Sporosarcina pasteurii with high urease activity and application thereof
By induced calcium carbonate deposition with high urease activity, the problem of insufficient permeability and strength of traditional cultural relics reinforcement materials in a high water content environment was solved, and efficient reinforcement and repair of unearthed ivory was achieved.
Patent Information
- Application Number
- CN202510546836.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-04-28
- Publication Date
- 2025-08-01
AI Technical Summary
Existing cultural relics reinforcement materials are difficult to effectively penetrate and reinforce in a high moisture content environment, traditional polymer materials are easy to degrade, and the inorganic materials are slow to form strength and have low permeability, which cannot meet the reinforcement needs of unearthed ivory.
The strain of Basil Pasteuris with high urease activity was used to induce calcium carbonate deposition through immersion, and the urease catalytic action of the strain was used to generate calcium carbonate precipitation, fill ivory pores and strengthen.
The efficient reinforcement of unearthed ivory has been achieved, the compressive strength reaches 30.9MPa, the reinforcement cycle is shortened, and the appearance of cultural relics is not changed. It is environmentally friendly and resource-saving.
Smart Images

Figure CN120399951A_ABST
Abstract
Description
Technical Field
[0001] The present application relates to the field of biotechnology, and particularly relates to Sporosarcina pasteurii with high urease activity and its application. Background Art
[0002] Conservation materials for cultural relics are one of the main research contents of cultural relics protectors. So far, many polymer materials, such as acrylate copolymers, polyvinyl acetate water emulsions, polyethylene glycols, and epoxy resin adhesives, have been used for the reinforcement of cultural relics due to their optical transparency, excellent mechanical strength, and adhesion ability. However, these polymers are prone to degradation due to oxidation and chain scission reactions.
[0003] Since the unearthed ivory has been buried in an environment with a high moisture content, the ivory has been colonized by a large number of microorganisms. The unearthed ivory mainly consists of organic collagen fibers and hydroxyapatite (HAP) mineral phases deposited in the collagen fibers. In a water-saturated burial environment, the collagen fibers in the unearthed ivory are prone to hydrolysis in an alkaline environment and are easily degraded by microbial collagenase. Due to the degradation and loss of organic collagen, the unearthed ivory usually has a porous hydroxyapatite skeleton. After the collagen fibers that play a supporting role in the unearthed ivory are degraded, the remaining pores are filled and supported by water and invading soil particles. Once the unearthed water-saturated ivory is exposed to air, the rapid volatilization of water causes the structure of the unearthed ivory to lose support, resulting in a decrease in its strength and easy collapse.
[0004] According to the specific requirements for conservation materials in the Guidelines for the Conservation of Chinese Cultural Relics and Historic Sites, the conservation materials should meet the following conditions: ① having a certain penetration depth and high reinforcement efficiency; ② the conservation materials cannot change the original appearance of the cultural relics, that is, the color difference before and after the reinforcement of the reinforcement liquid should be within the range recognizable by the human eye (△E*<5); ③ after the reinforcement is completed, the sample has a certain reinforcement strength.
[0005] Traditional conservation materials for cultural relics are mainly organic polymer materials and inorganic materials. Among them, organic conservation materials, such as polyvinyl acetate acetate and copolymers of ethyl methacrylate and methyl methacrylate, are widely used in the protection of bone cultural relics due to their optical transparency, rapid strength improvement, easy application, and strong adhesion ability. However, these polymers are prone to degradation due to oxidation and chain scission reactions, and it is difficult to apply them to the protection of cultural relics with high water content. Therefore, inorganic materials such as ammonium phosphate solutions and calcium hydroxide nanodispersions are increasingly used in the protection of bone cultural relics due to their sufficient chemical stability and good compatibility with bone cultural relics. However, inorganic materials still have some disadvantages, such as slow strength formation and low permeability.
[0006] Since the pores in waterlogged unearthed ivory are filled with water and there is not enough space to accommodate the protective material, it is very difficult for polymers (such as acrylate copolymers) commonly used in traditional cultural relic reinforcement to penetrate into the ivory in large quantities. When dehydrating and reinforcing unearthed ivory, both the solid strength and the impact of the reinforcing material on the appearance of cultural relics need to be considered. There is an urgent need for an efficient method for reinforcing cultural relics. Summary of the Invention
[0007] To solve the defects of the prior art, through a large number of studies on the structure and pores of unearthed ivory, the present application has screened out a strain of Sporosarcina pasteurii with high urease activity, and developed a method for reinforcing unearthed ivory cultural relics by submerging this strain, and optimized the reinforcement conditions. When the strain of the present application and the method using this strain are used for reinforcing and repairing unearthed ivory, they can fill the pores on the surface of unearthed ivory, making the reinforced unearthed ivory have a relatively large compressive strength.
[0008] The first aspect of the present application provides a Sporosarcina sp., and its preservation number is CCTCC M2025059.
[0009] The 16S rDNA sequence of the Sporosarcina sp. contains the sequence shown in SEQ ID No.3.
[0010] The urease activity of the Sporosarcina sp. is above 3.0 U / ml.
[0011] The second aspect of the present application provides a bacterial agent, which contains the Sporosarcina sp. in the first aspect above.
[0012] The third aspect of the present application provides the use of the Sporosarcina sp. in the first aspect above, or the bacterial agent in the second aspect above, in inducing calcium carbonate deposition and solidification, and / or reinforcing bone cultural relics, and / or repairing bone cultural relics.
