Sequence of larch strong promoter MarEF1-1 and application thereof

Abstract

The invention discloses a larch strong promoter MarEF1-1 nucleotide sequence and a method for constructing a plant expression vector which is suitable for efficiently working in gymnosperm such as larch by using the promoter sequence. The invention further discloses a method for creating and cultivating transgenic larch and other nude woody plants with directionally improved target agronomic traits by using the constructed expression vector with the larch strong promoter MarEF1-1. The implementation effect shows that compared with the known conventional plant expression vector, the expression vector with the larch starting MarEF1-1 nucleotide sequence is used as a skeleton, a target gene is inserted to construct a recombinant expression vector, genetic transformation is performed on larch, and the expression level of the target gene in an obtained positive transformation strain is 5-10 times that of the conventional expression vector. The nucleotide sequence of the larch strong promoter MarEF1-1 and the application of the larch strong promoter MarEF1-1 disclosed by the invention have important value in efficient and low-cost cultivation of new germplasm, new materials and varieties of nude woody plants such as fast-growing, stress-resistant and high-quality transgenic larch.

Description

Technical Field

[0001] The present invention relates to a larch promoter sequence in the field of plant genetic engineering and its application in cultivating transgenic gymnosperms such as larch by adopting biological breeding methods. Background Art

[0002] Larix gmelinii is a tree of the genus Larix in the Pinaceae family, including various species such as Larix gmelinii, Larix kaempferi, Larix kaempferi, and Larix principis-rupprechtii. It boasts a well-developed root system, strong adaptability to cold and drought conditions, rapid forest growth, and few pests and diseases, among other advantages that distinguish it from other broadleaf and coniferous trees. Therefore, larch is an important ecological afforestation species and is widely distributed in Northeast, North China, and Southwest my country. Furthermore, larch has excellent wood properties, good wood hardness, high compressive and flexural strength, and resistance to decay, making it an important pulpwood and construction timber species. Furthermore, larch can be used as a raw material to produce natural active ingredients such as arabinogalactan and dihydroquercetin, resulting in significant applications in the food and pharmaceutical sectors. However, compared to broadleaf trees such as poplar, larch grows slowly, has a long growth cycle, and requires a long breeding cycle. High-quality, fast-growing larch varieties are in short supply. Currently, most conventional larch species require at least 15 years from planting to maturity. Despite their significant economic value in ecological protection, high-quality timber supply, and the production of bioactive products, slow breeding progress and the lack of fast-growing, high-quality varieties have been the primary bottleneck hindering the realization of their ecological and economic value.

[0003] For a long time, cross-breeding has been the main means to obtain excellent larch strains. However, the long growth cycle, large genome, and complex genetic background have greatly restricted the breeding of excellent larch strains. With the development of modern biotechnology, especially the emergence of new gene operation strategies such as gene editing and polygenic convergent expression in recent years, and their successful application in the creation of high-yield and high-quality new germplasms and new materials in crops such as rice and woody plants such as poplar, it has laid a solid foundation and provided a new direction for creating and cultivating new larch germplasms and new strains with fast growth, high stress resistance, and excellent wood properties by means of genetic engineering. Currently, modern biological breeding methods have become an important means for precisely and efficiently creating fast-growing and high-quality new germplasms, new materials, and new varieties of woody plants such as larch with long growth cycles and scarce improved varieties. It can greatly shorten the breeding cycle and provide a germplasm source guarantee for the iterative improvement of improved varieties of woody plants such as larch and give full play to their value in ecological protection and economic production. In the process of creating new germplasms and new materials of crops with agronomic traits directionally improved by using biological breeding methods such as transgenic, gene editing, and polygenic convergent expression, whether the promoter element on the expression vector can efficiently initiate the expression of the target gene or functional components such as Cas and gRNA is a decisive event determining whether the trait can be efficiently improved. Currently, the strong promoters in commonly used plant expression vectors are mainly the 35S promoter and the U6, U29, ubi promoters derived from Arabidopsis thaliana, rice, etc. These promoters generally have strong promoter activity in herbaceous plants such as rice, corn, and rapeseed. However, a large number of studies have shown that due to the huge genetic differences between woody plants, especially gymnosperm woody plants represented by larch, and angiosperms such as rice, the promoters that can efficiently initiate the expression of the target gene in these angiosperms generally have low promoter efficiency in gymnosperms, resulting in it being difficult to achieve the efficient expression of the target gene in gymnosperms by directly using promoters derived from angiosperms. Therefore, identifying and cloning strong promoters that can be used for the construction of expression vectors in gymnosperms and applying them to biological breeding have important application values for efficiently creating new larch and other gymnosperm woody plant germplasms and new strains with agronomic traits directionally improved, and are of great significance for breaking through the technical bottleneck of biological breeding of larch and other gymnosperm woody plants. Summary of the Invention

