli BL21 (pET28a-SSF) expressing the dual recombinant protein rSSF is constructed through a linker sequence; the recombinant Escherichia coli BL21 (pET28a-SSF) is fermented, expressed, and purified to prepare the rSSF protein.
[0038] In some specific embodiments, the preparation method of the cellulose nano-suspension includes: (1) Carboxylation of bacterial cellulose: Mix wet bacterial cellulose with TEMPO, sodium bromide, and sodium hypochlorite in proportion, stir at room temperature for 12 h (control the pH at about 10.5), and add an appropriate amount of absolute ethanol to terminate the reaction.
[0039] (2)Preparation of carboxylated bacterial nanocellulose BNC: The above reaction solution was filtered with distilled water until pH≤8. 70% concentrated sulfuric acid was mixed with the filtered cellulose, and the mixture was heated and stirred at 50 °C for 2 h to prepare carboxylated nanocellulose with relatively uniform size (the nanosize was mainly concentrated between 200 - 300 nm). Distilled water was added to terminate the reaction. Dialysis (pH near neutral) and freeze-drying were carried out.
[0040] (3)BNC was mixed with EDAC and NHS in proportion and stirred at room temperature in MES buffer (pH = 6.0) for 4 h. An appropriate amount of mercaptoethanol was added to terminate the reaction.
[0041] (4)An amount of rSSF protein equal to that of BNC was resuspended in phosphate buffer (pH = 7.2), and then mixed with the BNC reaction solution at a ratio of protein resuspension: BNC reaction solution = 1:1 (V / V), and stirred at room temperature for 4 h.
[0042] (5)The reaction product was dialyzed with a dialysis bag with a cut-off molecular weight of 10,000 for 48 h, and the product was freeze-dried with a freeze dryer to obtain a solid powder.
[0043] The bivalent subunit vaccine of the present invention significantly improved the serum antibody level of tilapia, significantly reduced the mortality rate of tilapia after infection with Streptococcus agalactiae and Streptococcus iniae, had a good immune protection effect against streptococcus infection in tilapia, and could be used as a potential candidate vaccine for tilapia to resist streptococcus infection, providing new ideas and effective options for the immune prevention and control of tilapia streptococcosis.
[0044] Example 1
[0045] The antigenic epitopes of the amino acid sequences corresponding to the Sip protein of S. agalactiae (NCBI accession number: AKI94449.1) and the Srr protein of S. iniae (NCBI accession number: AGM97982.1) were predicted by the Bepipred linear epitope prediction program (http: / / tools.immuneepitope.org / bcell / ). Fragments with relatively high similarity and antigenic epitopes were taken respectively, targeting the Fc receptor, and the sequences were connected with the linker sequences of EAAAK and GGGGS to construct and express the bivalent recombinant protein rSSF.
[0046] The amino acid sequence of the bivalent recombinant protein rSSF is shown in SEQ ID NO.1, and the nucleotide sequence encoding the bivalent recombinant protein rSSF is shown in SEQ ID NO.2.
[0047] SEQ ID NO.1: MGHHHHHHKYGDTLSVISEAMSIDMNVLAEAAAKSIYGPANTWNAMPDRGGVTANHYDHVHVSFNKEAAAKSASMSESMSTSESASTSQSESASNSESLSTSESISTSQSESTSLSESMSTSESVSTSQSESASTSGGGGSGGGGSPPPPPFKQNPTLKAFSSSSDEDDTYTASCFAKEFAPKTHNLKWQKNGVDVASTIDLTESKNAAGKTLYNAASFLTVNSSDLNDQTRFTCVFTGGEDGSLNKTVIYKKNQCPGCVTSNVKVVISGPTTEDMLVRKKGTITCAVTVQKDEPQITWEDEKLGDIASNPVTKVEDNGNTYVSKLDITYDEWTRGVTRFCVVHHEDLIEPLREPYKRDFGGNPQRPSVFMLPPLEQTNKAEVTLTCFVKDFFPKEVFVSWLVDDEEADSIYAFNTTEPIENNGFYSAYGQLFVSLHQWQRDDAVYSCVVYHESVVNTTRAIVRSIGYRTFDKNRIDLNMNINQDSKCSLQ;
[0048] Example 2
[0049] Construction and Identification of Recombinant Escherichia coli BL21(pET28a-SSF) 1.1 Construction of Recombinant Escherichia coli BL21(pET28a-SSF) Expressing rSSF Protein The pET28a-SSF plasmid was synthesized by a biological company and transformed into E. coli BL21(DE3). It was spread on LB solid medium containing kanamycin and cultured overnight at 37°C in an inverted position. Then, single colonies were picked for colony PCR detection targeting SSF. The colonies with positive colony PCR were inoculated into LB culture medium containing kanamycin and cultured at 37°C at 180 r / min for 12 - 16 hours.