[0013] The bone cultural relics are unearthed ivory.
[0014] The fourth aspect of the present application provides a method for reinforcing or repairing bone cultural relics, including treating the bone cultural relics with the Sporosarcina sp. in the first aspect above, or the bacterial agent in the second aspect above.
[0015] The method further includes treating the bone cultural relics with a calcifying solution.
[0016] The ratio of the concentration of the Sporosarcina sp. to the concentration of the calcifying solution is 2.5×10 9 ~7.5×
[0017] 10 9 cfu / mL: 1 mol / L.
[0018] The bone cultural relic is unearthed ivory.
[0019] The calcification solution includes calcium salt and urea, and the molar ratio of the calcium salt to the urea is 1:1 - 3.
[0020] The calcium salt is selected from one or more of calcium chloride, calcium nitrate, and calcium acetate.
[0021] The steps of the method are as follows: Soak the unearthed ivory with the Sporosarcina sp. bacterial solution, perform the first placement after soaking, soak the unearthed ivory with the calcification solution, perform the second placement after soaking, and repeat the above steps more than 6 times.
[0022] The beneficial effects of this application are as follows:
[0023] This application has obtained a Sporosarcina sp. strain with high urease activity through screening and optimization. It has high urease activity, and both the growth ability and urease activity are significantly enhanced compared with existing strains.
[0024] This strain can be used for the reinforcement and repair of bone cultural relics. Using this strain to induce calcification and reinforce bone cultural relics by immersion, for example, when repairing specific unearthed ivory samples, compared with traditional chemical reinforcement, the method of this application has the advantages of being simple and easy to operate, environmentally friendly, short curing period, resource - saving, etc. At the same time, the total soaking time is short, reducing the impact of water on the samples. And through the optimization of the reinforcement conditions, the method of this application can completely fill the pores and micropores on the surface of unearthed ivory during the reinforcement of unearthed ivory. The maximum pressure of the reinforced ivory reaches 9.7 kgf, and the compressive strength can reach 30.9 MPa, which is superior to traditional reinforcement methods, providing a new and efficient solution for the reinforcement and repair of unearthed ivory cultural relics. BRIEF DESCRIPTION OF THE DRAWINGS
[0025] Figure 1 It is the agarose gel electrophoresis pattern of the amplification product after amplifying the genomic DNA of the strain in Example 2.
[0026] Figure 2 It is the comparison of the 16S rDNA sequence obtained by sequencing in Example 2 with the sequences of related species in the GenBank database.
[0027] Figure 3 It is the schematic diagram of the device for microbial - induced calcification and reinforcement of unearthed ivory by immersion in Example 3.
[0028] Figure 4Photo of unearthed ivory sample before reinforcement in Example 7 (5-micron scale).
[0029] Figure 5 Photo of unearthed ivory sample before reinforcement in Example 7 (1-micron scale).
[0030] Figure 6 Photo of unearthed ivory sample after microbial-induced calcification reinforcement in Example 7 (1-micron scale).
[0031] Figure 7 Effect of calcium concentrates with different concentrations on the solidification effect in Example 5.
[0032] Figure 8 Effect of bacterial solutions with different concentrations on the solidification effect in Example 6. Specific implementation manners
[0033] The following specific examples illustrate the implementation manners of the present application. Those skilled in the art can easily understand other advantages and effects of the present application from the content disclosed in this specification. The present application can also be implemented or applied through other different specific implementation manners. Various details in this specification can also be modified or changed based on different viewpoints and applications without departing from the spirit of the present application.
[0034] Before further describing the specific implementation manners of the present application, it should be understood that the protection scope of the present application is not limited to the specific implementation manners described below; it should also be understood that the terms used in the embodiments of the present application are for describing specific implementation manners, rather than for limiting the protection scope of the present application; in the specification and claims of the present application, unless otherwise clearly indicated in the text, the singular forms "a", "an", and "the" include the plural forms.
[0035] When an embodiment gives a numerical range, it should be understood that unless otherwise specified in the present application, any value between the two endpoints of each numerical range and either of the two endpoints can be selected. Unless otherwise defined, all technical and scientific terms used in the present application have the same meaning as commonly understood by those skilled in the technical field of the present application. Except for the specific methods, devices, and materials used in the embodiments, according to the knowledge of those skilled in the technical field of the present application and the description of the present application, any methods, devices, and materials similar or equivalent to the methods, devices, and materials described in the embodiments of the present application can also be used to implement the present application.
[0036] Through a large number of studies on the structure and pores of unearthed ivory, this application discovers that unearthed ivory has a special pore structure with uneven pores and is difficult to fill with polymers such as traditional acrylate copolymers. This application has screened out a strain of Sporosarcina sp. with high urease activity, which can induce calcium carbonate deposition and solidification for the reinforcement and restoration of bone cultural relics.
[0037] This application first provides a strain of Sporosarcina sp. with the preservation number of CCTCC M 2025059, the preservation date of January 8, 2025, and the preservation address of China Center for Type Culture Collection, No. 299, Bayi Road, Wuchang District, Wuhan City, Hubei Province.
[0038] In the specific implementation manner of this application, the strain of Sporosarcina sp. is named Sporosarcina sp. SAR1-02, hereinafter referred to as Sporosarcina SAR1-02.
