Method for screening crRNA based on molecular docking and application of double crRNA in improving group B streptococcus detection

Abstract

The invention discloses a method for screening crRNA based on molecular docking and application of double crRNA in improving group B streptococcus detection. A specific virulence gene in a streptococcus agalactiae genome is taken as a target spot, two potential crRNA candidates with the best detection effect are designed and screened out, and a double crRNA enhanced CRISPR detection system is established and is combined with RPA (recombinase polymerase amplification) amplification to be used for rapid and high-sensitivity detection of streptococcus agalactiae. The detection kit can complete detection from a sample to a result within one hour, the quantitative detection linear range is 103-107 cfu / mL, and the detection limit can reach 101 cfu / mL.

Description

Technical Field

[0001] This invention relates to a molecular docking-based method for screening crRNA and the application of dual crRNA in improving the detection of Group B Streptococcus. Background Technology

[0002] Group B Streptococcus (GBS) has become a major pathogen affecting the health of pregnant women and newborns during the perinatal period, causing amnionitis, urinary tract infections, and miscarriage in pregnant women, and sepsis and meningitis in newborns. Because GBS infection often lacks specific symptoms in its early stages, many cases are diagnosed only when they have progressed to a severe stage, missing the optimal treatment window and thus affecting treatment outcomes and prognosis. Early detection and treatment of GBS infection can significantly reduce neonatal morbidity and mortality. Early treatment, especially prophylactic antibiotic treatment for mothers, has been shown to significantly reduce vertical transmission of GBS, thereby protecting newborns from severe infection. Therefore, timely detection of GBS infection before delivery or in early screening has become a focus of clinical attention.

[0003] Currently, the gold standard for GBS diagnosis remains bacterial culture based on selective media. While gradient enrichment culture can achieve detection sensitivities of 54.3%-87.2%, the long detection cycle of 48-72 hours can easily delay clinical decision-making. Molecular diagnostic technology innovations have significantly improved detection efficiency. Quantitative real-time PCR (RT-qPCR), by targeting conserved genes of the target analyte, compresses the detection time to 2-4 hours, with a detection limit of 1×10² CFU / mL. Clinical validation shows that its positive detection rate is 18.6% higher than traditional culture methods. However, the dependence of qPCR on precision thermal cyclers limits its application in primary healthcare institutions and resource-scarce areas. To overcome the bottleneck of technological universality, third-generation nucleic acid amplification technology focuses on the development of isothermal reaction systems. Real-time recombinant polymerase amplification (RPA) and loop-mediated isothermal amplification (LAMP) achieve nucleic acid amplification in 30 minutes using a 37-42℃ isothermal reaction system, reaching a maximum of 10^ ... 8 The amplification efficiency is increased several times, and the ease of operation is significantly improved. However, recent studies have confirmed that the detection sensitivity of this type of method generally remains at 1×10⁻⁶. 3 -1×10 4The concentration of CFU / mL is 1-2 orders of magnitude lower than that of qPCR, and it is also susceptible to false positives due to primer dimer interference. Therefore, developing a simple, rapid, cost-effective, and efficient method for early detection of GBS is of great significance for improving the early diagnosis rate of GBS and securing the best treatment opportunity.

[0004] In recent years, the CRISPR / Cas12a system has become a research hotspot in the field of molecular diagnostics due to its advantages such as high specificity, high sensitivity, ease of operation, and instrument-independent operation. Compared with the limitations of traditional detection methods, such as long detection cycles, strong instrument dependence, and insufficient sensitivity, CRISPR / Cas-based biosensing technology, with its precise sequence recognition capabilities and enzyme-catalyzed signal amplification mechanism, provides a faster, more sensitive, and convenient solution for the detection of clinical pathogens. This system achieves precise recognition and cleavage of double-stranded DNA target sequences through the specific binding of Cas protein to crRNA, and simultaneously activates the trans-cleavage activity of any single-stranded fluorescent reporter molecule within the system. The presence of the target is determined by fluorescence detection or color development using test strips. This method can complete the detection from sample to result within one hour, with a detection sensitivity of up to pmol, comparable to qPCR. Furthermore, it does not require expensive thermal cycling equipment, making it widely applicable in resource-constrained primary healthcare institutions and low- and middle-income countries. However, traditional single crRNA designs are prone to false negatives or false positives due to target gene mutations, low-concentration samples, or interference from complex matrices, limiting the reliability of its clinical detection. Multiplex crRNA strategies, by simultaneously targeting multiple conserved regions of the target genome to enhance the robustness of detection systems, are considered key to overcoming this bottleneck. First, the synergistic effect of multiple targets can reduce the risk of missed detections due to single-gene mutations, especially suitable for pathogens with genetic diversity such as GBS. Second, multiple signal triggering mechanisms can further amplify the detection signal, increasing sensitivity to below 1 copy / μL, or even reaching the single-molecule detection level. Finally, multi-target cross-validation can effectively reduce false positives caused by non-specific cleavage, improving the specificity of clinical diagnosis. Studies have shown that the Cas12a system based on multiplex crRNAs maintains excellent performance in complex clinical samples and can achieve rapid on-site detection using portable devices, providing a new technological approach for the precise diagnosis of infectious diseases. Summary of the Invention

[0005] Purpose of the invention: The purpose of this invention is to provide a molecular docking screening method for crRNA with high sensitivity, specificity and good monitoring efficiency, and the application of dual crRNA in improving the detection of Group B Streptococcus.