[0050] Plasmid extraction was performed according to the operation instructions of the Omega plasmid extraction kit, and it was identified by PCR and double digestion. The PCR primers were SSF-F (SEQ ID NO.3): CATGCCATGGGCCATCACCACCACCACCAT and SSF-R (SEQ ID NO.4): CCGCTCGAGGGAGGTAGATGCAGATTCAG. The PCR and double digestion products were taken for agarose gel electrophoresis identification. The electrophoresis conditions were: 30 minutes at 120 V voltage. The results were as Figure 1 shown. Lane 2 was the double digestion identification of pET28a-SSF plasmid with Nco I + Sac I, which was consistent with the expected size of 1476 bp; Lane 3 was the double digestion identification of pET28a-SSF plasmid with BamH I + Sac I, which was consistent with the expected size of 1059 bp; Lane 4 was the double digestion identification of pET28a-SSF plasmid with Nco I + BamH I, which was consistent with the expected size of 417 bp; M2: DL10000 DNA Marker. It indicated that the recombinant expression plasmid pET28a-SSF was successfully constructed.
[0051] 1.2 Induced Expression of Recombinant Escherichia coli BL21(pET28a-SSF) A small amount of bacterial liquid was picked from the production strain with an inoculation loop and streaked on the LB solid medium petri dish. After static culture at 37°C for 12 - 16 hours, single colonies were picked and inoculated into LB liquid medium, cultured at 37°C at 180 r / min for 12 - 16 hours as the seed liquid, and then it was inoculated into LB medium at 1% (V / V). At the same time, kanamycin was added to a final concentration of 50 μg / ml. Cultured at 37°C for 5 - 7 hours until the OD of the bacterial liquid 600When the value is 1.1 - 1.3, isopropyl-β-D-thiogalactoside (IPTG) is added to a final concentration of 0.001 mol / L, and induced cultivation is carried out at 37 °C for 6 hours to stop fermentation.
[0052] 1.3 Bacterial liquid treatment and ultrasonic disruption The fermentation product is centrifuged at 10,000 r / min at room temperature to collect the bacteria. The bacteria are washed 3 times with PBS (0.01 mol / L, pH = 7.2), and the collected bacteria are resuspended at a ratio of wet bacteria to PBS solution of 1:10 (mg:mL). Ultrasonic disruption is carried out under ice bath conditions. The disrupted bacterial liquid is centrifuged at 4 °C and 12,000 r / min to collect the bacterial protein. The bacterial protein is dissolved with 8M urea to obtain a protein solution.
[0053] 1.4 Protein purification Dissolve according to the ratio of 10 mL of dissolution solution (5 mmol / L imidazole, 0.5 mmol / L sodium chloride, 8 M urea, 20 mmol / L Tirs-HCl, pH 7.9) per gram of protein precipitate. Oscillate and dissolve at 200 r / min at room temperature for 2 hours, then centrifuge at 4 °C and 10,000 r / min for 30 minutes to collect the supernatant. After fully equilibrating the metal (nickel Ni 2+ ) chelating affinity chromatography column with the equilibration buffer (5 mmol / L imidazole, 0.5 mmol / L sodium chloride, 8 M urea, 20 mmol / L Tirs-HCl, pH 7.9), load the sample at 2 times the column volume, then equilibrate with the equilibration buffer, and then elute with the elution buffer (0.5 mol / L imidazole, 0.5 mmol / L sodium chloride, 8 M urea, 20 mmol / L Tirs-HCl, pH 7.9) to collect the protein. Place 200 ml of the purified protein in a SnakeSkin™ dialysis bag (10K MWCO), and directly immerse it completely in 10 L of refolding solution (150 mM NaCl, 2.5 mM KCl, 10 mM Na2HPO4, 2 mM KH2PO4, 1% Tween-20, 10 mM β-cyclodextrin, 1M L-cysteine, 3 mM reduced and 1 mM oxidized glutathione, pH 7.9), and dialyze at 4 °C for 12 h. During this period, change the solution every 6 h. After dialysis, collect the dialyzed protein solution and store it at 4 °C for later use.