[0004] The object of the present invention is to provide a larch strong promoter sequence, and provide a method and application for using this promoter sequence to construct an efficient expression vector for gymnosperms such as larch, and then obtaining transgenic new germplasms and new strains of gymnosperms such as larch with fast growth, stress resistance, and high quality through genetic engineering means.

[0005] To achieve the above object, the present invention discloses the following technical solutions: A nucleotide sequence of the strong promoter LarEF1-1 of Larix gmelinii, characterized in that the gene sequence is as shown in SEQ ID NO.1.

[0006] The present invention further discloses a method for constructing a plant expression vector suitable for working efficiently in gymnosperms such as Larix gmelinii by using the above promoter sequence, which comprises the following steps: (1) Extraction of genomic DNA of Larix gmelinii: The seeds of Larix gmelinii harvested in the current year were purchased from the seed orchard of the National Larix gmelinii Improved Variety Forest Farm in Qingyuan County, Fushun City, Liaoning Province. After the seeds were treated at -20°C in a refrigerator for 3 days, they were soaked in warm water at 40°C for 8 h, sown in moist river sand, and after 25 days, the above-ground parts of the seedlings were collected, quickly freeze-dried with liquid nitrogen, ground into powder in a mortar, 0.5 g of the powder was transferred to a 1.5 ml centrifuge tube, 600 μL of a lysis solution containing 3% CTAB, 5% PVP, 0.5 Vc, 4% β-mercaptoethanol, 1.4 mol / L NaCl, and 200 mmol / L Tris-HCl (pH 8.0) was added, and the mixture was incubated in a water bath at 60°C for 30 min, during which it was inverted and mixed 5-6 times; an equal volume of Tris-saturated phenol:chloroform (1:1) was added and mixed vigorously by inversion for 3-5 min, and centrifuged at 10000 rpm for 10 min; the supernatant was aspirated, an equal volume of chloroform was added, gently inverted and mixed for 2-3 min, and centrifuged at 10000 rpm for 10 min; the supernatant was aspirated, 3 volumes of pre-cooled absolute ethanol were added, gently shaken, and left to stand at -20°C for 2 h; centrifuged at 12000 rpm for 10 min, the absolute ethanol was discarded, and the DNA precipitate was collected; the precipitate was air-dried at room temperature, and 100 μL of sterile water was added to dissolve the DNA, obtaining an aqueous DNA solution that can be used as a template for PCR amplification.

[0007] (2) Design and synthesis of primers for amplifying the larch promoter sequence with restriction enzyme sites LarEF1-1-Superpro-F: 5’ GAATTC TAGGGTTTGAATAAACAGGTCTTGG 3’ (the underlined part indicates the EcoR I restriction enzyme site) (SEQ ID NO: 2); LarEF1-1-Superpro-R: 5’ CCATGG ATGAGTGAAACGACAGAGAAACC3’ (the underlined part indicates the Nco I restriction enzyme site) (SEQ ID NO: 3).

[0008] The primer sequences were synthesized by Genewiz (Suzhou) Co., Ltd. The restriction enzyme sites can be flexibly selected according to different well-known plant expression vectors.

[0009] (3)Preparation of Larix promoter LarEF1-1 fragment with restriction enzyme sticky ends Using the Larix DNA prepared in step (1) above as a template and the sequence with restriction enzyme sites designed and synthesized in step (2) as primers, PCR amplification was performed to obtain a promoter sequence with EcoR I and Nco I restriction enzyme site sequences; the amplified product was ligated into a TA cloning vector, single colonies were picked, expanded culture was carried out, plasmids were extracted, and EcoR I and Nco I enzymes were used for digestion, the digested products were subjected to agarose gel electrophoresis, and the gel recovery method was used to recover the Larix promoter sequence with EcoR I and Nco I restriction enzyme sticky ends ( Figure 1 ).

