Disease-resistant and growth-promoting aspergillus alabamate AF-Q5, microbial preparation and application of aspergillus alabamate AF-Q5

By using Aspergillus Alabama AF-Q5 and its microbial preparations, the prevention and treatment of rice blight and tomato blight were solved, the inhibition of pathogenic bacteria and the promotion of plant growth were achieved, and crop yields were improved.

CN120399894APending Publication Date: 2025-08-01NORTHEAST AGRICULTURAL UNIVERSITY
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510625754.4
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-05-15
Publication Date
2025-08-01

AI Technical Summary

Technical Problem

The prior art has little effect in preventing and treating rice blight, and there is a lack of effective microbial preparations, especially the application of Aspergillus Alabama has not been reported.

Method used

It provides an Aspergillus Alabama AF-Q5 and its microbial preparation, which has high salt resistance and alkali resistance, can produce cellulase, inhibit pathogenic bacteria such as Fusarium apricot, Fusarium aphrodisiac, Fusarium oxysporus and stem-spot-sporidium rot bacteria, and promotes the growth of rice and tomatoes through irrigation root application.

Benefits of technology

Effectively prevent and control rice blight and tomato blight, while promoting plant growth and increasing yield.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120399894A_ABST
    Figure CN120399894A_ABST
Patent Text Reader

Abstract

The invention provides a disease-resistant and growth-promoting aspergillus alabamate AF-Q5, a microbial preparation and application of the microbial preparation, and belongs to the technical field of microorganisms. The invention provides aspergillus alabamaensis AF-Q5, and the preservation number of the aspergillus alabamaensis AF-Q5 is CGMCC (China General Microbiological Culture Collection Center) No. 41805. The aspergillus alabamaensis AF-Q5 can be used for producing cellulase and has the capability of decomposing cellulose; the bactericidal composition has the inhibiting ability on pathogenic bacteria such as fusarium oxysporum, Adiplomonas minuta, fusarium oxysporum, phomopsis and phytophthora, can be applied to prevention and treatment of rice seedling blight and / or tomato fusarium wilt, can also promote growth of rice and / or tomatoes, and is beneficial to increase of the yield of rice and / or tomatoes and the like.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the technical field of microbiology, and particularly relates to an Aspergillus alabamensis AF-Q5 with disease resistance and growth promotion, a microbial agent thereof, and their applications. Background Art

[0002] Blast of rice seedlings belongs to soil-borne diseases, which are caused by the infection of various pathogens, such as Fusarium. Fusarium generally overwinters in the diseased residues of various hosts and soil in the form of mycelia and chlamydospores. When environmental conditions are suitable, conidia are produced and spread by air currents to cause infection and damage.

[0003] Currently, the main methods for controlling blast of rice seedlings are as follows: when the rice seedlings are at the 1-2 leaf stage, Qingkulike is sprayed; or sowing is carried out at an appropriate time limit, the seedbed is managed, and work such as cold prevention, heat preservation, and ventilation is done well; or field management is strengthened. However, these methods can only temporarily reduce the incidence rate, and the effect is minimal.

[0004] Currently, the effect of using microbial agents to control blast of rice seedlings is becoming increasingly prominent. For example, Bacillus velezensis can be used to prepare Bacillus spore agents to control blast of rice seedlings; in addition, a microbial agent composed of a compound bacterium agent such as Bacillus thuringiensis, Trichoderma longibrachiatum, and Saccharomyces cerevisiae has a strong inhibitory effect on the pathogens of blast of rice seedlings and shows a good control effect on blast of rice seedlings, etc.

[0005] However, there has been no reported Aspergillus alabamensis that can be applied to control blast of rice seedlings. Summary of the Invention

[0006] Aiming at the defects in the prior art, the purpose of the present invention is to provide an Aspergillus alabamensis that can be applied to control blast of rice seedlings and promote the growth of rice.

[0007] The purpose of the present invention is achieved through the following technical solutions: The present invention provides an Aspergillus alabamensis ( Aspergillus alabamensis ) AF-Q5 with disease resistance and growth promotion, and the preservation number of the Aspergillus alabamensis AF-Q5 is CGMCC No. 41805.

[0008] The present invention provides a microbial agent, which comprises the Aspergillus alabamensis AF-Q5 described in the above technical solution and / or the fermentation product of the Aspergillus alabamensis AF-Q5.

[0009] Preferably, the viable count of the Aspergillus alabamensis AF-Q5 in the microbial agent is 1×10 7 ~1×10 9 CFU / mL.

[0010] The present invention provides a preparation method of the microbial agent described in the above technical solution, including: Culturing the Aspergillus alabamensis AF-Q5 to obtain a microbial agent.

[0011] The present invention provides the application of the Aspergillus alabamensis AF-Q5 described in the above technical solution, the microbial agent described in the above technical solution, or the microbial agent prepared by the preparation method described in the above technical solution in the preparation of a pathogen inhibitor; the pathogen includes any one or several of Fusarium acuminatum, Didymella bryoniae, Fusarium oxysporum, Phomopsis vexans, and Phytophthora spp.

[0012] The present invention provides the application of the Aspergillus alabamensis AF-Q5 described in the above technical solution, the microbial agent described in the above technical solution, or the microbial agent prepared by the preparation method described in the above technical solution in promoting plant growth and / or disease control; the plant includes rice and / or tomato; the disease includes rice damping-off and / or tomato wilt.

[0013] The present invention provides a method for promoting plant growth and / or disease control, including: Applying the microbial agent described in the above technical solution during the plant growth process; The plant includes rice and / or tomato.

[0014] Preferably, the method for applying the microbial agent includes root irrigation.