[0006] Technical solution: The present invention provides a crRNA, the nucleotide sequence of which is shown in any one of SEQ ID NO.11-14.

[0007] The crRNA is designed to target each virulence gene in the GBS genome. Based on the score and GC content, the crRNA with the highest score and the appropriate GC content is selected from 8 candidate crRNAs.

[0008] Preferably, the candidate crRNA is designed to target the GBS-specific virulence genes fbsA, bibA, cylE, cfb, iagA, cpsA, sip, and sodA.

[0009] Preferably, the secondary structure is predicted and the minimum free energy is calculated using the NUPACK web server, and the interaction between Cas12a, crRNA and target is predicted and docking score is calculated using the HDOCK server to determine the four optimal candidate crRNAs.

[0010] Preferably, the four candidate crRNAs include crRNAs designed for the GBS-specific virulence genes cylE, cfb, sip, and sodA.

[0011] Preferably, the selection of the two crRNAs is based on the combination of crRNAs with the highest detection sensitivity when the CRISPR / Cas12a system screens for targets of GBS DNA, selected from four candidate crRNAs.

[0012] The present invention also provides the application of the crRNA in the preparation of a detection kit for detecting Group B Streptococcus.

[0013] The present invention also provides a kit for detecting Group B Streptococcus, which contains the crRNA.

[0014] It also contains Cas12a protein, ssDNA signal probe, and NEBuffer.

[0015] The 5' end of the ssDNA signal probe is modified with a fluorescent group, and the 3' end is modified with a quencher group. The fluorescent group includes Atto 425, BODIPY FL, FAM, Oregon Green 488, TET, JOE, R6G, Yakima Yellow, VIC, HEX, Quasar 570, Cy3, NED, TAMRA, ROX, Aqua Phluor 593, Texas Red, Atto 590, Cy5, Quasar 670, or Cy5.5. The quencher group includes BHQ1, BHQ2, BHQ3, BBQ650, MGB, or Dabcyl. The nucleotide sequence of the ssDNA signal probe is TTTATTT. These ssDNA signal probes are modified with a fluorescent group at the 5' end and a quenching group at the 3' end. As long as the fluorescent group can emit light and the quenching group can quench the fluorescent signal of the fluorescent group, that is, as long as the fluorescent group and the quenching group are not problematic, they can be used to modify ssDNA as probes.

[0016] Preferably, the single-stranded ssDNA reporter probe sequence is modified with FAM at the 3' end of TTATT and with BHQ at the 3' end, i.e., FAM-TTTATTT-BHQ.

[0017] Preferably, the NEBuffer is NEBuffer1.1, NEBuffer2.1, NEBuffer3.1, NEBuffer4.1, or NEBuffer5.1.

[0018] More preferably, the NEBuffer is version 2.1, which is suitable for most restriction endonucleases, and its components include NaCl, Tris-HCl, MgCl2 and BSA.

[0019] Furthermore, NEBuffer comprises 50 mM NaCl, 10 mM Tris-HCl, 10 mM MgCl2, and 100 ug / ml BSA (pH 7.9 @ ​​25℃).

[0020] The present invention also provides a method for detecting Group B Streptococcus, comprising the following steps: (1) After RPA amplification of the sample DNA, add Cas12a protein solution, ssDNA signal probe solution, NEBuffer, and the crRNA solution described in claim 1, mix well, and then perform fluorescence signal detection; (2) The concentration of Group B Streptococcus was calculated based on the linear relationship between the concentration of Group B Streptococcus and the fluorescence signal; the linear relationship is y = 2599.6ln(x) - 14345, R 2=0.9824, where x represents the concentration of Group B Streptococcus and y represents the relative fluorescence signal intensity.

[0021] The concentration ratio of Cas12a to crRNA is 1-2:1-2.

[0022] Furthermore, for the cylE, sip, and cfb genes, the concentration ratio of Cas12a to crRNA is 1–2:1–1.5. For the sodA gene, the concentration ratio of Cas12a to crRNA is 1–2:1–1.5.

[0023] Furthermore, for the cylE, sip, and cfb genes, the concentration ratio of Cas12a to crRNA is 1-1.5:1-1.5.

[0024] Preferably, the concentration of the Cas12a protein is 10-100 nM; the concentration of the crRNA is 10-100 nM; and the concentration of the ssDNA signal probe is 10-200 nM.

[0025] The concentration ratio of Mg²⁺ in Cas12a and NEBuffer is 10000:1-10.

[0026] Furthermore, for the cylE gene, the concentration ratio of Cas12a to Mg²⁺ is 10000:1-5. For the sip and sodA genes, the concentration ratio of Cas12a to Mg²⁺ is 10000:5-10.

[0027] The reaction time is at least 20 minutes.

[0028] Preferably, the Cas12a protein can also be replaced by Cas12 or Cas14. The Cas12 can also be Cas12b, Cas12c, Cas12d, Cas12e, Cas12g, Cas12h, or Cas12i.