[0054] 1.5 Detection of recombinant protein 1.5.1 SDS-PAGE: Equal volumes of 2× gel loading buffer were added to the supernatant after cell lysis and the solution after resuspending the precipitate. Additionally, samples without sonication were directly added with equal volumes of 2× gel loading buffer. They were boiled for 10 minutes and detected by SDS-PAGE electrophoresis. The acrylamide concentration of the separating gel was 12%. Coomassie Brilliant Blue staining was performed, and decolorization was carried out with decolorizing solution until the bands were clear. Meanwhile, BL21(pET28a-SSF) cultures without IPTG induction were set as controls. The results are as Figure 2 shown. Lane 1: supernatant of uninduced BL21(pET28a); Lane 2: precipitate of uninduced BL21(pET28a); Lane 3: supernatant of induced BL21(pET28a); Lane 4: precipitate of induced BL21(pET28a); Lane 5: supernatant of uninduced BL21(pET28a-SSF); Lane 6: precipitate of uninduced BL21(pET28a-SSF); Lane 7: supernatant of induced BL21(pET28a-SSF); Lane 8: precipitate of induced BL21(pET28a-SSF), indicating that the target protein was mainly expressed in the precipitate.
[0055] 1.5.2 Western-blot identification: First, the recombinant protein was subjected to SDS-PAGE electrophoresis using the same method as above. After electrophoresis, a gel was placed on a transfer apparatus and transferred for 1 hour at 200 mA. The PVDF membrane with the protein was placed in a plastic washing box, and 25 ml of 5% skim milk was added to block it at room temperature for 2 hours. The skim milk was poured out, and after washing 3 times with TBST, 30 ml of mouse anti-Histidine monoclonal antibody (diluted with antibody diluent at a ratio of 1:1000) was added, and the reaction was slowly shaken at room temperature for 2 hours. The primary antibody was poured out, and after washing 5 times with TBST, 30 ml of horseradish peroxidase-labeled goat anti-mouse secondary antibody (diluted with antibody diluent at a ratio of 1:2000) was added, and the reaction was slowly shaken at room temperature for 2 hours. The secondary antibody was poured out, and after washing 5 times with TBST, the membrane was placed in a petri dish and placed in a dark room. First, 1 ml of deionized water was added, and then 1 drop of each of DAB developing solution (solution A and solution B) was added. The surface of the membrane was repeatedly rinsed with a pipette for 1 minute. After complete color development, it was rinsed with deionized water, dried, and imaged. There was a specific band at approximately 53.4 kDa after color development, indicating the presence of correctly expressed rSSF protein in the sample. The same method was used to detect the binding of the protein with rabbit anti-S. agalactiae / S. iniae (used as the primary antibody respectively, and goat anti-rabbit as the secondary antibody). There was a specific band at approximately 53.4 kDa after color development. The results are as Figure 3 shown, where Figure 3 A is the SDS-PAGE analysis of rSSF protein; Figure 3 B is the specific binding reaction of rSSF protein with mouse anti-His antibody; Figure 3In C, it is the specific binding reaction between the rSSF protein and the rabbit anti-S. agalactiae antibody; Figure 3 In D, it is the specific binding reaction between the rSSF protein and the rabbit anti-S. iniae antibody. Lane 1 is the purified rSSF protein, indicating that the rSSF protein has cross-immunogenicity.
[0056] After sequencing, the nucleotide sequence corresponding to the purified rSSF protein is identical to SEQ ID NO.2.