[0015] Preferably, when the plant is rice, the microbial agent is applied at the stage when the rice seedlings grow to 1-2 leaf stages.

[0016] Preferably, when the plant is tomato, the microbial agent is applied when the tomato grows to 2-4 true leaves.

[0017] The beneficial effects of the present invention: The present invention provides a disease-resistant and growth-promoting Aspergillus alabamensis ( Aspergillus alabamensis ) AF-Q5, and the preservation number of the Aspergillus alabamensis AF-Q5 is CGMCC No. 41805. The Aspergillus alabamensis AF-Q5 has high salt tolerance and alkali tolerance; can produce cellulase and has the ability to decompose cellulose; has an inhibitory ability against pathogens such as Fusarium acuminatum, Didymella bryoniae, Fusarium oxysporum, Phomopsis vexans, and Phytophthora spp. The results of the examples of the present invention show that the Aspergillus alabamensis AF-Q5 can be applied to control rice damping-off, and while controlling rice damping-off, it can also promote the growth of rice, which is beneficial to increasing the rice yield, etc. Further, the Aspergillus alabamensis AF-Q5 provided by the present invention can also be applied to the control of tomato wilt and promote the growth of tomato.

[0018] Biological Deposit Description Aspergillus alabamensis AF-Q5, taxonomically named as: Aspergillus alabamensis , was deposited at the General Microbiological Center of the China Committee for Culture Collection of Microorganisms on January 22, 2025. The address is No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, and the deposit number is CGMCC No. 41805. Brief Description of the Drawings

[0019] In order to more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required for use in the embodiments. Obviously, the drawings in the following description are only some embodiments of the present invention. For those of ordinary skill in the art, without creative efforts, other drawings can also be obtained based on these drawings.

[0020] Figure 1 It is a result diagram of the plate confrontation test of the biocontrol bacterium AF-Q5 against Fusarium oxysporum; Figure 2 It is a diagram of the colony morphology of AF-Q5 and its morphology under an optical microscope; Figure 3 It is a result diagram of the phylogenetic analysis of the biocontrol bacterium AF-Q5; Figure 4 It is a result diagram of the cellulase activity detection of AF-Q5; Figure 5 It is an observation diagram of Fusarium oxysporum confronted with the biocontrol bacterium AF-Q5; Figure 6 It is a diagram of the hyperparasitism of the biocontrol bacterium AF-Q5 on the hyphae of Fusarium oxysporum; Figure 7 It is a diagram of the hyphae of Fusarium oxysporum growing normally. Detailed Embodiments

[0021] The present invention provides a disease-resistant and growth-promoting Aspergillus alabamensis ( Aspergillus alabamensis ), and the deposit number of the Aspergillus alabamensis AF-Q5 is CGMCC No. 41805.

[0022] The Aspergillus alabamensis AF-Q5 provided by the present invention was isolated from the soil of the alkali land tomato planting base in Daqing City, Heilongjiang Province. After being cultured on a PDA medium at 28 °C for 5 days, the colony diameter of the Aspergillus alabamensis AF-Q5 provided by the present invention is 48 mm. The front of the colony is white to light yellow, the mycelium is white and flocculent, and the back of the colony is white; under an optical microscope, it can be clearly observed that the conidiophores extend vertically from the foot cells, the top of the spore stalks expands, and the spores are spherical. In the present invention, the ITS sequencing analysis result of the Aspergillus alabamensis AF-Q5 is as shown in SEQ ID NO.1. Through the relevant information of the morphology and molecular biology of the strain, the taxonomic status of the strain AF-Q5 is further confirmed.

[0023] The Aspergillus alabamensis AF-Q5 provided by the present invention has high salt tolerance and alkali tolerance. The Aspergillus alabamensis AF-Q5 can grow normally under the condition that the salt concentration of Na2CO3 content ≤ 0.55%, and the Aspergillus alabamensis AF-Q5 can grow normally under the alkaline condition of pH ≤ 12.

[0024] The Aspergillus alabamensis AF-Q5 provided by the present invention can produce cellulase and has the ability to decompose cellulose.

[0025] The Aspergillus alabamensis AF-Q5 provided by the present invention has an inhibitory ability against the pathogens of Fusarium acuminatum, Didymella bryoniae, Fusarium oxysporum and Phomopsis vexans. By the plate confrontation method, the present invention obtains that the mycelial growth inhibition rate of the Aspergillus alabamensis AF-Q5 against Fusarium oxysporum CICC 41029 is 62.22%; it also has an inhibitory ability against the pathogens of Fusarium acuminatum, Didymella bryoniae and Phomopsis vexans. Through the microscopic morphological study of the interaction between the Aspergillus alabamensis AF-Q5 and the pathogen mycelia, it is found that this biocontrol strain shows obvious mycolysis and hyperparasitism against the pathogen Fusarium oxysporum CICC 41029. During the co-culture of the pathogen and this biocontrol strain, the pathogen mycelia are distorted at the mycelial interaction sites, showing phenomena such as protoplast condensation, mycelial thinning and constriction. AF-Q5 grows prostrate around the pathogen mycelia, and after recognition and contact, it spirally winds around the pathogen mycelia, resulting in the rupture of its mycelial wall and the cessation of growth, showing obvious hyperparasitism.

[0026] The Aspergillus alabamensis AF-Q5 provided by the present invention can also be applied to control rice damping-off. While controlling rice damping-off, it can also promote the growth of rice, which is beneficial to increasing the rice yield, etc.

[0027] The Aspergillus alabamensis AF-Q provided by the present invention can also be applied to control tomato wilt. While controlling tomato wilt, it can also promote the growth of tomatoes, which is beneficial to increasing the tomato yield, etc.