[0039] The 16S rDNA sequence of the Sporosarcina SAR1-02 contains the sequence shown in SEQ ID No. 3.
[0040] 16S rDNA (16S ribosomal DNA) is a part of the small ribosomal subunit (30S subunit) of bacteria and archaea. It is a highly conserved gene with high sequence similarity among different bacteria and can be used as a molecular marker for bacterial classification and identification. By comparing the similarity of 16S rDNA sequences of different bacteria, their phylogenetic relationships can be inferred and a phylogenetic tree can be constructed.
[0041]
[0042] Due to the high conservation of 16S rDNA, universal primers can be designed to perform PCR amplification on it for the detection and identification of bacteria.
[0043] For example, in the specific embodiments of the present application, the universal primers 27F / 1492R are used to amplify the 16S rDNA of the strain.
[0044] 27F primer: AGAGTTTGATCCTGGCTCAG (SEQ ID NO.1).
[0045] 1492R primer: GGTTACCTTGTTACGACTT (SEQ ID NO.2).
[0046] In the specific embodiments of the present application, the urease activity of the Sarcina pasteurii SAR1-02 is above 3.0 U / ml.
[0047] In some specific embodiments of the present application, the urease activity of the Sarcina pasteurii SAR1-02 can be 5.1 - 7.0 U / ml.
[0048] In the specific embodiments of the present application, the urease activity can be detected by the following method:
[0049] Inoculate the Sarcina pasteurii SAR1-02 strain into 100 mL of LB medium containing 30 g / L urea and culture it in a shaker flask at 30 °C and 200 rpm for 30 h, and determine its urease activity by the conductivity method.
[0050] The specific measurement method is as follows: Take 1 volume of the bacterial liquid and mix it with 9 volumes of 1.1 mol / L urea solution, measure the change in conductivity of the solution within 5 min with a conductivity meter, and multiply the average conductivity change value measured within 5 min (unit: mS / cm / min) by the dilution factor (10 times), which is the initial enzyme activity of the bacterial liquid, that is, the above urease activity. This value reflects the ability of the bacterial liquid to hydrolyze urea. The enzyme activity is defined as: the amount of enzyme required to hydrolyze 1 mmol of urea solution per minute at room temperature is one enzyme activity unit U.
[0051] The present application also provides a bacterial agent, which contains the above-mentioned Sarcina pasteurii SAR1-02.
[0052] The bacterial agent may further include components such as the culture medium required for culturing the microorganism, or additives.
[0053] For example, the bacterial agent can be obtained by culturing Sarcina pasteurii SAR1-02 in a culture medium, or further obtained by other processes such as freeze-drying to obtain a freeze-dried powder.
[0054] The dosage form of the bacterial agent can be liquid bacterial agent, powder bacterial agent, granular bacterial agent, or other dosage forms.
[0055] The present application creatively develops a reinforcement and restoration method for unearthed ivory by immersing it in Sporosarcina pasteurii bacterial liquid and calcification liquid, which can comprehensively reinforce and restore unearthed ivory. Based on the research on the pores of unearthed ivory in the present application, the Sporosarcina pasteurii bacterial liquid and calcification liquid are optimized to adapt to and match the special pore structure and pore conditions of unearthed ivory, and it has the best reinforcement and restoration effect for unearthed ivory with special pore structure and conditions.
[0056] Therefore, the present application also provides the use of the above-mentioned Sporosarcina sp. or the above-mentioned bacterial agent in inducing calcium carbonate deposition and solidification, and / or bone cultural relic reinforcement, and / or bone cultural relic restoration.
[0057] The so-called inducing calcium carbonate deposition and solidification is a technology that uses microbial metabolic activities or urease catalytic action to promote the deposition and solidification of calcium carbonate in a specific environment. Its core principle is to use urease-producing microorganisms or urease itself to hydrolyze urea to generate carbonate ions (CO3 2- ), and then the carbonate ions react with calcium ions (Ca 2+ ) in the environment to form calcium carbonate (CaCO3) precipitate.
[0058] Bone cultural relics refer to various cultural relic products related to bone materials such as animal bones, horns, and teeth. Bone cultural relic reinforcement refers to treating bone cultural relics by physical or chemical methods to improve their mechanical strength, durability, and stability, and prevent them from being further damaged due to environmental factors (such as humidity, temperature changes, microbial erosion, etc.). Bone cultural relic restoration refers to the process of protecting and restoring damaged bone cultural relics due to natural erosion, human damage, or other reasons to restore their integrity, stability, and historical value.
[0059] The present application also provides a method for reinforcing or restoring bone cultural relics, including treating bone cultural relics with the above-mentioned Sporosarcina sp. or the above-mentioned bacterial agent.
[0060] In some embodiments of the present application, the bone cultural relic is unearthed ivory.
[0061] The unearthed ivory refers to ivory cultural relics excavated from the ground, which may originate from ancient tombs, sites or other archaeological excavation locations. Due to long-term burial, unearthed ivory usually suffers varying degrees of damage, such as dehydration, cracks, deformation, corrosion, etc. After the unearthed ivory is reinforced and repaired, it will ultimately be provided to the museum and become an important exhibit for the public to understand the ancient Shu civilization through ancient ivory. Therefore, the protection of unearthed ivory has important historical and archaeological value for understanding ancient culture, art and craftsmanship.