[0029] More preferably, the Cas12a is specifically LbCas12a, which comes from Lachnospiraceae bacterium, and the GBS target sequence is identified by recognizing the sequence with PAM of 5'-TTTV-3'.

[0030] like Figure 1As shown, this invention constructs a CRISPR / Cas12a detection system based on the synergistic effect of dual crRNAs. This system achieves a synergistic effect of multi-target parallel recognition and cascaded signal amplification by directionally combining sip-cfb dual-target crRNAs: on the one hand, the multiple recognition mechanism of the dual crRNAs ensures detection specificity; on the other hand, the synergistic effect of the Cas12a trans-cleavage activity enables the detection sensitivity to reach 10. 1 The cfu / mL concentration is two orders of magnitude higher than traditional single crRNA detection. This integrated reaction system simultaneously performs target validation and signal amplification in a single tube, offering both high-sensitivity detection and real-time monitoring capabilities.

[0031] Among them, the primer pairs designed based on the sip gene include sip-RPA-F (SEQ ID NO.27: CAGCAACAAATGCTGCTGGTCAAACAACAGCTACT) and sip-RPA-R (SEQ ID NO.28: TGAGTTGGTTTAACTTCCTCTTTAGCTGCTGGAAC); the primer pairs designed based on the sip gene include cfb-RPA-F (SEQ ID NO.23: CTCTAGTGGCTGGTGCATTGTTATTTTCACCAGC) and cfb-RPA-R (SEQ ID NO.24: GCCTCATTAACCGGTTTTTCATAATCTGTTCC).

[0032] Beneficial effects: Compared with the prior art, the present invention has the following significant advantages: 1. This invention introduces a molecular docking strategy to screen and optimize crRNA at the structural level. By simulating the binding mode and energy of the Cas12a-crRNA-DNA ternary complex, the system identifies candidate crRNAs with better binding stability and more reasonable spatial conformation, which greatly improves the scientific nature and prediction accuracy of sequence design and breaks through the limitations of traditional empirical screening.

[0033] 2. This invention proposes and verifies a design concept for multi-crRNA synergistic recognition, especially the combination of sip and cfb dual targets, which achieves synergistic activation and signal amplification in the Cas12a system. The detection sensitivity is improved by 2–4 times compared to single crRNA, and the limit of detection can reach 10. 1 CFU / mL, with a quantitative detection linear range of 10. 3 -10 7The concentration of CFU / mL significantly enhances the sensitivity and robustness of detection. This invention targets the specific virulence genes sip and cfb in the GBS genome, designing and optimizing the RPA primer pairs and specific crRNA sequence combinations to achieve accurate and rapid identification of GBS, with a quantitative detection linear range of 10. 3 -10 7 cfu / mL, detection limit can reach 10 1 cfu / mL, with the advantages of high specificity and high sensitivity; 3. This invention constructs an integrated rapid detection platform combining molecular simulation screening, dual crRNA, and RPA amplification. Under isothermal conditions, the entire process from sample lysis and nucleic acid amplification to CRISPR detection can be completed within 60 minutes. It boasts advantages such as ease of operation, no need for large instruments, high specificity, and good reproducibility, demonstrating broad application prospects in the rapid diagnosis of GBS in clinical samples. Based on the obtained RPA primer pairs and specific crRNA sequence combinations, this invention further develops a rapid GBS detection method. The rapid visual GBS detection method described in this invention uses simple equipment, is easy to operate, and has a short detection time; the entire detection time can be controlled within one hour. This invention allows for the pre-synthesized crRNA as a long-term reserve material, suitable for rapid on-site screening or detection, and has the advantages of low cost and high practicality. Attached Figure Description

[0034] Figure 1 Schematic diagram of multiple crRNA strategies to enhance the detection of Streptococcus agalactiae in swabs using the CRISPR / Cas12a system; Figure 2 Fluorescence intensities of experimental groups targeting different genes: A: cylE-crRNA; B: sip-crRNA; C: cfb-crRNA; D: sodA-crRNA; Figure 3 Optimization of Cas12a protein and crRNA dosage: A: Cas12a protein and cylE; B: Cas12a protein and sip; C: Cas12a protein and cfb; D: Cas12a protein and sodA; Figure 4 Optimization of Mg²⁺ ion concentration for four target gene detection methods: A: cylE-crRNA; B: sip-crRNA; C: cfb-crRNA; D: sodA-crRNA; Figure 5 Real-time fluorescence kinetics curves of the CRISPR / Cas12a system for each gene at serially diluted target concentrations; fluorescence was recorded every 5 minutes over 60 min; Figure 6Quantitative comparison of endpoint fluorescence values ​​(30 minutes) at different concentrations of each crRNA (*p<0.01; P<0.05; ns=not significant). Error bars represent the standard deviation of three experiments. Figure 7 Comparison of endpoint fluorescence of different double crRNA combinations at different target concentrations; Figure 8 Fluorescence response curves of the sip+cfb dual crRNA system relative to sequentially target-diluted single crRNAs; Figure 9 Fluorescence response curves of the cfb+cylE dual-crRNA system relative to serially diluted single-crRNAs; Figure 10 Fluorescence kinetics curves of the sip+cfb dual-crRNA system at different target concentrations; Figure 11 Performance comparison of multiple crRNA combinations: sip, sip+cfb, sip+cfb+cylE, sip+cfb+cylE+sodA; Figure 12 : In a series of GBS concentrations (10 0 -10 7 At CFU / mL, the fluorescence response of the sip+cfb dual crRNA system compared to a single crRNA system (sip or cfb); Figure 13 GBS standard curves for single crRNA and dual crRNA detection; Figure 14 Specific detection; Figure 15 Results of testing 30 types of swab samples. Detailed Implementation

[0035] The technical solution of the present invention will be further described below with reference to the accompanying drawings.