[0028] The present invention provides a microbial preparation, comprising Aspergillus alabamensis AF-Q5 and / or its fermentation product as described in the above technical solution. As an optional implementation manner of the present invention, the viable count of Aspergillus alabamensis AF-Q5 in the microbial preparation is 1×10 7 ~1×10 9 CFU / mL, or may also be 1×10 8 CFU / mL.

[0029] The present invention provides a preparation method of the microbial preparation as described in the above technical solution, comprising: Culturing the Aspergillus alabamensis AF-Q5 to obtain a microbial preparation. As an optional implementation manner of the present invention, the culture medium used for culturing may be a PDA medium; the culture temperature may be 25~28°C, or may also be 25, 26, 27 or 28°C; the culture time may be 5~7 d, or may also be 5, 6 or 7 d.

[0030] After the culturing is completed, the present invention obtains a culture solution. The obtained culture solution can be directly used as a microbial preparation; the obtained culture solution can also be used as a microbial preparation by collecting the thalli, resuspending the thalli to obtain a cell suspension.

[0031] The present invention provides the application of the microbial preparation prepared by Aspergillus alabamensis AF-Q5 as described in the above technical solution, the microbial preparation as described in the above technical solution or the preparation method as described in the above technical solution in the preparation of a pathogen-inhibiting preparation. As an optional implementation manner of the present invention, the pathogen includes any one or more of Fusarium acuminatum, Didymella bryoniae, Fusarium oxysporum, Phomopsis vexans and Phytophthora spp. The results of the examples of the present invention show that Aspergillus alabamensis AF-Q5 has a significant inhibitory effect on Fusarium acuminatum, Didymella bryoniae, Fusarium oxysporum, Phomopsis vexans and Phytophthora spp.

[0032] The present invention provides the application of Aspergillus alabamensis AF-Q5 described in the above technical solution, the microbial agent described in the above technical solution, or the microbial agent prepared by the preparation method described in the above technical solution in promoting plant growth and / or disease control. As an optional embodiment of the present invention, the plants include rice and / or tomato; the diseases include rice damping-off and / or tomato fusarium wilt. The results of the examples of the present invention show that Aspergillus alabamensis AF-Q5 or the microbial agent can be applied to control rice damping-off. While controlling rice damping-off, it can also promote the growth of rice, increase the plant height, root length, stem base width, root number, and fresh weight of the plant, etc., and thus is beneficial to increasing the rice yield. Aspergillus alabamensis AF-Q5 or the microbial agent can be applied to control tomato fusarium wilt, while promoting the growth of tomato, promoting the elongation of tomato roots, increasing the fresh weight and dry weight of tomato, and thus is beneficial to increasing the tomato yield.

[0033] The present invention provides a method for promoting plant growth and / or disease control, including: Applying the microbial agent described in the above technical solution during the plant growth process.

[0034] As an optional embodiment of the present invention, the plants include rice; the microbial agent is applied when the rice seedlings grow to 1-2 leaf stages. The present invention has no special limitation on the application method, and any conventional application method in the art can be used. The preferred application method of the present invention includes root irrigation.

[0035] As an optional embodiment of the present invention, the plants include tomato; the microbial agent can be applied when the tomato grows to 2-4 true leaves, or can also be applied when it grows to 3-4 true leaves. The present invention has no special limitation on the application method, and any conventional application method in the art can be used. The preferred application method of the present invention includes root irrigation.

[0036] In order to further illustrate the present invention, the technical solutions provided by the present invention will be described in detail below with reference to the drawings and examples, but they cannot be understood as limiting the protection scope of the present invention.

[0037] The compositions of the media used in the following examples are shown in Tables 1-2.

[0038] Table 1 Potato Dextrose Agar Medium (PDA)

[0039] Potato Dextrose Broth Medium (PDB) is a PDA medium without agar. Both media are at natural pH and are heated in a high-pressure steam sterilizer at 115 °C for 20 min, and then cooled to room temperature for standby.

[0040] Table 2 Sodium Carboxymethylcellulose Medium

[0041] 0.1% Congo red dye: Weigh 1.0 g of Congo red, dissolve it in distilled water and make up the volume to 1000 mL.

[0042] NaCl eluent (1 mol / L): Weigh 58.5 g of NaCl, dissolve it in distilled water and make up the volume to 1000 mL.

[0043] The culture medium for measuring the cellulase activity produced by microorganisms was prepared according to the formula in Table 2, adjusted to pH 7.2, heated in a high-pressure steam sterilizer at 121 °C for 20 min, and cooled to room temperature for standby.

[0044] Example 1 1. Isolation and purification of biocontrol bacteria The soil was taken from the alkali land tomato planting base in Daqing City, Heilongjiang Province, and the microorganisms in the soil were isolated by the dilution coating plate method. Weigh 10 g of fresh rhizosphere soil sample, add it to 90 mL of sterilized water containing glass beads, shake for 10 min, and let it stand to obtain a soil stock solution with a concentration of 10 -1 The soil stock solution was serially diluted with sterile water to obtain five gradients of soil suspensions with concentrations of 10 -2 -10 -6 Then, use a pipette to aspirate 200 μL of the soil suspensions with concentrations of 10 -4 、10 -5 、10 -6 Coat them onto PDA medium containing 50 μg / mL of chloramphenicol. The PDA was set with two salt contents, namely Na2CO3 with concentrations of 0.1% and 0.15% respectively. Each dilution gradient was set with 3 replicates, and incubated at 30 °C in an inverted position for 3 d. Select the dominant colonies for further purification culture.

[0045] 2. Screening of biocontrol strains Using Fusarium oxysporum Fusarium oxysporum (strain number: CICC 41029) as the target bacterium, the plate confrontation method was used to preliminarily screen the strains with inhibitory effects on the target bacterium.