[0010] (4)Preparation of linearized expression vector with restriction enzyme sticky ends The well-known common plant expression vectors pCAMBIA3301, pBI121 or pCAMBIA1300 were subjected to EcoR I and Nco I double digestion to excise the 35S promoter from Cauliflower mosaic virus (CaMV) on the original vector and linearize the vector. The linearized vector was separated using low-concentration (0.8%) agarose gel, and the linearized vector was recovered by the gel recovery method.

[0011] (5)Construction of expression vector with Larix strong promoter LarEF1-1 nucleotide sequence The expression vector excised from the CaMV 35S promoter and with EcoR I and Nco I restriction enzyme sticky ends was ligated to the Larix promoter sequence also with EcoR I and Nco I restriction enzyme sticky ends: The ligation system is as follows: 5 μL of linearized vector about 2 μg, with EcoR I and Nco3.5 μL of the larch promoter sequence fragment with I enzyme digestion sticky ends, 1 μL of 10× ligation buffer, and 0.5 μL of ligase were placed in a 0.2 mL centrifuge tube, shaken and mixed evenly, and ligated at a constant temperature of 16°C for 16 h. The ligation product was transferred into Escherichia coli DH5α competent cells by heat shock method, and cultured overnight at 37°C on an LB plate containing 150 mg / L Kan to screen for positive clones containing the ligation product; positive monoclonal clones were extracted and amplified in an LB liquid medium containing 150 mg / L Kan, and the recombinant plasmid was extracted using a plasmid extraction kit to obtain a universal backbone expression vector suitable for genetic transformation of gymnosperm woody plants such as larch, which carried the nucleotide sequence of the larch strong promoter LarEF1-1 after modification.

[0012] The present invention further discloses a method for creating and cultivating transgenic larch with target agronomic traits directionally improved by using the above-mentioned expression vector carrying the nucleotide sequence of the larch promoter LarEF1-1, which includes the following steps: (1) Construction of a recombinant expression vector for expressing a target gene by the larch promoter LarEF1-1 and preparation of an infection solution The target gene for improving important agronomic traits such as fast growth, stress resistance, and high quality, or the GUS reporter gene for evaluating the working efficiency of the modified expression vector, was ligated into the above-mentioned universal backbone expression vector carrying the larch promoter sequence constructed by modifying a conventional plant expression vector through methods such as enzyme digestion and ligation to obtain a recombinant expression vector for expressing the target gene or the GUS reporter gene by the larch promoter LarEF1-1, and the receptor of gymnosperm woody plants such as larch was genetically transformed. The specific process is as follows: The target gene for improving important agronomic traits such as fast growth, stress resistance, and high quality, or the GUS reporter gene, was obtained by PCR amplification or direct DNA sequence synthesis, and the above target gene was transferred into the backbone expression vector carrying the nucleotide sequence of the larch promoter LarEF1-1 disclosed in the present invention by enzyme digestion ligation or seamless cloning method to obtain a recombinant expression vector for expressing the target gene by the larch promoter; the recombinant expression vector was transferred into EHA105 Agrobacterium competent cells by the liquid nitrogen freeze-thaw method, and the transformed Agrobacterium was spread on an LB plate containing 100 mg / L rifampicin and 200 mg / L kanamycin, and cultured inverted at 28°C for 3 d. White clones were picked and inoculated into 100 mL of liquid LB medium containing 100 mg / L rifampicin and 200 mg / L kanamycin, and cultured with shaking at 28°C for 24 h. The cells were collected by centrifugation at 5000 rpm for 10 min, and the cells were resuspended with 1 mL of 1 / 2 MS liquid medium. An appropriate amount of the resuspended cells was added to 100 mL of 1 / 2 MS liquid medium and mixed evenly. The OD of the bacterial solution 600Adjust to 0.5 - 0.7, add 100 μM / L of acetosyringone and 0.02% of sliwet-l 77 to the above bacterial solution to obtain an Agrobacterium infection solution with a recombinant expression vector for genetic transformation.