[0062] In a specific embodiment of the present application, the method further includes treating bone cultural relics with a calcifying solution.
[0063] The calcifying solution refers to a liquid solution used to induce or promote the calcification process, and its main components include calcium ions, phosphates or other chemical substances that can promote the deposition of calcium salts.
[0064] In a specific embodiment of the present application, the ratio of the concentration of Sporosarcina pasteurii SAR1-02 to the concentration of the calcifying solution is 2.5×10 9 ~7.5×10 9 cfu / mL: 1mol / L. For example, the concentration of Sporosarcina pasteurii used can be 2.5×10 9 cfu / mL: 1mol / L, 3.0×10 9 cfu / mL: 1mol / L, 3.5×10 9 cfu / mL: 1mol / L, 4.0×10 9 cfu / mL: 1mol / L, 4.5×10 9 cfu / mL: 1mol / L, 5.0×10 9 cfu / mL: 1mol / L, 5.5×10 9 cfu / mL: 1mol / L, 6.0×10 9 cfu / mL: 1mol / L, 6.5×10 9 cfu / mL: 1mol / L, 7.0×10 9 cfu / mL: 1mol / L, 7.5×10 9 cfu / mL: 1mol / L; in the present application, through the research and discovery of the structure and pores of unearthed ivory, when the immersion method of the present application and the concentration of a specific Sporosarcina pasteurii are treated to match the concentration of a specific calcifying solution, it has a better reinforcement effect on unearthed ivory.
[0065] In a specific embodiment of the present application, the calcifying solution includes calcium salts and urea, wherein the calcium salts can be selected from one or more of calcium chloride, calcium nitrate and calcium acetate.
[0066] Furthermore, the molar ratio of the calcium salt to urea is 1:1 to 3, for example, it can be 1:1, 1:2; 1:3.
[0067] In a preferred embodiment of the present application, the concentration ratio of Sporosarcina pasteurii SAR1-02 to the calcifying solution is 3.7×10 9 ~5.0×10 9 cfu / mL: 1 mol.
[0068] In a specific embodiment of the present application, the Sporosarcina pasteurii is a Sporosarcina pasteurii bacterial solution.
[0069] In a specific embodiment of the present application, the bacterial solution can be obtained by inoculating pure Sporosarcina pasteurii strains into a culture medium for cultivation.
[0070] In a specific embodiment of the present application, the formula of the culture medium is peptone 5-10 g / L, beef extract 3-8 g / L, urea 10-20 g / L. For example, peptone can be 5 g / L, 6 g / L, 7 g / L, 8 g / L, 9 g / L, 10 g / L; beef extract can be 3 g / L, 4 g / L, 5 g / L, 6 g / L, 7 g / L, 8 g / L; urea can be 10 g / L, 11 g / L, 12 g / L, 13 g / L, 14 g / L, 15 g / L, 16 g / L, 17 g / L, 18 g / L, 19 g / L, 20 g / L.
[0071] In a specific embodiment of the present application, the cultivation temperature is 25-37 °C, for example, it can be 25 °C, 26 °C, 27 °C, 28 °C, 29 °C, 30 °C, 31 °C, 32 °C, 33 °C, 34 °C, 35 °C, 36 °C, 37 °C.
[0072] In a specific embodiment of the present application, the cultivation time is 24-48 h, for example, it can be 24 h, 26 h, 28 h, 30 h, 32 h, 34 h, 36 h, 38 h, 40 h, 42 h, 44 h, 46 h, 48 h.
[0073] In a specific embodiment of the present application, in the acquisition of the bacterial solution, it also includes the bacterial solution obtained by inoculating the strain into the culture medium for cultivation. The bacterial solution is separated to obtain a bacterial cell precipitate and a supernatant. The bacterial cell precipitate is mixed with different volumes of the supernatant to obtain a Sporosarcina pasteurii bacterial solution with a concentration of 2.5×10 9 ~7.5×10 9 cfu / mL.
[0074] In the specific embodiments of the present application, there is no limitation on the method for separating the bacterial cell precipitate and the supernatant, and it is only necessary to separate the bacterial cell precipitate and the supernatant. For example, centrifugation can be used to separate the bacterial cell precipitate and the supernatant.
[0075] There is no limitation on the centrifugation conditions, and it is only necessary to separate the bacterial cell precipitate and the supernatant. For example, the rotation speed of the centrifugation can be 10,000 - 14,000 rpm, specifically it can be 10,000 rpm, 11,000 rpm, 12,000 rpm, 13,000 rpm, 14,000 rpm, and the centrifugation time can be 10 - 15 min, specifically it can be 10 min, 11 min, 12 min, 13 min, 14 min, 15 min.
[0076] In the specific embodiments of the present application, the method for treating unearthed ivory with Sporosarcina pasteurii SAR1 - 02 and the calcifying solution is as follows: successively treat the unearthed ivory with the Sporosarcina pasteurii SAR1 - 02 bacterial solution and the calcifying solution, specifically, first treat the unearthed ivory with the Sporosarcina pasteurii SAR1 - 02 bacterial solution, and then treat the unearthed ivory with the calcifying solution.
[0077] In the specific embodiments of the present application, the method uses the immersion method, that is, the unearthed ivory is completely immersed in the Sporosarcina pasteurii SAR1 - 02 bacterial solution and the calcifying solution in sequence, so that the entire surface of the unearthed ivory can contact the Sporosarcina pasteurii SAR1 - 02 bacterial solution and the calcifying solution, and according to the concentration ratio of the bacterial solution and the calcifying solution in the present application, the efficiency of strengthening the unearthed ivory is improved.