[0036] Example 1: Custom-designed CRISPR-Cas12a system for targeting and cleaving GBS crRNA Step 1: Select target sequence: Access the Eezassay Biodesign platform (https: / / ezassay.com / rna), and input the target DNA sequences of the eight GBS virulence genes: cylE, sodA, cfb, fbsA, bibA, cpsA, sip, and iagA. The platform will automatically screen candidate target sequences containing effective PAMs.

[0037] Step 2: Verify the specificity of the selected target: Access NCBI BLAST (https: / / blast.ncbi.nlm.nih.gov / Blast.cgi) to align candidate target DNA, ensuring that the target sequence is uniquely derived from GBS in the database. To further confirm the conservation of these virulence genes, we searched the NCBI database for all available GBS genome sequences and compared the distribution of their virulence genes. The results showed that after aligning all GBS sequences in the NCBI database, the detection rate of the selected virulence genes exceeded 97%, indicating that these genes have high sequence conservation among different GBS strains, further validating their reliability as detection targets.

[0038] Step 3: Access the CRISPOR design platform (http: / / crispor.tefor.net / ), re-enter the target DNA sequence mentioned above, select Cas12a as the nuclease type, generate candidate crRNA sequences, and select the sequences with the highest CRISPOR score and GC content controlled between 40% and 60% as the final 8 selected crRNAs (Tables 1 and 2).

[0039] Table 1

[0040] Table 2

[0041] Step 4: crRNA structure prediction and optimization: The secondary structure of each crRNA was predicted using the NUPACK web server (https: / / old.nupack.org / partition / new), and the minimum free energy (MFE) was calculated. The minimum free energy of each crRNA and its spacer region was less than -14.20 kcal / mol. Among them, the crRNAs of sodA, sip, cylE, and cfb and their spacer arms had larger free energies and simpler secondary structures, indicating that they were more likely to bind to Cas proteins and target DNA.

[0042] Step 5: Use the SWISS-MODEL server (https: / / swissmodel.expasy.org / ) and RNAfoldweb server (https: / / eu.idtdna.com / calc / analyzer) to perform homology modeling and 3D structure prediction of Cas12a and crRNA to study the structural basis of their binding to the target.

[0043] Step 6: Molecular docking and binding ability assessment: Access the HDOCK server (http: / / hdock.phys.hust.edu.cn / ), upload the Cas12a protein model (PDB format), crRNA 3D structure file, and target DNA sequence, predict the interactions between Cas12a and crRNA, as well as between the Cas12a-crRNA complex and the target, and calculate their docking scores. Results showed that the docking scores of candidate crRNAs with Cas12a were all negative, ranging from -300.66 to -417.09 kJ / mol. The median docking score of Cas12a with crRNA was -338.06 kJ / mol. Among the candidate crRNAs, sodA, sip, cylE, and cfb-related crRNAs had higher docking scores, indicating they had higher guiding potential. After binding to Cas12a, crRNA recognizes the target DNA sequence through sequence complementarity, thereby guiding Cas12a to specifically cleave the target DNA. To further evaluate the binding affinity of the Cas12a-crRNA complex to the target gene, a three-dimensional structure of the complex formed by Cas12a and crRNA and the target gene sequence was constructed, and the docking fraction was calculated. The docking fractions of different Cas12a-crRNA complexes with target DNA ranged from -294.34 to -376.68 kJ / mol. SodA, sip, cylE, and cfb showed higher docking fractions, indicating relatively high binding stability and better cleavage efficiency. Therefore, based on the complexity of the secondary structure of crRNA and its binding affinity to Cas12a and target DNA, sodA, sip, cylE, and cfb-related crRNAs were selected for subsequent experimental validation to evaluate their application potential in GBS detection.