[0013] (2)Preparation of Larix genetic transformation receptor materials Larix seeds are planted in sterilized river sand, and the culture temperature is between 22°C and 24°C. When the Larix seedlings grow to 3 - 5 cm in height after about 21 days, cut off the hypocotyls of the seedlings, wash them with 75% alcohol for 3 min in a laminar flow bench, wash three times with distilled water, 1 min each time; then wash with 1% mercuric chloride for 5 min and wash three times with distilled water, 1 min each time. Cut the hypocotyls into small segments about 8 - 10 mm long, spread them flat on the MS solid medium and pre-culture for 2 days as stable transformation materials ( Figure 2 a).

[0014] (3)Infection and co-culture Place the above pre-cultured Larix hypocotyl segments into the Agrobacterium infection solution with a recombinant expression vector, infect for 5 min, filter dry the infection solution, and spread them evenly on the solid medium of 1 / 2 DCR + 100 μM / L acetosyringone for co-culture for 3 days.

[0015] (4)Bacteria elimination culture Wash the co-cultured Larix hypocotyl segments with sterile water containing a low concentration of ticarcillin for 2 min, and repeat the washing process 5 - 7 times. Filter dry the surface moisture and spread them flat on the solid medium of 1 / 2 DCR + 4 mg / L 6-BA + 0.2 mg / L NAA + 600 μL / L ticarcillin for bacteria elimination culture for 7 days ( Figure 2 b); (5)Differentiation culture Transfer the bacteria-eliminated hypocotyls to the differentiation medium (1 / 2 DCR + 4 mg / L 6-BA + 0.2 mg / L NAA) for differentiation induction culture to generate adventitious buds ( Figure 2 c, d).

[0016] (6)Identification of positive transformed lines obtained by genetic transformation Cut off the well-developed adventitious buds growing from the Larix hypocotyl callus, transfer them to the DCR medium containing 0.1 mg / L 6-BA + 0.01 mg / L NAA + 1 g / L AC + 3 mg / L Basta for resistance screening culture. After about 20 days, only the positive transformed seedlings can grow normally ( Figure 2 d). After the positive transformed seedlings resistant to Basta take root, transfer them to nutrient soil to continue growing.

[0017] (7)Evaluation of the expression level of the target gene in transgenic materials For the transgenic positive larch materials with the GUS reporter gene transferred, which were obtained by basta resistance screening, the GUS staining method was used to evaluate the GUS activity in the transgenic materials. The results showed that high-level expression of GUS was obtained in the basta-resistant positive transformation materials ( Figure 3 ), proving that the strong larch promoter disclosed in the present invention can initiate the efficient expression of the target gene in larch transformation materials.

[0018] Extract the DNA of the positive transformed seedlings obtained by basta resistance screening, and use the combined primers designed according to the target gene sequence and vector sequence to perform PCR identification on the positive transformed strains; extract the RNA of the positive transformed seedlings obtained by basta resistance screening, and use the quantitative primers designed according to the target gene to perform qRT-PCR detection and analysis on the expression level of the target gene in the transformed strains. The expression level of the target gene in the transgenic lines is 5-10 times that of the transgenic lines obtained by genetic transformation using a well-known conventional plant expression vector as the backbone vector ( Figure 4 ). Compared with the control and transgenic larch obtained by genetic transformation of the target gene for improving specific agronomic traits into a well-known conventional plant expression vector, at the same growth stage, the transgenic larch obtained by driving the expression of the target gene with the strong larch promoter disclosed in the present invention as the core element has more significant advantages in improving the target agronomic traits ( Figure 5 ).

[0019] The beneficial effects of the present invention are as follows: It mainly solves the breeding technical bottleneck of the extremely scarce high-activity promoters necessary for constructing high-efficiency expression vectors in the biological breeding process of gymnosperm woody plants such as larch, and provides a core element for the creation / cultivation of fast-growing, stress-resistant, high-quality new germplasms, new materials and new varieties of gymnosperm woody plants such as larch.

[0020] The extraction solution used for extracting the larch genomic DNA described in the present invention refers to a mixed liquid containing 3% CTAB + 5% PVP + 0.5 Vc + 4% β-mercaptoethanol + 1.4 mol / L NaCl + 200 mmol / L Tris-HCl (pH 8.0). It should be prepared and used immediately and is not suitable for long-term storage.