[0078] In the specific embodiments of the present application, the steps of successively treating the unearthed ivory with the Sporosarcina pasteurii SAR1 - 02 bacterial solution and the calcifying solution are as follows: soak the unearthed ivory with the Sporosarcina pasteurii SAR1 - 02 bacterial solution, and perform the first placement after soaking; soak the unearthed ivory with the calcifying solution, and perform the second placement after soaking.
[0079] In the specific embodiments of the present application, the treatment of the unearthed ivory with the Sporosarcina pasteurii SAR1 - 02 bacterial solution and the calcifying solution in sequence is repeated more than 6 times, for example, it can be 6 times, 7 times, 8 times, 9 times, 10 times, more than 10 times.
[0080] In the specific embodiments of the present application, the soaking time for soaking the unearthed ivory with the Sporosarcina pasteurii SAR1 - 02 bacterial solution is 5 - 10 s, for example, it can be 5 s, 6 s, 7 s, 8 s, 9 s, 10 s. Under this condition, Sporosarcina pasteurii can enter the pores of the unearthed ivory while shortening the strengthening period.
[0081] In the specific embodiments of the present application, the soaking time of the unearthed ivory in the calcifying solution is 5 to 10 s. For example, it can be 5 s, 6 s, 7 s, 8 s, 9 s, 10 s. Under this condition, the calcifying solution can penetrate into the pores of the unearthed ivory while shortening the reinforcement period, and the calcium salts and urea therein react under the action of Sporosarcina pasteurii.
[0082] In the specific embodiments of the present application, the time of the first placement is the time required for the surface of the unearthed ivory to change from wet to dry. Specifically, it can be judged by touching the unearthed ivory with blotting paper and there is no change in the blotting paper. For example, the time can be greater than or equal to 1 h. For example, it can be 1 h, 2 h, 3 h, 4 h, 5 h, greater than 5 h.
[0083] In the specific embodiments of the present application, the time of the second placement is the time required for the mass of the unearthed ivory to remain constant. Specifically, it can be judged by weighing the unearthed ivory. For example, the time can be greater than or equal to 24 h. For example, it can be 24 h, 25 h, 26 h, 27 h, 28 h, 29 h, 30 h, greater than 30 h.
[0084] In the specific embodiments of the present application, the method further includes drying the unearthed ivory treated with Sporosarcina pasteurii SAR1-02 and the calcifying solution for 24 to 30 h after treatment. The time can be, for example, 24 h, 25 h, 26 h, 27 h, 28 h, 29 h, 30 h.
[0085] Through the method developed in the present application and the optimized conditions, for the reinforcement and repair of unearthed ivory with special pores and structures, the compressive strength of the unearthed ivory after reinforcement and repair reaches 30.9 Mpa, and the color difference of the cultural relics after reinforcement is only 2.23. All the micropores in the unearthed ivory are completely filled.
[0086] The present application is further illustrated below by examples, but the scope of the present application is not limited thereby. Unless otherwise specified, the experimental methods, detection methods, and preparation methods disclosed in the present invention all adopt the conventional molecular biology, biochemistry, chromatin structure and analysis, analytical chemistry, cell culture, recombinant DNA technology and related conventional technologies in the technical field. These technologies have been well described in the existing literature. Unless otherwise specified, the materials, instruments, reagents, etc. used in the examples can be obtained through conventional channels.
[0087] Example 1 Screening of Sporosarcina pasteurii and Detection of Enzyme Activity
[0088] In this Example 1, Sporosarcina pasteurii was screened and isolated. The steps are as follows:
[0089] 1.1. Primary Screening
[0090] Samples were taken from highly alkaline soil in the suburbs of Shanghai using a sterile sampling bag and stored at low temperature before screening in the laboratory. Selective screening was carried out by the increase in environmental pH during the metabolic process of urease-producing bacteria, which caused the phenol red solution to turn red.
[0091] Prepare the screening medium: yeast extract 3 g / L, NaCl 5 g / L, urea 15 g / L (added after sterilization), 0.2% phenol red solution 4 mL / L, agar 20 g / L. After autoclaving and disinfection, strain screening was carried out, and the strains with the surrounding medium turning red were selected for re-screening.
[0092] 1.2. Re-screening
[0093] The bacteria obtained from the primary screening in step 1.1 were inoculated into 100 mL of LB medium containing 30 g / L urea and cultured in a shaker flask at 30 °C and 200 rpm for 30 h, and its urease activity was determined by the conductivity method.
[0094] The detection method of urease activity is as follows:
[0095] A certain concentration of urea solution was added to the urease-producing microbial solution. Due to the hydrolysis of urea by urease-producing microorganisms per unit time, the concentration of conductive ions in the solution increased, resulting in an increase in the conductivity of the solution. And the amount of hydrolyzed urea is proportional to the increase in the conductivity of the solution. Therefore, the change in the conductivity of the solution can be used to characterize the ability of the microbial solution to hydrolyze urea per unit time (urease activity of the microbial solution).