[0046] First, activate the Fusarium oxysporum pathogen, and inoculate a target pathogen cake with a diameter of 5 mm in the center of the PDA plate by the cross-streak method. Inoculate the tested biocontrol bacteria obtained from step 1 with a diameter of 5 mm on the cross-line about 2 cm away from the center. Use the plate inoculated with the pathogen alone as a control, and do 3 replicates for each tested biocontrol bacterium. Incubate at 28 °C for 7 d, observe whether an inhibition zone appears in the tested fungi, and preliminarily screen out the strains with inhibitory effects on the target pathogen.

[0047] The strains obtained from the primary screening were further subjected to a secondary screening using the plate confrontation culture method. Specific method: Using the cross-streaking method, inoculate 5 mm of the target pathogen at one end 2 cm away from the center, and inoculate 5 mm of the biocontrol bacterium to be tested at the corresponding other end. Use the plate inoculated with the target pathogen only on one side as a control. Incubate at a constant temperature of 28°C. Each treatment of the biocontrol bacterium to be tested was repeated 3 times. When the colonies in the control group grew to the edge of the culture medium, observe the antibacterial effect of the biocontrol bacterium strain to be tested, and measure the colony radius of the pathogen in the control group and the experimental group respectively, and calculate the inhibition rate.

[0048] Inhibition rate (%) = (colony radius of the control group - colony radius of the experimental group) / colony radius of the control group × 100%.

[0049] The obtained salt-tolerant fungi were subjected to a secondary screening, and 1 strain with stable growth and good antibacterial effect was obtained, named AF-Q5. Its antibacterial effect is as Figure 1 shown in and Table 3, where Figure 1 A in is the result of the secondary screening of the AF-Q5 plate confrontation test; Figure 1 B in is the test result of the control group.

[0050] Table 3 Inhibition rate of AF-Q5 against Fusarium oxysporum

[0051] From Figure 1 and Table 3, it can be seen that compared with the control group CK, AF-Q5 can significantly inhibit the mycelial growth of the pathogen, and its inhibition rate is 62.22%.

[0052] 3. Morphological and molecular biological identification of biocontrol bacteria Use a 5 mm punch to punch out a bacterial cake from the edge of the purified AF-Q5 colony, and then place the bacterial cake on a new PDA plate, record its growth rate, and observe the color and morphology of the colony. Use the cover slip culture method, combined with lactophenol cotton blue staining, to observe the mycelial morphology, spore morphology and size, and presence or absence of septa of AF-Q5 through an optical microscope, and classify the strains preliminarily in combination with the above morphological characteristics.

[0053] The purified AF-Q5 obtained by isolation and purification was subjected to ITS sequencing analysis by Shanghai Majorbio Bio-Pharm Technology Co., Ltd. Use the BLAST tool to build a library for the sequencing results, and use the MEGA software for sequence alignment and construction of phylogenetic trees.

[0054] (1)Colony and microscopic morphology of the AF-Q5 biocontrol bacterium The colony morphology of AF-Q5 and its morphology under the optical microscope are as Figure 2 shown, Figure 2 A in is the colony morphology of AF-Q5, where Figure 2 the left picture of A in is the front view of the colony,Figure 2 The right figure of A shows the back of the colony, Figure 2 and the scale bar of A is 1.12 cm; Figure 2 B in it shows the hyphal morphology of AF-Q5, Figure 2 and the scale bar of B is 21 µm; Figure 2 C in it shows the sporulation structure of AF-Q5, Figure 2 and the scale bar of C is 38 µm; Figure 2 D in it shows the spore morphology of AF-Q5, Figure 2 and the scale bar of D is 21 µm. After culturing AF-Q5 on PDA medium for 5 d (28 °C), the colony diameter is 48 mm. The front of the colony is white to light yellow, the hyphae are white and flocculent, and the back of the colony is white. Under an optical microscope, it can be clearly observed that the conidiophores extend vertically from the foot cells, the top of the conidiophores expands, and the spores are spherical.

[0055] (2) Molecular biological identification of the biocontrol bacterium AF-Q5 The ITS sequencing result of the biocontrol bacterium AF-Q5 is shown as SEQ ID NO.1, specifically: GTTTCGAGTGCGGGTCTTTATGGCCCAACCTCCCACCCGTGACTATTGTACCTTGTTGCTTCGGCGGGCCCGCCAGCGTTGCTGGCCGCCGGGGGGCGTCTCGCCCCCGGGCCCGTGCCCGCCGGAGACCCCAACATGAACCCTGTTCTGAAAGCTTGCAGTCTGAGTGTGATTCTTTGCAATCAGTTAAAACTTTCAACAATGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAACTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCCCGGCTTGTGTGTTGGGCCCTCGTCCCCCGGCTCCCGGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGGTCCTCGAGCGTATGGGGCTTCGTCTTCCGCTCCGTAGGCCCGGCCGGCGCCCGCCGACGCATTTGTTTGCAACTTGTTTTTTTCCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAAAA.

[0056] The ITS sequence obtained by sequencing the biocontrol bacterium AF-Q5 was aligned with the GenBank database using the BLAST tool, and a phylogenetic tree was constructed using the MEGA software. The results are as Figure 3 shown. Combining its morphological identification, AF-Q5 was identified as Aspergillus alabamensis Aspergillus alabamensis , and the preservation number of this biocontrol fungus AF-Q5 is CGMCC No. 41805.

[0057] 4. Salt tolerance of the biocontrol bacterium AF-Q5 The screened biocontrol bacterium AF-Q5 was inoculated onto PDA plates containing 0.05%, 0.15%, 0.25%, 0.35%, 0.45% and 0.55% Na2CO3 respectively, and cultured in an inverted position at 28 °C for 5 d. A salt-free treatment group was set as the control to observe the growth of the strains.