[0021] The construction of the expression vector with the nucleotide sequence of larch promoter LarEF1-1 (SEQ ID NO: 1) as described in the present invention refers to the expression vector modified by replacing the promoter element sequence in the known conventional plant expression vectors including but not limited to pBI121, pBI221, pCAMBIA1300, pCAMBIA1301, pCAMBIA3301, pCAMBIA3300, etc. with the larch promoter LarEF1-1 sequence by means of enzymatic digestion and ligation.

[0022] The present invention also discloses the application of the expression vector with the nucleotide sequence of the strong larch promoter LarEF1-1 (SEQ ID NO: 1) in the molecular improvement of fast growth, stress resistance and high quality traits of gymnosperm woody plants such as larch. The research results show that using the expression vector with the nucleotide sequence of larch promoter LarEF1-1 described in the present invention as the backbone and inserting key regulatory genes related to fast growth, salt resistance, drought resistance, lignin synthesis, cellulose synthesis, etc., a recombinant expression vector of larch strong promoter LarEF1-1: target gene is constructed, and then larch is genetically transformed. The expression level of the target gene in the obtained positive transgenic lines is 5-10 times that of the conventional expression vector. This shows that the strong larch promoter sequence disclosed in the present invention plays an important role in creating new germplasms, new materials and varieties of transgenic larch with highly expressed target trait genes.

[0023] The positive effects of the method for creating new germplasms, new materials and varieties of fast-growing, stress-resistant and high-quality transgenic gymnosperm woody plants such as larch by using the nucleotide sequence of the strong larch promoter LarEF1-1 disclosed in the present invention and adopting biological breeding means compared with the prior art are as follows: (1) Simple operation: Only need to replace the promoter in the known conventional plant expression vector with the nucleotide sequence of the strong larch promoter LarEF1-1 disclosed in the present invention, and without changing other functional elements on the vector, a general-purpose high-efficiency expression vector for transgenic gymnosperm woody plants such as larch can be obtained; (2) Strong applicability and practicability: Using the backbone expression vector with the nucleotide sequence of the strong larch promoter LarEF1-1 disclosed in the present invention, any target gene can be ligated behind the promoter according to the conventional molecular biology operation methods, and then gymnosperm woody plants such as larch are genetically transformed to obtain transgenic materials with highly expressed target genes; (3) High efficiency: When using a well-known conventional plant expression vector to genetically transform larch, it is also possible to obtain positive transgenic lines. However, the target gene is generally not expressed or has a low expression level in the transgenic lines. In this case, even if transgenic materials carrying the target gene are obtained, the possibility of improving the target trait is not high. By using the expression vector carrying the nucleotide sequence of the larch strong promoter LarEF1-1 disclosed in the present invention to genetically transform larch, transgenic materials with high expression of the target gene can be obtained, significantly increasing the number of valuable breeding transgenic materials with significantly improved target traits. Especially for gymnosperm woody plants such as larch with extremely low genetic transformation efficiency, effectively improving the expression level of the target gene in the transformed lines is the most important strategy for efficiently obtaining valuable breeding transgenic materials with improved target traits under extremely low transformation efficiency conditions. Description of the Drawings

[0024] Figure 1 Electrophoresis detection results of the PCR amplification product of the larch promoter LarEF1-1 nucleotide sequence (M2000 indicates the 2000bp DNA molecular weight marker, and pro1-6 are the electrophoresis results of six independent PCR amplification products of LarEF1-1); Figure 2 (a, b, c, d) Schematic diagram of the genetic transformation of larch seedling hypocotyls and the regeneration of positive explants; where a shows the larch seedling hypocotyl segment; b shows the swelling and development of the hypocotyl segment in axenic culture; c and d show the formation of callus and explants from the genetically transformed larch hypocotyl segment; Figure 3 Expression analysis of the reporter gene GUS in the positive transformed lines obtained by genetically transforming larch with the expression vector carrying the larch promoter LarEF1-1; Figure 4 Schematic diagram of the expression level of the target gene LaAP2L1 driven by the larch promoter LarEF1-1 in larch transgenic materials; WT indicates untransformed larch seedlings; 35S-LaAP2L1-Lin1 and 35S-LaAP2L1-Lin2 indicate LaAP2L1 transgenic larch materials obtained by genetic transformation with a well-known conventional plant expression vector carrying the 35S promoter; LarEF1-1-LaAP2L1-Lin1, LarEF1-1-LaAP2L1-Lin6, and LarEF1-1-LaAP2L1-Lin10 indicate LaAP2L1 transgenic larch materials obtained by genetic transformation with the expression vector carrying the larch LarEF1-1 promoter disclosed in the present invention; Figure 5Schematic diagram of the fast-growing phenotype of transgenic larch created by expressing the target gene LaAP2L1 driven by the larch promoter LarEF1-1. (a, b, c) a shows the growth phenotype of transgenic larch obtained by genetic transformation after transferring LaAP2L1 into a conventional well-known plant expression vector; b and c show the growth phenotype of transgenic larch obtained by genetic transformation after transferring LaAP2L1 into an expression vector with the larch promoter LarEF1-1 as the core promoter element. Detailed implementation manners