[0096] The relationship between the amount of urea hydrolysis and the change in conductivity is:
[0097] Amount of urea hydrolysis (mM / min) = Change in conductivity value (mS / cm / min) × 11.11
[0098] Specifically, the method reported in the literature (Whiffin V S. Microbial CaCO3 precipitation for the production of bbiocemenet. Pertj, Australia: Murdoch University, 2004) was adopted, and the R2 of the standard curve was 0.9988.
[0099] The specific measurement method is as follows: Take 1 volume of the microbial solution and mix it with 9 volumes of 1.1 mol / L urea solution, measure the change in conductivity of the solution within 5 min with a conductivity meter, and multiply the average change in conductivity value measured within 5 min (unit: mS / cm / min) by the dilution factor (10 times), which is the initial enzyme activity of the microbial solution. This value reflects the ability of the microbial solution to hydrolyze urea. The enzyme activity is defined as: The amount of enzyme required to hydrolyze 1 mmol of urea solution per minute at room temperature is one enzyme activity unit U.
[0100] The results of the second-round screening are shown in Table 1:
[0101] Table 1 OD values and urease activities after culturing the strains with urease activity screened by the second-round screening
[0102]
[0103] Thus, a strain No. 6 with high urease activity was screened out. Its OD600 was 2.5 and its urease activity was 5.1 U / ml. For the previous Sporosarcina pasteurii strain Sarisp1 in the laboratory, its OD600 was 0.4 and its urease activity was 1.2 U / ml. The growth ability and urease activity of the newly screened strain were significantly enhanced compared with the existing strain.
[0104] Example 2 Strain identification
[0105] In this example, the bacterial liquid of the to-be-identified strain No. 6 after shake-flask culture was taken, and genomic DNA was extracted using an Ezup column-type bacterial DNA extraction kit.
[0106] Universal primers 27F and 1492R were used for amplification. The amplification product was subjected to 1.5% agarose gel electrophoresis. The electrophoresis results are shown in Figure 1 , and the length of the target band was 1500; the target band was recovered and sequenced on a sequencer. The 16S rDNA sequence obtained by sequencing was compared with the sequences of related species in the GenBank database. The results are shown in Figure 2 .
[0107] Primers: 27F: AGAGTTTGATCCTGGCTCAG (SEQ ID NO.1)
[0108] 1492R: GGTTACCTTGTTACGACTT (SEQ ID NO.2)
[0109] The sequence of 16S rDNA is as follows:
[0110]
[0111] The 16S rDNA was aligned in the National Center for Biotechnology Information (NCBI) database (https: / / blast.ncbi.nlm.nih.gov / Blast.cgi?PROGRAM=blastn&PAGE_TYPE=BlastSearch&LINK_LOC=blasthome). It was found that the 16S rDNA sequence had a homology of 97.53% with the bacterium Bacillus sp. VS1 in GenBank. At the same time, it had a homology of 95.62% with Sporosarcina pasteurii Sarisp1 (preservation number: CCTCC M 2024524, disclosed in the patent "A Sporosarcina pasteurii and Its Application", publication number CN118272270A, publication date July 2, 2024) previously screened in the laboratory.
[0112] Based on the comprehensive 16S rDNA identification results, this strain was identified as Sporosarcina pasteurii. The taxonomic name of this strain is Sporosarcina sp. strain SAR1-02, with a preservation number of CCTCC M 2025059. It was preserved in the China Center for Type Culture Collection on January 8, 2025, at the address: No. 299, Bayi Road, Wuchang District, Wuhan City, Hubei Province.
[0113] Example 3 Method for Microbially Induced Calcification to Strengthen Unearthed Ivory
[0114] 3.1 Cultivation of Sporosarcina pasteurii strain SAR1-02
[0115] The medium components for Sporosarcina pasteurii were 5 g / L peptone, 3 g / L beef extract, and 20 g / L urea, and the pH value was adjusted to 7. The strain of Sporosarcina pasteurii strain SAR1-02 was preserved in a glycerol tube at -80°C. Take the strain of Sporosarcina pasteurii strain SAR1-02. After thawing the glycerol tube at room temperature, take 150 μL of the bacterial solution and inoculate it into a test tube containing 3 mL of the medium. Incubate at 37°C and 180 rpm for 24 h. The activated bacterial solution was transferred into a 250 mL conical flask containing 100 mL of the medium and cultured at 37°C and 180 rpm for 24 h for scale-up cultivation. The scale-up cultivated Sporosarcina pasteurii was inoculated into 250 mL conical flasks containing 100 mL of the medium at an inoculation amount of 5% (v / v) and cultured at 37°C and 180 rpm for 24 h.
[0116] 3.2 Microbially Induced Calcification to Strengthen Unearthed Ivory
[0117] Use as Figure 3The shown calcification device has a main body consisting of two open 250 mL containers, which are respectively used to hold the reinforced bacterial liquid and the calcification liquid. The ivory is placed on a perforated tray and immersed in a solution in a beaker.
[0118] The specific steps are as follows:
[0119] 1) Concentrate the bacterial liquid of Sporosarcina pasteurii strain SAR1-02: Centrifuge the bacterial liquid of Sporosarcina pasteurii strain SAR1-02 at 10000 rpm for 10 min to separate the bacterial cells and the supernatant. Dissolve the centrifuged bacterial precipitate with the supernatant and adjust the concentration. The obtained bacterial liquid has an OD600 of 25 and a viable cell count of 2.5×10 9 CFU / mL.