[0044] Example 2: Screening for crRNAs targeting GBS DNA using the CRISPR / Cas12a system 1. This invention selected four virulence genes—sodA, sip, cylE, and cfb—as target gene loci and detected GBS DNA using the CRISPR / Cas12a system. First, a crRNA detection protocol targeting the four virulence genes was designed and validated to explore the feasibility of detection at each gene locus. Therefore, the experimental group for each target gene included four variables and one negative control. The experimental group contained a complete reaction system: a Cas12a protein solution (Shenzhen Yizhi Biotechnology Co., Ltd., catalog number: CAS-12E-010) at a final concentration of 10 nM, a crRNA solution at a final concentration of 10 nM, a target DNA solution at a final concentration of 100 nM, an F-ssDNA-Q probe (FAM-TTTATTT-BHQ) solution at a final concentration of 200 nM, and 1× NEBuffer buffer (containing 50 mM NaCl, 10 mM Tris-HCl, 10 mM MgCl2, pH 7.9). The other control groups lacked one reaction component. The reaction signal was monitored using fluorescence analysis. Fluorescence intensity was measured using a microplate reader, and the fluorescence intensity at 30 min incubation was recorded to create a bar chart. The results are as follows: Figure 2 As shown, significant fluorescence signals were observed only in the experimental group containing all reaction components, while the other control groups did not show obvious fluorescence signals. This indicates that the non-specific cleavage activity of Cas12a depends on the specific recognition of target DNA; the absence of any key reaction component will lead to the inactivation of Cas12a, thus preventing the generation of a fluorescence signal.

[0045] 2. To improve the detection sensitivity and specificity of the CRISPR / Cas12a system, this invention first optimized the amount of Cas12a protein and crRNA to explore the optimal reaction conditions.

[0046] The amounts of Cas12a protein and crRNA used for four target detections were optimized. Five different Cas12a to crRNA ratios were designed: 2:1, 1.5:1, 1:1, 1:1.5, and 1:2. The Cas12a protein concentration was fixed at 10 nM, and the crRNA concentrations were 5 nM, 6.6 nM, 10 nM, 15 nM, and 20 nM, respectively. The system also included 100 nM target DNA solution, 200 nM F-ssDNA-Q probe solution, and 1× NEBuffer (containing 50 mM NaCl, 10 mM Tris-HCl, 10 mM MgCl2, pH 7.9). A negative control group was included in each group (the target DNA solution in the experimental groups was replaced with pure water). The fluorescence detection results after 30 min of incubation are shown below. Figure 3As shown, the amounts of Cas12a protein and crRNA directly affect the system's cleavage efficiency. Insufficient Cas12a protein or crRNA may lead to inadequate binding to target DNA, reducing detection sensitivity; excessive amounts may cause non-specific cleavage, increasing background noise. Therefore, for the cylE, sip, and cfb genes, the optimal ratio of Cas12a to their corresponding crRNA is 1.5:1, i.e., a Cas12a concentration of 10 nM and a crRNA concentration of 6.6 nM. For the sodA gene, the optimal ratio is 2:1, i.e., a crRNA concentration of 5 nM.

[0047] 3. Mg 2+ Ions play a crucial role as cofactors in CRISPR-Cas reactions, and their concentration is critical to the efficiency of the reaction system. Therefore, this invention investigated the effect of Mg²⁺ ion concentration on fluorescence intensity in a system containing 10 nM Cas12a solution, crRNA solution (the optimal concentration determined above), 100 nM target DNA solution, 200 nM F-ssDNA-Q probe solution, and NEBuffer buffer (containing 50 mM NaCl, 10 mM Tris-HCl, and MgCl₂, pH 7.9), optimizing the Mg²⁺ ion concentration for each target gene detection. The MgCl₂ concentrations in the NEBuffer buffer were 1, 5, 10, 15, and 20 nM, respectively. Fluorescence detection results after 30 min of incubation are shown below. Figure 4 As shown, an appropriate amount of Mg 2+ It can promote the binding of Cas protein and crRNA, stabilize the complex structure, and thus improve the recognition and binding efficiency of target DNA. Mg 2+ Insufficient Mg concentration may lead to unstable complex structure, thereby reducing reaction efficiency, while excessive Mg concentration may result in instability. 2+ Concentration may lead to nonspecific cleavage reactions. When detecting cylE, sip, cfb, and sodA genes, the optimal Mg concentration... 2+ The ion concentrations were 5, 10, 10 and 5 nM, respectively.

[0048] 4. To further determine the optimal reaction time, the fluorescence intensity changes in the CRISPR / Cas12a reaction system were recorded at different target DNA concentrations, measured every 5 minutes for a total of 60 minutes. The system contained 10 nM Cas12a solution, crRNA solution (the optimal concentration determined above), target DNA solutions of different concentrations, 200 nM F-ssDNA-Q probe solution, and NEBuffer (containing 50 mM NaCl, 10 mM Tris-HCl, and MgCl2, pH 7.9), with the MgCl2 solution being the optimal concentration determined above. Results are as follows: Figure 5 As shown, the fluorescence value of the reaction system gradually increased with increasing reaction time, and tended to stabilize after 30 min. Therefore, this invention determined that the optimal time for CRISPR / Cas12a to trans-cleave target DNA is 30 min.

[0049] 5. Under the optimized reaction conditions described above, the detection sensitivity of each crRNA was evaluated using sequential dilutions of GBS target DNA from 100 nM to 0 nM. Fluorescence signals were recorded 30 minutes after the reaction. Figure 6 As shown in the figure, all four crRNA systems exhibited concentration-dependent fluorescence increases, stabilizing at higher concentrations, indicating system saturation. To determine the limit of detection (LOD), an unpaired t-test was used to statistically compare the fluorescence values ​​at each concentration with the negative control. The lowest concentration showing a statistically significant difference (p < 0.05) was defined as the LOD. Based on this criterion, the calculated LODs for crRNAs targeting cylE, sip, cfb, and sodA were 0.195 nM, 0.024 nM, 0.049 nM, and 0.195 nM, respectively. Among them, sip-crRNA showed the highest sensitivity, followed by cfb-crRNA and cylE-crRNA, while sodA-crRNA showed a relatively high detection threshold.