[0025] The present invention will be further described in conjunction with the accompanying drawings of the specification and specific embodiments. These embodiments are only used to illustrate the present invention and not to limit the scope of the present invention. For the experimental methods without specific conditions noted in the following embodiments, they are usually carried out under conventional conditions such as those described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989) and Principles and Techniques of Plant Gene Manipulation edited by Li Minggang. All biochemical reagents, enzymes, vectors, and strains of the present invention can be purchased from various biological reagent companies, and the primer sequences are synthesized by Genewiz (Suzhou) Inc.

[0026] The sources of biochemical reagents and enzymes required for the present invention are shown in the following table: Examples

[0027]

[0028] A method for constructing a plant expression vector suitable for highly efficient work in gymnosperms such as larch using the above promoter sequence, which comprises the following steps: (1) Extraction of larch genomic DNA: Larch seeds harvested in the current year were purchased from the seed orchard of the National Larch Improved Variety Forest Farm in Qingyuan County, Fushun City, Liaoning Province. After the seeds were treated at -20 °C in a refrigerator for 3 days, they were soaked in warm water at 40 °C for 8 h, sown in moist river sand, and the above-ground parts of the seedlings were collected after 25 days. They were quickly freeze-dried with liquid nitrogen and ground into powder in a mortar. 0.5 g of the powder was transferred to a 1.5 ml centrifuge tube, and 600 μL of a lysis solution containing 3% CTAB, 5% PVP, 0.5 Vc, 4% β-mercaptoethanol, 1.4 mol / L NaCl, and 200 mmol / L Tris-HCl (pH 8.0) was added. It was incubated in a water bath at 60 °C for 30 min, during which it was inverted and mixed 5-6 times; an equal volume of Tris-saturated phenol:chloroform (1:1) was added and mixed vigorously by inversion for 3-5 min, and then centrifuged at 10,000 rpm for 10 min; the supernatant was aspirated, an equal volume of chloroform was added, and it was gently inverted and mixed for 2-3 min, and then centrifuged at 10,000 rpm for 10 min; the supernatant was aspirated, 3 volumes of pre-cooled absolute ethanol were added, and it was gently shaken and left to stand at -20 °C for 2 h; it was centrifuged at 12,000 rpm for 10 min, the absolute ethanol was discarded, and the DNA precipitate was collected; the precipitate was air-dried at room temperature, and 100 μL of sterile water was added to dissolve the DNA, obtaining an aqueous DNA solution that could be used as a template for PCR amplification.

[0029] (2) Design and synthesis of amplification primers for the larch promoter sequence with restriction enzyme sites LarEF1-1-Superpro-F: 5’ GAATTC TAGGGTTTGAATAAACAGGTCTTGG 3’ (the underlined part indicates the EcoR I restriction enzyme site) (SEQ ID NO: 2); LarEF1-1-Superpro-R: 5’ CCATGG ATGAGTGAAACGACAGAGAAACC 3’ (the underlined part indicates the Nco I restriction enzyme site) (SEQ ID NO: 3).

[0030] The primer sequences were synthesized by GenScript Biotech Corporation. The restriction enzyme sites can be flexibly selected according to different known plant expression vectors.