[0120] 2) Take 221.96 g of calcium chloride and 120.12 g of urea, mix and dissolve them with distilled water, and make up the volume to 1000 mL with a volumetric flask to obtain a mixed solution of 2 mol / L CaCl2 and 2 mol / L urea, which is the 2.0 M calcification liquid, and obtain the 1.0 M calcification liquid by diluting with distilled water.
[0121] 3) Take 1 ivory sample and place the sample on a perforated tray with a bracket.
[0122] 4) Immerse the tray into a beaker containing the concentrated Sporosarcina pasteurii bacterial liquid, take it out after 5 s, and let it stand at room temperature for 1 h;
[0123] 5) Immerse the tray into a beaker containing the calcification liquid, take it out after 5 s, and let it stand at room temperature for 23 h (at this time, the weight of the sample no longer changes);
[0124] 4) Continue to repeat steps 4) and 5) 6 times;
[0125] 5) Place the ivory sample after induced calcification fixation in a blast drying oven and dry it for 24 h for analysis and testing.
[0126] Example 4 Method for Microbially Induced Calcification to Reinforce Unearthed Ivory
[0127] In this example, the conditions in the method are changed as follows:
[0128] 1) Concentrate the bacterial liquid of Sporosarcina pasteurii strain SAR1-02: Centrifuge the bacterial liquid of Sporosarcina pasteurii strain SAR1-02 at 10000 rpm for 10 min to separate the bacterial cells and the supernatant. Dissolve the centrifuged bacterial precipitate with the supernatant and adjust the concentration. The obtained bacterial liquid has an OD600 of 25 and a viable cell count of 2.5×10 9 CFU / mL.
[0129] 2) Take 166.47 g of calcium chloride and 90.09 g of urea, dissolve them with distilled water, and make up the volume to 1000 mL with a volumetric flask to obtain a mixed solution of 1.5 mol / L CaCl₂ and 1.5 mol / L urea, which is 1.5 M calcifying solution.
[0130] 3) Take 1 piece of ivory sample and place the sample on a perforated tray with a bracket.
[0131] 4) Immerse the tray into a beaker containing the bacterium Sporosarcina pasteurii solution, take it out after 10 s, and let it stand at room temperature for 3 h.
[0132] 5) Immerse the tray into a beaker containing the calcifying solution, take it out after 10 s, and let it stand at room temperature for 30 h (at this time, the weight of the sample no longer changes).
[0133] 4) Continue to repeat steps 4) and 5) 8 times.
[0134] 5) Place the ivory sample after induced calcification fixation in a blast drying oven and dry it for 30 h for analysis and testing.
[0135] Example 5 Optimization of the concentration of calcium concentrate
[0136] 5.1 Preparation of reinforcement bacterium solution and calcifying solution with different concentrations
[0137] Calcifying solution: Take 221.96 g of calcium chloride and 120.12 g of urea, dissolve them with distilled water, and make up the volume to 1000 mL with a volumetric flask to obtain a mixed solution of 2 mol / L CaCl₂ and 2 mol / L urea, which is 2.0 M calcifying solution. And 0.5 M and 1.0 M calcifying solutions are obtained by diluting with distilled water.
[0138] The preparation of the bacterium solution is the same as that in Example 3, where OD₆₀₀ is 25, and the remaining steps are the same as those in Example 3.
[0139] 5.2 Mechanical property detection
[0140] Use a texture analyzer RAPID TA+ to detect the strength of the ivory sample before and after reinforcement. Place the material to be tested on a horizontal plane, and the probe of the texture analyzer is perpendicular to the horizontal plane and slowly presses down on the calcified layer after reinforcement until the material is fractured. At this time, the count of the texture analyzer is the maximum pressure that the material can withstand, and the compressive strength of the sample is calculated through the contact surface between the probe and the sample.
[0141] As Figure 7As shown in Table 2, the strength of the Jinsha ivory samples after being induced and calcified and strengthened with calcifying solutions of different concentrations is higher than that of the initial ivory samples. As the concentration of the calcifying solution gradually increases, the maximum pressure and compressive strength that the strengthened ivory samples can withstand show a trend of increasing first and then decreasing. Compared with other concentrations, when the ivory samples are strengthened with a 1.0 M calcifying solution, the maximum pressure and compressive strength of the samples reach the maximum values of 4.6 kgf and 14.8 MPa respectively.
[0142] Table 2 Influence of Calcifying Solutions with Different Concentrations on the Strengthening Effect
[0143]
[0144] Example 6 Optimization of the Bacterial Liquid Concentration of Sporosarcina pasteurii Strain SAR1-02
[0145] In this example, the bacterial liquid of Sporosarcina pasteurii strain SAR1-02 screened in Example 1 was used to conduct an experiment on inducing calcium carbonate deposition and solidification with the optimal calcifying solution concentration (1 M) in Example 5. The details are as follows:
[0146] 6.1 Bacterial Liquids with Different Concentrations for Strengthening: The bacterial liquid of Sporosarcina pasteurii strain SAR1-02 was centrifuged at 10,000 rpm for 10 min to separate the bacterial cells and the supernatant. The centrifuged bacterial precipitate was dissolved with the supernatant and the concentration was adjusted to obtain 5 bacterial liquids with different concentrations. The concentrations of the bacterial liquids were 2.5×10 9 cfu / mL, 3.7 cfu / mL, 5.0 cfu / mL, 6.7 cfu / mL, 7.5×10 9 cfu / mL, and the corresponding OD600 values were 25, 37.5, 50, 62.5, and 75 respectively.