[0050] Example 3: Enhancing the performance of the CRISPR / Cas12a system using a dual crRNA strategy The multi-target recognition characteristics exhibited by crRNA in the CRISPR / Cas system provide a new strategy for improving the sensitivity of nucleic acid detection.

[0051] 1. Based on the preliminary simulation results of Example 1, we further conducted experimental verification studies on the dual crRNA system. First, the reaction system was prepared by adding Cas12a protein solution to a final concentration of 10 nM, 200 nM F-ssDNA-Q probe, and 1× NEBuffer (containing 50 mM NaCl, 10 mM Tris-HCl, 10 mM MgCl2, pH 7.9) to a sterile centrifuge tube. Then, a single crRNA or two crRNAs were added in equimolar proportions (10 nM for the single crRNA group and 5 nM for each of the dual-combination groups). Sterile deionized water was added to a total volume of 50 μL and mixed well. Next, 10 μL of target DNA solution to a final concentration of 100 nM was added, bringing the final reaction volume to 60 μL. The mixture was then transferred to a fluorescence detection microplate and incubated at 37°C for 30 min. The results are as follows: Figure 7As shown, based on the sip group with the best LOD in the single crRNA system, only the sip-cfb and cfb-cylE combinations showed significant sensitivity improvement.

[0052] In the above system, the target DNA was serially diluted starting from 100 nM: 100, 50, 25, 12.5, 6.25, 3.125, 1.5625, 0.78125, 0.39, 0.195, 0.097, 0.048, 0.024, and 0.012 nM. Quantitative analysis showed that ( Figure 8 The detection limit of the sip+cfb combination reached 0.012 nM, which is 2 times and 4 times higher than that of sip (0.024 nM) and cfb (0.049 nM) alone, respectively. Similarly, the detection limit of the cfb-cylE combination was 0.024 nM, which is 2 times and 8 times higher than that of cfb (0.049 nM) and cylE (0.195 nM) alone, respectively. Figure 9 These two crRNA combinations, exhibiting significant synergistic effects, were significantly correlated with the group showing the lowest interaction energy in the previous MFE analysis, confirming that the low spontaneous folding tendency of crRNA molecules effectively enhances their synergistic binding ability to target DNA by reducing non-specific interactions. Based on their outstanding sensitivity performance, and considering the clinical relevance of sip and cfb as pathogen marker genes, this invention ultimately selected the sip-cfb dual crRNA combination as the optimal detection system.

[0053] 2. To obtain the optimal detection time, this invention constructed the reaction kinetics of the dual crRNA system by real-time monitoring of fluorescence intensity changes. A detection kinetic curve for the dual crRNA was established by plotting the relationship between fluorescence intensity and immune reaction time. The system consisted of a 60 μL volume containing a Cas12a protein solution with a final concentration of 10 nM, an F-ssDNA-Q probe with a final concentration of 200 nM, 1× NEBuffer (containing 50 mM NaCl, 10 mM Tris-HCl, 10 mM MgCl2, pH 7.9), a sip-cfb dual crRNA combination (both sip and cfb with a final concentration of 5 nM), and target DNA solutions with final concentrations of 0, 1, 3, 6, 12, 25, 50, and 100 nM. These solutions were transferred to a dedicated fluorescence detection microplate and incubated at 37°C in a constant-temperature fluorescence detector. Detection was performed every 5 minutes. Results are as follows: Figure 10 As shown, when the reaction proceeded to 25 min, the fluorescence signal change rate of each concentration gradient dropped to <2% / min, indicating that the system reached the reaction equilibrium state. Therefore, we chose 25 min as the reaction time of the dual crRNA system.

[0054] 3. To further analyze the relationship between the number of crRNA combinations and detection sensitivity, considering the subtle differences in the quality of crRNA combinations, and based on the priority order of detection limits as sip>cfb>cylE>sodA, we designed sip, cfb, sip+cfb, sip+cfb+cylE, and sip+cfb+cylE+sodA combinations for crRNA detection. The 60 μL system contained a Cas12a protein solution with a final concentration of 10 nM, an F-ssDNA-Q probe with a final concentration of 200 nM, 1× NEBuffer (containing 50 mM NaCl, 10 mM Tris-HCl, 10 mM MgCl2, pH 7.9), crRNA (sip, cfb, cylE, and sodA with the same final concentration and a total concentration of 10 nM), and target DNA solutions with final concentrations of 100, 50, 25, 12.5, 6.25, 3.125, 1.5625, 0.78125, 0.39, 0.195, 0.097, 0.048, 0.024, and 0.012 nM, respectively. These solutions were transferred to a dedicated microplate for fluorescence detection and incubated at 37°C for 30 min before detection. The experimental results showed that the LOD of each group was as follows: Sip: 0.024 nM; sip+cfb: 0.012 nM; sip+cfb+cylE: 0.049 nM; sip+cfb+cylE+sodA: 0.049 nM; that is, the LOD of the sip+cfb combination was greater than that of sip. However, the LOD of the sip+cfb+cylE and sip+cfb+cylE+sodA combinations decreased with the increase of crRNA. Figure 11 ).