[0031] (3) Preparation of the larch promoter LarEF1-1 fragment with sticky ends for restriction enzyme digestion Using the larch DNA prepared in the above step (1) as a template and the sequence with restriction enzyme sites designed and synthesized in step (2) as primers, PCR amplification is carried out to obtain a promoter sequence with EcoR I and Nco I restriction enzyme site sequences; the amplification product is ligated into a TA cloning vector, single colonies are picked, expanded in culture, plasmids are extracted, and EcoR I and Nco I enzymes are used for digestion. The 25 μL digestion system contains 3 μg (9 μL) of plasmid, 2.5 μL of 10×T buffer, Nco I (50 U / μL) 1.0 μL, EcoR I (100 U / μL) 1.0 μL, 1.5 μL of sterile water, shaken and mixed evenly, and incubated at a constant temperature of 16 °C for 16 h. Agarose gel electrophoresis is carried out on the digestion product, and the larch promoter sequence with EcoR I and Nco I digested sticky ends is recovered by the gel extraction method ( Figure 1 ).

[0032] (4) Preparation of a linearized expression vector with digested sticky ends The well-known common plant expression vectors pCAMBIA3301, pBI121 or pCAMBIA1300 are EcoR I and Nco I double digested to excise the 35S promoter from the cauliflower mosaic virus (CaMV) on the original vector and linearize the vector. The linearized vector is separated using a low-concentration (0.8%) agarose gel, and the linearized vector is recovered by the gel extraction method.

[0033] (5) Construction of an expression vector with the nucleotide sequence of the strong larch promoter LarEF1-1 The above-mentioned expression vector that has excised its own CaMV 35S promoter and has EcoR I and Nco I digested sticky ends is ligated to the larch promoter sequence that also has EcoR I and Nco I digested sticky ends: The ligation system is as follows: 5 μL of the linearized vector about 2 μg, with EcoR I and Nco3.5 μL of the larch promoter sequence fragment with I digestion sticky ends, 1 μL of 10× ligation buffer, and 0.5 μL of ligase were placed in a 0.2 mL centrifuge tube, shaken and mixed evenly, and ligated at a constant temperature of 16 °C for 16 h. The ligation product was transferred into Escherichia coli DH5α competent cells by heat shock method, and cultured overnight at 37 °C on an LB plate containing 150 mg / L Kan to screen positive clones containing the ligation product; positive monoclonal colonies were extracted and amplified in an LB liquid medium containing 150 mg / L Kan, and the recombinant plasmid was extracted using a plasmid extraction kit to obtain a universal backbone expression vector suitable for genetic transformation of larch and other gymnosperm woody plants with the larch promoter sequence after modification.

[0034] Furthermore, using the above expression vector with the larch promoter LarEF1-1 nucleotide sequence, a method for creating and cultivating fast-growing and high-biomass transgenic larch by overexpressing LaAP2L1 (for detailed information on the LaAP2L1 gene, refer to Li A1 et al. LaAP2L1, a heterosis-associated AP2 / EREBP transcript factor of Larix, increases organ size and final biomass by effecting cell proliferation in Arabidopsis. Plant and Cell Physiology. 2013, 54(11): 1822–1836. Accession number in the NCBI database: JN851868), which includes the following steps: (1) Construction of a recombinant expression vector for expressing the target gene LaAP2L1 driven by the larch promoter LarEF1-1 and preparation of an infection solution The target gene LaAP2L1 for improving fast-growing agronomic traits was ligated into the above universal backbone expression vector with the larch promoter LarEF1-1 nucleotide sequence constructed after modification of the conventional plant expression vector by methods such as digestion and ligation to obtain a recombinant expression vector for expressing the target gene LaAP2L1 driven by the larch promoter, and used for genetic transformation of larch and other gymnosperm woody plant receptors. The specific process is as follows: Obtained by PCR amplification or direct DNA sequence synthesis with Nco I and Bst EThe LaAP2L11 coding sequence with the double restriction enzyme cleavage site was transferred into the backbone expression vector with the nucleotide sequence of the larch promoter LarEF1-1 disclosed in the present invention by enzyme cleavage and ligation to obtain a recombinant expression vector expressing LaAP2L11 driven by the larch promoter. The ligation system was as follows: 5 μL of the linearized backbone expression vector with the larch promoter sequence (about 2 μg), the backbone expression vector with the Nco I and Bst E 3.5 μL of the LaAP2L11 coding sequence fragment with sticky ends cut by enzyme II, 1 μL of 10× ligation buffer, and 0.5 μL of ligase were placed in a 0.2 mL centrifuge tube, shaken to mix, and ligated at a constant temperature of 16°C for 16 h. The ligation product was transformed into Escherichia coli DH5α competent cells using the heat shock method and cultured overnight at 37°C on LB plates containing 150 mg / L Kan. Positive clones containing the ligation product were screened. Positive single clones were extracted and expanded in LB liquid medium containing 150 mg / L Kan. The recombinant plasmid was extracted using a plasmid extraction kit to obtain a recombinant expression vector expressing LaAP2L1 driven by the larch promoter. The recombinant expression vector was transformed into EHA105 competent Agrobacterium by the liquid nitrogen freeze-thaw method. The transformed Agrobacterium was spread on LB plates containing 100 mg / L rifampicin and 200 mg / L kanamycin and cultured inverted at 28°C for 3 days. White colonies were picked and inoculated into 100 mL of liquid LB medium containing 100 mg / L rifampicin and 200 mg / L kanamycin, cultured at 28°C with shaking for 24 h, and then inoculated with 5000 μg of 4% HCl. Centrifuge at rpm for 10 min to collect the bacteria, resuspend the bacteria in 1 mL 1 / 2MS liquid culture medium, take an appropriate amount of the resuspended bacteria and add it to 100 mL 1 / 2MS liquid culture medium, mix thoroughly, and calculate the bacterial solution OD 600 Adjust the concentration to 0.5-0.7, add 100 μM / L acetosyringone and 0.02% sliwet-1 77 to the above bacterial solution to obtain Agrobacterium infection solution carrying the LaAP2L1 recombinant expression vector for genetic transformation.