[0058] The growth of the biocontrol bacterium AF-Q5 on different salt concentration media is shown in Table 4.

[0059] Table 4 Growth of the biocontrol bacterium AF-Q5 on different salt concentration media <![CDATA[Content of Na2CO3 (%)]]> 0 0.05 0.15 0.25 0.35 0.45 0.55 Colony diameter (cm) 4.85±0.05a 4.25±0.05c 4.65±0.05b 4.15±0.05c 4.15±0.15c 3.70±0.10e 3.90±0.10d

[0060] Note: Different letters in the table indicate significant differences, and the same applies hereinafter.

[0061] The results in Table 4 show that the fungus AF-Q5 can grow on a medium with a salt concentration as high as 0.55%, indicating a certain salt tolerance. As the salt concentration increases, the colony diameter of AF-Q5 shows a downward trend. At a salt concentration of 0.55%, the colony diameter is 3.90 cm, which is 19.58% lower than that of the CK group.

[0062] 5. Alkaline tolerance of the biocontrol bacterium AF-Q5 The screened biocontrol bacterium AF-Q5 was inoculated onto PDA plates with pH values of 7, 8, 9, 10, 11 and 12 respectively, and cultured in an inverted position at 28 °C for 5 d to observe the growth of the strains.

[0063] The growth of the biocontrol bacterium AF-Q5 on different pH media is shown in Table 5.

[0064] Table 5 Growth of the biocontrol bacterium AF-Q5 on different pH media

[0065] Table 5 results showed that the AF-Q5 fungus could grow on the medium with a pH value of 12, indicating good alkali tolerance. During the process of increasing the pH value from 7 to 12, the change in the colony diameter of AF-Q5 was small. When the pH value was 12, the colony diameter was 4.05 cm, which was 16.49% lower than that at a pH value of 7, showing relatively high alkali tolerance.

[0066] Example 2 Antibacterial Spectrum of the AF-Q5 Biocontrol Bacterium Using Fusarium oxysporum f. sp. glycines Fusarium oxysporum QLJ1 (accession number MT180464), Fusarium solani Fusarium solani WF7(2) (accession number MT180477), Fusarium acuminatum Fusarium acuminatum CGMCC 3.6865, Fusarium tricinctum Fusarium tricinctum DJWZ3(3) (accession number MT180474), Rhizoctonia solani Rhizoctonia solani XLZ7(1) (accession number MT180476) [Liu Jinxin. (2020). Analysis of the population structure and genetic diversity of rice sheath blight pathogens in Heilongjiang Province (Master's thesis, Northeast Agricultural University)], Pythium aristosporum Pythium aristosporum JS22 [Liu Jinxin, Zhang Ruisi, Xu Chuzhen, Liu Chunlai, Zheng Yanyan, Zhang Xue & Li Yonggang. (2022). Characterisation of Pythium aristosporum Oomycete—A Novel Pathogen Causing Rice Seedling Blight in China. Journal of Fungi, 8(9), 890 - 890.], Didymella Didymella bryoniae CFCC88122, Phomopsis vexans Phomopsislongicolla MP4PL11PS (GenBank accession number HQ130441.1) [Geng Xiaobing et al. (2015). Identification of Phomopsis vexans causing soybean seedling root rot. Plant Protection, 41(05), 127 - 129 + 144.], Sclerotinia sclerotiorum Sclerotinia sclerotiorum CCTCC KF 2008457, Phytophthora Phytophthora sojaeUsing Ps-H2 [Yang Mingxiu et al. Establishment of virulent pure lines of single oospore strains of Phytophthora sojae. Journal of Northeast Agricultural University, (06), 702-706. doi: 10.19720 / j.cnki.issn.1005-9369.2005.06.003.] as the target strain, the antibacterial effects of the biocontrol bacterium AF-Q5 against 10 soil-borne pathogenic fungi were determined by the plate confrontation method and the cross-cross method.

[0067] By using the plate confrontation method, the inhibitory activities of AF-Q5 against 10 pathogenic fungi were determined, and the results are shown in Table 6.

[0068] Table 6 Antibacterial spectrum of the biocontrol bacterium AF-Q5 against the tested pathogenic bacteria

[0069] Note: -: No antibacterial activity was detected; +: Inhibited the mycelial growth of the pathogenic bacterium The inhibitory activities of AF-Q5 against 10 pathogenic fungi were determined, and the results are shown in Table 6. From the results in the table, it can be seen that AF-Q5 has the inhibitory ability against a total of 4 pathogenic fungi, namely Fusarium acuminatum, Didymella bryoniae, Phomopsis vexans, and Phytophthora sp.

[0070] Example 3 Cellulase activity of the biocontrol bacterium AF-Q5 Take a 5-mm-diameter bacterial cake of the biocontrol bacterium AF-Q5 and inoculate it at the center of the carboxymethyl cellulose sodium medium. Incubate it upside down at 28 °C for 7 d. Take out the petri dish, evenly cover the entire surface of the medium with a 0.1% Congo red solution, and let it stand for staining for 15 min. Elute it with 1 mol / L NaCl solution for 20 min. A light yellow transparent circle will appear around the colony that can degrade cellulose. Measure and calculate the ratio HC of the transparent circle to the colony diameter to estimate the cellulase activity of the strain.

[0071] On the CMC medium stained with Congo red, a transparent circle will form around the fungal colony that produces cellulase. The appearance of this phenomenon is because the cellulase produced by the fungal colony decomposes the CMC in the medium, thus forming a transparent area near the colony. Congo red dye has a good affinity for CMC, but it cannot bind in the area where CMC is acted on by cellulase, so it will not show red. As Figure 4 shown, AF-Q5 formed obvious transparent circles on the CMC medium, indicating that it has the ability to decompose cellulose. Among them, the diameter of the transparent circle of AF-Q5 is 48 mm, and the HC value is 1.07.