[0057] Example 3
[0058] Preparation of the bivalent subunit nanocarrier vaccine 2.1 Preparation of the bacterial nanocellulose delivery system (1) Carboxylation of bacterial cellulose: Mix wet bacterial cellulose with 2,2,6,6-tetramethylpiperidine 1-oxyl (TEMPO), sodium bromide, and sodium hypochlorite in proportion, stir at room temperature for 12 h (control the pH at about 10.5), and add an appropriate amount of absolute ethanol to terminate the reaction.
[0059] (2) Preparation of carboxylated bacterial nanocellulose BNC: Filter the above reaction solution with distilled water until the pH ≤ 8, mix 70% concentrated sulfuric acid with the filtered cellulose, heat and stir at 50 °C for 2 h to prepare carboxylated nanocellulose with a relatively uniform size (the nanosize is mainly concentrated between 200 - 300 nm), and add distilled water to terminate the reaction. Dialyze (pH near neutral) and freeze-dry.
[0060] (3) Mix BNC with 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide (EDAC) and N-hydroxysuccinimide (NHS) in proportion, and stir at room temperature for 4 h in MES buffer (pH = 6.0). Add an appropriate amount of mercaptoethanol to terminate the reaction.
[0061] 2.2 Preparation of the bivalent subunit nanocarrier vaccine (1) Resuspend the purified rSSF protein with the same mass as BNC in phosphate buffer (pH = 7.2), and then mix at a ratio of protein resuspension: BNC reaction solution = 1:1 (V / V), and stir at room temperature for 4 h.
[0062] (2) Dialyze the reaction product with a dialysis bag with a cut-off molecular weight of 10000 for 48 h, and freeze-dry the product with a freeze dryer to obtain a solid powder; (3) Mix at a ratio of 20 mg of solid precipitate added to 1 ml of PBS to prepare a protein suspension and store it at 4 °C for standby.
[0063] Example 4
[0064] Evaluation of the immune effect of the bivalent subunit nanocarrier vaccine 3.1 ELISA detection of serum antibody levels Take 200 healthy tilapia with consistent growth status, weighing 3.0 - 4.0 g, and divide them into 4 groups (50 tails / group). Among them, 1 group is the control group and 3 groups are the experimental groups. The immunization dose for the experimental groups is 1 ml / L (vaccine content 20 mg / L), and the control group uses physiological saline instead of the vaccine. After immersion immunization for 6 hours, transfer them to a normal aquaculture water body. Collect the blood of tilapia in each group on days 7, 14, 21, and 28 respectively. Let the collected blood stand at room temperature for 2 h and then place it in a 4°C refrigerator overnight. The next day, centrifuge at a speed of 5000 g in a low-temperature freezer centrifuge for 15 min, take the upper-layer serum, and store it at -20°C.
[0065] The serum antibody level was determined by indirect ELISA: Dilute the serum to an appropriate concentration with coating diluent, add 100 μL to each well of a 96-well ELISA plate, with three replicates for each sample, and incubate overnight at 4°C. After completion, discard the liquid in the wells; add 5% calf serum and incubate at 37°C for 1 h for blocking. After blocking, wash 3 times with TBST, 3 min each time; after diluting the antigen protein rSSF to an appropriate concentration, add it to the ELISA reaction wells, 100 μL per well, and incubate at 37°C for 40 - 60 min. Then wash 3 times with TBST, 3 min each time; dilute the mouse-derived His-tag monoclonal antibody (1:1000), add 100 μL to each well of the ELISA reaction wells, incubate at 37°C for 30 - 60 min, and then wash 3 times with TBST, 3 min each time; dilute the horseradish peroxidase-labeled goat anti-mouse IgG (1:5000), add 100 μL per well volume to the ELISA reaction wells, incubate at 37°C for 30 - 60 min, and then wash 3 times with TBST, 3 min each time; add 100 μL of TMB chromogenic solution to each well, place it at 37°C in the dark for 5 - 10 min; add 50 μL of stop solution to each well to terminate the reaction, and measure the absorbance at a wavelength of 450 nm within 20 min.