[0055] Example 4: Detection of GBS DNA in real samples using CRISPR / Cas12a dual crRNA After collecting clinical vaginal swab samples, the swab tip was immersed in a 1.5 mL sterile centrifuge tube containing 1 mL PBS buffer and vortexed vigorously for 30 seconds to thoroughly wash away bacteria. The sample was then centrifuged at 5000 rpm for 3 minutes, the supernatant was discarded, and the pellet was retained. 50 μL of 0.2% Triton X-100 solution was added to the pellet, and the mixture was vortexed for 10 seconds. The sample was then heated in a 95°C metal bath for 10 minutes to lyse cells and release GBS genomic DNA (confirmed by qPCR). The sample was then immediately centrifuged at 5000 rpm for 3 minutes, and the supernatant was transferred to a new centrifuge tube. The resulting DNA solution (target strands (TS and NTS)) was stored at -4°C for later use.

[0056] Prepare a 20 μL amplification system: Add 0.5 μL each of 10 μM forward and reverse primers (RPA amplification kit from Shenzhen Yizhi Biotechnology Co., Ltd., catalog number: BA-LY0-96), 10 μL of 2×RPA reaction buffer, 1 μL of swab sample DNA template (target strand), 6 μL of enzyme-free sterile water, and 2 μL of RPA Starter Mix to a sterile PCR tube. Gently tap the tube wall to mix, then briefly centrifuge to collect the liquid at the bottom of the tube. Incubate the reaction tube in a 39℃ metal bath for 20 minutes to complete isothermal amplification. The sequences of the primers, crRNA, and target strands (TS and NTS) for RPA amplification are shown in Tables 3 and 4.

[0057] Table 3

[0058] Table 4

[0059] The amplification products are used directly for subsequent detection. The amplification products are then serially diluted: each amplification product is diluted sequentially with enzyme-free sterile water to a concentration of 10. 7 10 6 10 5 10 4 10 3 10 2 10 1 10 0 A series of gradients with a final concentration of 0 nM were used. The system contained Cas12a protein at a final concentration of 10 nM, F-ssDNA-Q probe at 200 nM, 1×NEBuffer (containing 50 mM NaCl, 10 mM Tris-HCl, 10 mM MgCl2, pH 7.9), and equally partitioned dual crRNA (total final concentration of sip and cfb 10 nM). After adding water to a final volume of 50 μL, 10 μL of different concentrations of diluted amplification products were added (the final target concentration was adjusted according to the gradient). After mixing, the mixture was transferred to a fluorescence detection microplate and incubated at 37℃. The instrument acquired fluorescence signals every 5 minutes for 60 minutes, with a focus on recording the fluorescence intensity at 30 minutes. The results are as follows: Figure 12 As shown, the Cas12a protein is guided by dual crRNA targeting the GBS characteristic virulence genes sip and cfb to specifically recognize RPA amplification products at two sites, activating trans-cleavage activity and releasing a fluorescent signal. The dual crRNA design effectively constructs a redundant detection system; when either sip or cfb target is inactivated due to gene mutation, the other crRNA can still independently trigger the signal, significantly reducing the false negative risk of traditional single-target detection.

[0060] The fluorescence signal values ​​corresponding to each concentration gradient were imported into Origin software, and linear fitting was performed with target (GBS) concentration as the x-axis and fluorescence intensity as the y-axis. The results are as follows: Figure 13 As shown, fluorescence intensity increases with increasing GBS concentration. The dual crRNA detection system achieves a LOD of 10¹ CFU / mL for GBS DNA, which is significantly higher than that of single-target detection (sip: LOD = 10² CFU / mL; cfb: LOD = 10¹ CFU / mL). 3 The sensitivity of this system (CFU / mL) is improved by 1-2 orders of magnitude. 3 -10 7 The system exhibits good log-linearity within the CFU / mL range (sip: y=2599.6ln(x)–14345, R²=0.9824), indicating that it maintains stable quantification capabilities over a wide dynamic range.

[0061] The specificity of this method was further investigated by analyzing nine other common pathogenic microorganisms (clinical isolates or model organisms: Staphylococcus aureus ATCC25923, Klebsiella pneumoniae, Escherichia coli, Pseudomonas aeruginosa, clinical isolates of Pseudomonas aeruginosa, clinical isolates of Burkholderia neodei, Staphylococcus aureus ATCC6538, clinical isolates of Escherichia coli, and Burkholderia neodei). The system contained a final concentration of 10 nM Cas12a protein, 200 nM F-ssDNA-Q probe, 1×NEBuffer (containing 50 mM NaCl, 10 mM Tris-HCl, 10 mM MgCl2, pH 7.9), and proportionally allocated dual crRNA (total final concentration of sip and cfb 10 nM). After adding water to a final volume of 50 μL, 10 μL of the amplification product of the pathogenic microorganism (pathogen concentration 10) was added to each microorganism. 7 CFU / mL (the amplification product was obtained using the same method as the previously described extraction and amplification method for swab samples, without dilution). After mixing, the product was transferred to a fluorescence detection microplate and reacted at 37°C for 30 minutes before measuring the fluorescence intensity. Results are as follows... Figure 14 As shown, significant fluorescence values ​​are only observed in the presence of GBS, indicating that the method has good specificity.