[0072] Example 4 Study on the antibacterial activity of the biocontrol bacterium AF-Q5 1. Direct inhibitory effect of biocontrol bacterium AF-Q5 on the mycelia of pathogenic fungi The inhibitory effect of biocontrol bacterium AF-Q5 on the mycelia of pathogenic fungus Fusarium oxysporum ( Fusarium oxysporum , strain number: CICC 41029) was observed by the dual-culture method combined with the slide insertion method and staining method. Pathogenic bacteria with a diameter of 5 mm and biocontrol bacterium AF-Q5 were inoculated 2 cm from the midpoint of the PDA plate medium. Two sterile cover glasses were symmetrically inserted on the perpendicular bisector of the two strains of bacteria and cultured upside down at 28 °C until the mycelia of the two strains of bacteria climbed onto or intersected with the cover glasses and then the culture was stopped. The medium with an intersection trend between the pathogenic bacteria and AF-Q5 biocontrol bacteria was cut with a sterile scalpel and placed under a microscope to observe the morphology of aerial mycelia; the medium was cut into thin slices with a scalpel, and the longitudinal section of the medium was placed under a microscope to observe the morphology of substrate mycelia. Observe whether the mycelia of the pathogenic bacteria show deformation, dissolution or parasitism. During the observation process, cotton blue dye can be used for staining to facilitate the observation of the mycelial morphology.

[0073] The interaction between biocontrol bacterium AF-Q5 and Fusarium oxysporum was observed through an optical microscope. During the confrontation between the pathogenic bacteria and biocontrol bacterium AF-Q5, their lytic effect and hyperparasitism were observed by their natural diffusion and mutual competition in the medium. When two microorganisms meet in the medium, their interaction can be manifested at the contact interface.

[0074] In the dual-culture experiment, take the mycelia at the edge of the pathogenic bacteria near the biocontrol bacterium AF-Q5 to make sections, and observe them under a microscope after treatment with cotton blue staining. The results are shown in Figures 5 - 7 . Among them Figure 5 is Fusarium oxysporum confronting with biocontrol bacterium AF-Q5, Figure 5 The scale bar in Figure 6 is the hyperparasitism of biocontrol bacterium AF-Q5 on the mycelia of Fusarium oxysporum, Figure 6 The scale bar in Figure 7 is the mycelia of Fusarium oxysporum growing normally.

[0075] Hyperparasitism refers to a series of continuous processes of biocontrol bacteria recognizing, contacting, winding, penetrating and parasitizing pathogenic bacteria, consuming the nutrients and vital energy of pathogenic bacteria, making the mycelia of pathogenic bacteria thinner, and the mycelial wall rupturing and finally dying. As can be seen from Figures 5 - 7 , in the control group (CK), the mycelia of pathogenic bacteria were smooth and naturally extended, and the thickness was uniform under the natural growth state ( Figure 7 ). However, under the interaction condition with biocontrol bacterium AF-Q5, the mycelia of Fusarium oxysporum showed obvious distortion, accompanied by constriction phenomenon ( Figure 5). The hyphae of the biocontrol bacterium AF-Q5 grow prostrate around the hyphae of Fusarium oxysporum. After identifying and contacting Fusarium oxysporum, they spiral around the hyphae of the pathogen. This entanglement, along with further enzymatic penetration and parasitism of the cell wall, can interfere with the pathogen's nutrient absorption and ultimately lead to the cessation of hyphal growth ( Figure 6 ).

[0076] Example 5 Experiment on the control effect of the biocontrol bacterium AF-Q5 against rice damping-off 1. Experimental design Experimental materials: Rice variety: Zhongkefa No. 5. Pathogen: Fusarium oxysporum ( Fusarium oxysporum , strain number: CICC 41029). Biocontrol bacterium: Aspergillus alabamensis AF-Q5( A. alabamensis ).

[0077] Experimental treatments: Blank control group: Neither inoculated with the pathogen nor added with the biocontrol bacterium. Control group: Inoculated with Fusarium oxysporum without adding the biocontrol bacterium. Treatment group 1: Inoculated with Fusarium oxysporum + Aspergillus alabamensis AF-Q5. Each group was set up with 3 parallel experiments.

[0078] 2. Cultivation of the pathogen and the biocontrol bacterium Cultivation of Fusarium oxysporum: Inoculate Fusarium oxysporum onto PDA medium and culture it in an incubator at 25 - 28 °C for 5 - 7 d. Collect the spores and prepare a spore suspension (concentration about 1×10 6 spores / mL) to obtain the Fusarium oxysporum spore suspension.

[0079] Cultivation of the biocontrol bacterium: Inoculate the biocontrol bacterium Aspergillus alabamensis AF-Q5 onto PDA medium and culture it at 28 °C for 5 - 7 d. After cultivation, collect the mycelium and prepare a bacterial suspension (concentration about 1×10 7 CFU / mL) to obtain the biocontrol bacterium suspension.

[0080] 3. Rice seedling raising and inoculation Seedling raising: Select healthy rice seeds. Disinfect the rice seeds by soaking them in 75% alcohol for 30 s for the first time. After taking out the seeds, soak them in 5% sodium hypochlorite for 1 min for the second time, rinse them 3 times with sterile water to remove the residual chlorine, and finally dry the surface moisture of the seeds for standby. Place the seeds on double-layer absorbent filter paper in a 10 cm petri dish and moisten them with 10 mL of distilled water. When the radicle appears 2 mm or longer, the seeds are considered germinated.