[0147] The remaining steps were the same as those in Example 3.
[0148] 6.2 Mechanical Property Detection
[0149] Same as the "Mechanical Property Detection" in Example 5.
[0150] As Figure 8 shown in Table 3, the strength of the Jinsha ivory samples after being induced and calcified and strengthened with bacterial liquids of different concentrations is higher than that of the initial ivory samples. As the concentration of the bacterial liquid gradually increases, the maximum pressure and compressive strength that the strengthened ivory samples can withstand show a trend of increasing first and then decreasing. Compared with other concentrations, when the OD600 of the strengthening bacterial liquid is 50, the maximum pressure and compressive strength of the samples reach the maximum values of 9.7 kgf and 30.9 MPa respectively.
[0151] Table 3 Influence of Bacterial Liquids with Different Concentrations on the Strengthening Effect
[0152]
[0153]
[0154] Example 7 Evaluation of the Reinforcement Effect after Microbially Induced Calcification of Unearthed Ivory Submerged in a Certain Way
[0155] In this example, the reinforcement effect of unearthed ivory samples reinforced with a bacterial solution concentration (OD600 of 50) was evaluated, including the following:
[0156] 3.1 Color Difference Detection
[0157] By detecting the Lab values of a color difference meter, the L*, a*, and b* values of the unearthed ivory samples before and after reinforcement were measured. The differences △L, △a, and △b of the three values of the samples before and after reinforcement were calculated.
[0158] Color difference △E = [(△L*)^2 + (△a*)^2 + (△b*)^2]^0.5.
[0159] By calculation using the formula, the color difference △E of the ivory samples before and after reinforcement was 2.23, meeting the requirement that the color difference of cultural relics before and after reinforcement should be less than 3, indicating that the appearance of ivory cultural relics will not be significantly changed after microbially induced calcification reinforcement.
[0160] 3.2 Scanning Electron Microscope Detection
[0161] A scanning electron microscope (Zeiss Gemini 300, Germany) was used to observe the surface and internal pores of the ivory samples before and after treatment. Before the SEM test, the samples were vacuum dried at a constant temperature of 50 °C for more than 48 hours and sputter-coated with platinum to improve the conductivity of the samples.
[0162] The surface structure of the ivory sample before reinforcement was as shown in Figure 4 and Figure 5 , the surface of the unearthed ivory was covered with micropores and cracks, while the surface of the ivory sample after reinforcement was as shown in Figure 6 , and the reinforcing bacteria entered the pores on the ivory surface and produced calcium carbonate to fill the micropores.
[0163] The above examples only illustratively explain the principles and effects of this application, rather than limiting this application. Any person familiar with this technology can modify or change the above examples without departing from the spirit and scope of this application. Therefore, all equivalent modifications or changes completed by those with ordinary knowledge in the technical field without departing from the spirit and technical ideas disclosed in this application should still be covered by the claims of this application.
Claims
1. A Sporosarcina sp., whose deposit number is CCTCC M 2025059.
2. The Sporosarcina sp. according to claim 1, characterized in that, The 16S rDNA sequence of Sporosarcina sp. comprises the sequence shown in SEQ ID No.
3.
3. The Sporosarcina sp. according to claim 1, characterized in that, The urease activity of the Sporosarcina sp. is greater than 3.0 U / ml. A bacterial agent comprising the Sporosarcina pasteuriana sp. according to any one of claims 1 to 3.
5. Use of the Sporosarcina sp. according to any one of claims 1 to 3 or the bacterial agent according to claim 4 in inducing calcium carbonate deposition and solidification, and / or strengthening bone cultural relics, and / or repairing bone cultural relics.
6. The use according to claim 5, characterized in that, The bone artifacts mentioned are unearthed ivory.
7. A method for reinforcing or repairing bone artifacts, comprising treating the bone artifacts with the Sporosarcina sp. according to any one of claims 1 to 3 or the bacterial agent according to claim 4.
8. The method according to claim 7, characterized in that, The method further includes treating the bone artifact with a calcifying solution; Preferably, the ratio of the concentration of Sporosarcina sp. to the concentration of the calcifying solution is 2.5×10 9 ~7.5×10 9 cfu / mL: 1 mol / L; And / or, the bone artifact is unearthed ivory.
9. The method according to claim 8, characterized in that The calcification solution includes calcium salt and urea, and the molar ratio of the calcium salt to the urea is 1:1-3; Preferably, the calcium salt is selected from one or more of calcium chloride, calcium nitrate and calcium acetate.
10. The method according to claim 9, wherein The method comprises the following steps: soaking the unearthed ivory in a Sporosarcina sp. bacterial solution, placing the ivory for the first time after soaking, soaking the unearthed ivory in a calcification solution, placing the ivory for the second time after soaking, and repeating the above steps for more than 6 times.
Citation Information
Patent Citations
Sporosarcina pasteurii and application thereof
CN118272270A
Cited By
Pseudomonas syringae and application thereof in repairing bone cultural relics
CN121379876A
Pseudomonas syringae and application thereof in repairing bone relics
CN121379876B
Microbial composite microbial inoculant and application thereof in cultural relic reinforcement and restoration
CN122686471A