[0062] This invention further validated the reliability of the method using clinical samples (30 vaginal swab samples). The system contained a final concentration of 10 nM Cas12a protein, 200 nM F-ssDNA-Q probe, 1×NEBuffer (containing 50 mM NaCl, 10 mM Tris-HCl, 10 mM MgCl2, pH 7.9), and proportionally allocated dual crRNA (total final concentration of 10 nM for sip and cfb). After adding water to a final volume of 50 μL, 10 μL of a 10% concentration of sip and cfb was added. 7 The diluted amplification product of the nM clinical sample (obtained using the same extraction and amplification method as described above for swab samples) was mixed and transferred to a fluorescence detection microplate. The fluorescence intensity was measured after incubation at 37°C for 30 minutes. Results are as follows: Figure 15 As shown, the positive rate of the 30 vaginal swab samples was 100%, and there was no cross-reactivity in the negative control (RFU<6000). Samples 31-50 served as the control group. The method of this invention completes amplification and detection under a constant temperature of 39℃, with a total time of <60 minutes. Combined with intuitive fluorescence signal interpretation, it provides an efficient solution for the immediate diagnosis of clinical GBS infection. The results were verified to be consistent with those obtained by the qPCR method. The qPCR reaction system is shown in Table 5. Table 5

[0063] qPCR amplification program: Step 1: Preincubation: 95℃ 30s; Step 2: Amplification 40 Cycles: 95℃ 10s; 60℃ 30s; Step 3: Melting: 95℃ 15s; 60℃ 60s; 95℃ 15s.

[0064] Example 5: The accuracy and precision of the present invention were evaluated by detecting swab samples contaminated with artificially created GBS. Take the above 10 respectively 2 10 4 and 10 6 The bacterial culture of swab samples with CFU / mL was extracted for genomic DNA and then tested using the method of this invention. The test was repeated three times a day for three consecutive days. The specific results are shown in Table 6.

[0065] Table 6

[0066] The method established in this invention achieves an intra-assay recovery rate of 104.16%–111.09% for detecting GBS in swab samples, with a coefficient of variation of less than 15.96%; the inter-assay recovery rate is between 97.81% and 109.72%, with a coefficient of variation of less than 13.81%, indicating that this method has high accuracy and precision in detecting GBS in actual clinical swab samples. The method completes amplification and detection under a constant temperature of 39℃, with a total processing time of less than 60 minutes. Combined with intuitive fluorescence signal interpretation, it provides an efficient solution for the immediate diagnosis of clinical GBS infection.

Claims

1. A crRNA, characterized in that, Its nucleotide sequence is shown in any one of SEQ ID NO.11-14.

2. The use of the crRNA described in claim 1 in the preparation of a detection kit for detecting Group B Streptococcus.

3. A kit for detecting Group B Streptococcus, characterized in that, It contains one or more of the crRNAs described in claim 1.

4. The reagent kit according to claim 3, characterized in that, It also contains Cas12a protein, ssDNA signal probe, and NEBuffer.

5. The reagent kit according to claim 4, characterized in that, The ssDNA signal probe is modified with a fluorescent group at its 5' end and with a quenching group at its 3' end.

6. The reagent kit according to claim 5, characterized in that, The fluorescent groups include Atto 425, BODIPY FL, FAM, Oregon Green 488, TET, JOE, R6G, Yakima Yellow, VIC, HEX, Quasar 570, Cy3, NED, TAMRA, ROX, Aqua Phluor 593, Texas Red, Atto 590, Cy5, Quasar 670, or Cy5.5; the quenching groups include BHQ1, BHQ2, BHQ3, BBQ650, MGB, or Dabcyl; the nucleotide sequence of the ssDNA signal probe is TTTATTT.

7. The kit according to claim 4, characterized in that, The concentration ratio of Cas12a to crRNA is 1-2:1-2.

8. The reagent kit according to claim 4, characterized in that, The concentration ratio of Mg²⁺ in the Cas12a and NEBuffer is 10000:1-10.

9. The use of any one or more of the crRNAs described in claim 1, or the kit described in any one of claims 3 to 8, in the detection of Group B Streptococcus for non-diagnostic or therapeutic purposes.

10. The application according to claim 9, characterized in that, Includes the following steps: (1) After RPA amplification of the sample DNA, add Cas12a protein solution, ssDNA signal probe solution, NEBuffer, and a solution containing any one or more of the crRNAs described in claim 1, mix well, and then perform fluorescence signal detection. (2) The concentration of Group B Streptococcus was calculated based on the linear relationship between the concentration of Group B Streptococcus and the fluorescence signal; the linear relationship is y = 2599.6ln(x) - 14345, R 2 =0.9824, where x represents the concentration of Group B Streptococcus and y represents the relative fluorescence signal intensity.

Images