[0081] Add sterilized nutrient soil to the seedling tray, sow the germinated seeds in the seedling tray, and maintain appropriate temperature and humidity for seedling raising.

[0082] 4. Inoculation of the pathogen: When the rice seedlings grew to the 1-2 leaf stage, they were inoculated with a spore suspension of Fusarium oxysporum. The inoculum volume of Fusarium oxysporum was 50 mL per plate, and the concentration of the suspension was 1×10 6 spores / mL.

[0083] Inoculation of biocontrol bacteria: Three days before the inoculation of the pathogen, the biocontrol suspension was irrigated into the roots. That is, three days after the biocontrol suspension was irrigated into the roots, Fusarium oxysporum was inoculated. The inoculation amount of the rice biocontrol agent was 50 mL per tray, and the concentration of the bacterial solution was 1×10 7 CFU / mL.

[0084] At the same time, the control group was set up without using the biocontrol bacteria suspension to irrigate the roots, but was watered with an equal amount of sterile water.

[0085] The blank control group was not irrigated with the spore suspension of Fusarium oxysporum or the biocontrol bacteria suspension, but with an equal amount of sterile water.

[0086] 5. Seedling management Environmental control: Maintain temperature at 25-30°C and humidity at 70%-80% to simulate conditions suitable for disease occurrence.

[0087] Water management: Keep the soil moist, avoid being too dry or too wet.

[0088] 6. Data Collection From each treatment group, 100 rice plants at the three-leaf, one-heart stage were randomly selected and their stem base width, root number, root length, and plant height were measured. In addition, the fresh and dry weights of all 100 rice plants in each treatment group were measured. Through a comprehensive analysis of these indicators, the disease status of rice and the efficacy of the biocontrol agent were evaluated.

[0089] 7. Notes Aseptic operation: When inoculating pathogens and biocontrol bacteria, ensure that the operating environment is sterile to avoid cross contamination.

[0090] Experimental consistency: Keep the experimental conditions of each group consistent to reduce errors.

[0091] Repeat the test: To ensure the reliability of the results, it is recommended to repeat the test 2-3 times.

[0092] 8. The test results are shown in Table 7.

[0093] Table 7 Test results of rice plant growth indicators in different experimental groups

[0094] As shown in Table 7, after inoculating rice seedlings with Fusarium oxysporum, it had a significant adverse effect on the rice seedlings, significantly reducing the stem base width and root number of the rice plants. After inoculating with Fusarium oxysporum, inoculating the biocontrol bacterium AF-Q5 could significantly alleviate the inhibitory effect of Fusarium oxysporum on the growth of rice plants. At the same time, compared with the blank control group, after inoculating with the biocontrol bacterium AF-Q5, it could also significantly promote the growth of rice plants, increasing the plant height, root length, stem base width, root number, and fresh weight of the plants. Therefore, the biocontrol bacterium AF-Q5 can significantly improve the incidence of Fusarium oxysporum, and at the same time, it can also promote the growth of rice.

[0095] 8. The incidence of rice damping-off of rice plants in the three-leaf and one-heart growth stage in each treatment group was statistically analyzed, and the incidence (%) = (number of diseased plants / total number of plants surveyed) × 100%.

[0096] The statistical results are shown in Table 8.

[0097] Table 8 Effect of AF-Q5 on the incidence of rice damping-off

[0098] As shown in Table 8, the biocontrol bacterium AF-Q5 can significantly improve the incidence of Fusarium oxysporum and reduce the incidence of rice damping-off.

[0099] Example 6 Experiment on the control effect of the biocontrol bacterium AF-Q5 against tomato fusarium wilt 1. Experimental design Experimental materials: Tomato variety: Tall-stemmed big red.

[0100] Pathogen: Fusarium oxysporum ( Fusarium oxysporum , strain number: CICC 41029).

[0101] Biocontrol bacterium: Aspergillus alabamensis AF-Q5( A. alabamensis ).

[0102] Experimental treatments: Blank control group: Neither inoculated with the pathogen nor added with the biocontrol bacterium.

[0103] Control group: Inoculated with Fusarium oxysporum, without adding the biocontrol bacterium.

[0104] Treatment group 1: Inoculated with Fusarium oxysporum + Aspergillus alabamensis AF-Q5.

[0105] Each group was set with 3 replicates.

[0106] 2. Cultivation of the pathogen and the biocontrol bacterium Cultivation of Fusarium oxysporum: Inoculate Fusarium oxysporum onto PDA medium and incubate it in an incubator at 25 - 28°C for 5 - 7 d.

[0107] Collect the spores and prepare a spore suspension (concentration about 1×10 6 spores / mL) to obtain a Fusarium oxysporum spore suspension.

[0108] Biocontrol agent cultivation: Inoculate the biocontrol agent Aspergillus alabamensis AF-Q5 onto PDA medium and incubate it at 28°C for 5 - 7 d. After incubation, collect the mycelium and prepare a bacterial suspension (concentration about 1×10 7 CFU / mL) to obtain a biocontrol agent suspension.

[0109] 3. Tomato seedling raising and inoculation Seedling raising: Select healthy tomato seeds and soak them in 75% alcohol for 30 s for the first disinfection. After taking out the seeds, soak them in sodium hypochlorite with a mass fraction of available chlorine of 5% for 1 min for the second disinfection, and rinse them 3 times with sterile water to remove residual chlorine. Finally, dry the surface moisture of the seeds for standby.

[0110] The culture dishes, filter papers, forceps, and pipette tips used in the experiment are all sterilized by high-temperature steam at 121°C for 20 min. Place two filter papers in each petri dish, put the pre-sterilized tomato seeds (50 seeds per dish) in the middle of the two filter papers, add 15 mL of fermentation supernatant to each dish, repeat 3 times for each dilution gradient, and incubate at room temperature. Record the germination when the radicle of the tomato seed is significantly exposed.