[0066] The results showed that the serum antibody levels in each vaccine group reached the highest on day 28, and the antibody levels in the BNC-rSSF group were significantly (p < 0.05) higher than those in the other three groups in each week after immunization, as Figure 4 shown.
[0067] 3.2 Detection of immunoprotection rate after bacterial artificial infection After observing the immunized tilapia for 28 days, inject each group intraperitoneally with Streptococcus agalactiae (bacterial content 1×10 8 cfu / mL) and Streptococcus iniae (bacterial content 1×10 9 cfu / mL) bacterial solutions for challenge, 100 μl / tail. Continuously observe for 14 days after challenge and record the death situation of tilapia.
[0068] The results showed that after 28 days of immersion immunization of tilapia, the relative protection rates of the bivalent subunit nanocarrier vaccine BNC-rSSF against Streptococcus agalactiae and Streptococcus iniae infections in tilapia were 71.43% and 64.29% respectively, as Figure 5 shown.
[0069] In summary, in view of the cross and mixed infections of Streptococcus agalactiae and Streptococcus iniae faced during the tilapia breeding process, Sip and Srr have been confirmed to be the protective antigens of S. agalactiae and S. iniae respectively. The present invention targets the Fc receptor on the surface of antigen-presenting cells, prepares the bivalent recombinant protein rSip-Srr-Fc (rSSF) by means of molecular biology and chemical ligation techniques, uses bacterial nanocellulose (BNC) as a delivery carrier, constructs a bivalent subunit nanocarrier vaccine by chemical ligation and other techniques, and immunizes tilapia by immersion. The present invention discovers that the constructed bivalent recombinant protein rSSF has good immunogenicity against both S. agalactiae and S. iniae. The nanocarrier vaccine BNC-rSSF can significantly improve the serum antibody level and non-specific immune indexes such as lysozyme and total antioxidant capacity of tilapia, and significantly reduce the mortality rate of tilapia after infection with Streptococcus agalactiae and Streptococcus iniae, providing a good immune protection effect for tilapia to resist streptococcus infection.
[0070] Obviously, the above-mentioned embodiments of the present invention are merely examples for clearly illustrating the present invention, rather than limiting the implementation manners of the present invention. For those of ordinary skill in the art, other different forms of changes or modifications can be made on the basis of the above description. It is not necessary and impossible to enumerate all the implementation manners here. Any modifications, equivalent replacements, and improvements made within the spirit and principle of the present invention shall be included within the protection scope of the claims of the present invention.
Claims
1. A recombinant protein rSSF of Streptococcus agalactiae and Streptococcus iniae, characterized in that, The amino acid sequence of the recombinant protein rSSF is shown in SEQ ID NO.
1.
2. A DNA molecule encoding the dual recombinant protein rSSF described in claim 1, characterized in that, The nucleotide sequence of the DNA molecule is shown in SEQ ID NO.
2.
3. A recombinant expression vector, characterized in that, Comprising the DNA molecule according to claim 2.
4. The recombinant expression vector according to claim 3, characterized in that, The recombinant vector is obtained by cloning and ligating the DNA molecule onto the pET-28a expression vector to obtain the recombinant expression vector pET28a-SSF.
5. A recombinant strain, characterized in that, Comprising the recombinant expression vector according to claim 3 or 4.
6. Use of the bivalent recombinant protein rSSF according to claim 1 in the preparation of a vaccine for preventing and / or treating streptococcal diseases.
7. The application according to claim 6, wherein The streptococcal diseases include streptococcal diseases caused by Streptococcus agalactiae and / or Streptococcus iniae.
8. A dual subunit nano - carrier vaccine for preventing and / or treating streptococcal disease, characterized in that, Comprising the bivalent recombinant protein rSSF according to claim 1.
9. The preparation method of the dual-subunit nanocarrier vaccine according to claim 8, wherein Comprising the following steps: Mixing and reacting the recombinant protein rSSF with a cellulose nanosuspension, centrifuging to collect the precipitate after the reaction, and dissolving the precipitate to prepare a nano-carrier vaccine.
10. The preparation method according to claim 9, wherein The concentration of the bivalent recombinant protein rSSF in the bivalent subunit nano-carrier vaccine is 20 mg / ml.