[0111] Add sterilized nutrient soil to the seedling tray, sow the germinated seeds in the seedling tray, and keep appropriate temperature and humidity for seedling raising.

[0112] 4. Inoculate the pathogenic bacteria: When the tomato seedlings grow to have 3 - 4 true leaves, inoculate them by pouring the Fusarium oxysporum spore suspension at the root. The inoculation amount of Fusarium oxysporum is 50 mL per dish, and the concentration of the bacterial solution is 1×10 6 spores / mL.

[0113] Inoculate the biocontrol agent: Inoculate the biocontrol agent 3 d before inoculating the pathogenic bacteria, and pour the biocontrol agent suspension at the root (that is, 3 d after pouring the biocontrol fungal suspension at the root, then inoculate Fusarium oxysporum). The inoculation amount of the biocontrol agent is 50 mL per dish, and the concentration of the bacterial solution is 1×10 7 CFU / mL.

[0114] At the same time, in the control group set, instead of pouring the biocontrol agent suspension at the root, pour an equal amount of sterile water.

[0115] The blank control group was not irrigated with the spore suspension of Fusarium oxysporum, nor with the biocontrol bacteria suspension, but with an equal amount of sterile water.

[0116] 5. Seedling management Environmental control: Keep the temperature at 25 - 30 °C and the humidity at 70% - 80% to simulate the conditions suitable for the occurrence of diseases.

[0117] Water management: Keep the soil moist and avoid being too dry or too wet.

[0118] 6. Data collection Thirty days after inoculation with the biocontrol bacteria, the plant growth indexes were measured, including root length, fresh weight, and dry weight. Through the comprehensive analysis of the above indexes, at the same time, the incidence rate of tomatoes was counted, and the method was the same as that in Example 5.

[0119] 7. Precautions Sterile operation: When inoculating pathogenic bacteria and biocontrol bacteria, ensure that the operation environment is sterile to avoid cross - contamination.

[0120] Test consistency: Keep the test conditions of each group consistent to reduce errors.

[0121] 8. The test results are shown in Tables 9 - 10.

[0122] Table 9 Detection results of tomato plant growth indexes in different test groups

[0123] As can be seen from Table 9, after tomatoes were inoculated with the pathogenic bacteria Fusarium oxysporum, the root length, above - ground fresh weight, above - ground dry weight, underground fresh weight, and underground root weight all decreased significantly. It can be seen that Fusarium oxysporum significantly inhibited the growth of tomatoes. For the treatment group inoculated with AF - Q5 strain and Fusarium oxysporum, compared with the treatment group inoculated only with Fusarium oxysporum, the root length, above - ground fresh weight, above - ground dry weight, underground fresh weight, and underground root weight of tomatoes were significantly increased, and its growth effect was equivalent to that of the control group, and even better than that of the control group. It can be seen that the AF - Q5 strain can significantly improve the disease incidence of Fusarium oxysporum and, at the same time, promote the growth of tomatoes.

[0124] Table 10 Incidence rate of tomato plants in different test groups

[0125] As can be seen from Table 10, the biocontrol bacteria AF - Q5 can significantly improve the disease incidence of Fusarium oxysporum and reduce the incidence rate of tomato wilt disease.

[0126] Although the above - mentioned embodiments have described the present invention in detail, they are only a part of the embodiments of the present invention, not all of them. People can also obtain other embodiments without creative work based on these embodiments, and these embodiments all fall within the protection scope of the present invention.

Claims

1. A disease-resistant and growth-promoting Aspergillus alabamensis ( Aspergillus alabamensis ), AF-Q5, characterized in that The preservation number of the Aspergillus alabamensis AF-Q5 is CGMCC No. 41805.

2. A microbial preparation, characterized in that, It includes the Aspergillus alabamensis AF-Q5 described in claim 1 and / or the fermentation product of the Aspergillus alabamensis AF-Q5.

3. The microbial agent according to claim 2, characterized in that, The viable count of Aspergillus alabamensis AF-Q5 in the microbial preparation is 1×10 7 ~1×10 9 CFU / mL.

4. The preparation method of the microbial preparation according to claim 2 or 3, characterized in that, It includes: Culturing the Aspergillus alabamensis AF-Q5 to obtain a microbial preparation.

5. Use of the Aspergillus alabamensis AF-Q5 described in claim 1, the microbial preparation described in claim 2 or 3, or the microbial preparation prepared by the preparation method described in claim 4 in the preparation of a pathogen-inhibiting preparation; the pathogens include any one or several of Fusarium acuminatum, Didymella bryoniae, Fusarium oxysporum, Phomopsis vexans, and Phytophthora spp.

6. Use of the Aspergillus alabamensis AF-Q5 described in claim 1, the microbial preparation described in claim 2 or 3, or the microbial preparation prepared by the preparation method described in claim 4 in promoting plant growth and / or disease control; the plants include rice and / or tomato; the diseases include rice damping-off and / or tomato wilt.

7. A method for promoting plant growth and / or disease control, characterized in that, It includes: Applying the microbial preparation described in claim 2 or 3 during the plant growth process; The plants include rice and / or tomato.

8. The method according to claim 7, wherein The method of applying the microbial preparation includes root irrigation.

9. The method according to claim 7 or 8, characterized in that, When the plant is rice, the microbial preparation is applied when the rice seedlings grow to the 1-2 leaf stage.

10. The method according to claim 7 or 8, characterized in that When the plant is tomato, the microbial preparation is applied when the tomato grows to 2-4 true leaves.