[0035] (2) Preparation of larch genetic transformation receptor materials Larch seeds were sown in sterilized river sand at a temperature between 22°C and 24°C. After 21 days, when the seedlings grew to 3-5 cm in height, the hypocotyls were cut and washed in a clean bench with 75% alcohol for 3 minutes, then three times with distilled water for 1 minute each. The hypocotyls were then washed with 1% mercuric chloride for 5 minutes, then three times with distilled water for 1 minute each. The hypocotyls were cut into small segments of approximately 8-10 mm and plated on MS solid medium for pre-culture for 2 days before being used as stable transformation materials ( Figure 2 a).

[0036] (3) Infection and co-culture The pre-cultured larch hypocotyl segments were placed in an Agrobacterium infection solution containing a recombinant expression vector expressing LaAP2L11 driven by a larch promoter. The infection solution was filtered and evenly spread on a solid culture medium containing 1 / 2 DCR + 100 μM / L acetosyringone for 3 days.

[0037] (4) Debacterial culture After co-cultivation, the larch hypocotyl segments were washed with sterile water containing a low concentration of timentin for 2 minutes. The washing process was repeated 5-7 times. The surface water was drained and the segments were spread on a solid medium containing 1 / 2 DCR + 4 mg / L 6-BA + 0.2 mg / L NAA + 600 μL / L timentin for 7 days without sterilization. Figure 2 b); (5) Differentiation culture The sterilized hypocotyls were transferred to differentiation medium (1 / 2 DCR+4 mg / L 6-BA+0.2 mg / L NAA) for differentiation induction culture to generate adventitious buds ( Figure 2 c, d).

[0038] (6) Identification of positive transformed strains obtained by genetic transformation The adventitious buds grown in good condition from the hypocotyl callus of larch were cut off and transferred to DCR medium containing 0.1 mg / L 6-BA + 0.01 mg / L NAA + 1 g / L AC + 3 mg / L Basta for resistance screening. After about 20 days, only the positive transformed seedlings could grow normally ( Figure 2 d). After the Basta-resistant positive transformed seedlings have taken root, they are transferred to nutrient soil for further growth.

[0039] (7) Evaluation of the expression level of the target gene LaAP2L11 and observation of target traits in transgenic larch materials.

[0040] DNA was extracted from LaAP2L11-positive transformed seedlings obtained through basta-resistance screening, and the positive transformants were identified by PCR using a combination of primers designed based on the target gene sequence LaAP2L11 and the vector sequence. RNA was extracted from LaAP2L11-positive transformed seedlings obtained through basta-resistance screening, and the expression level of the target gene LaAP2L11 in the transformants was detected and analyzed by qRT-PCR using quantitative primers designed based on LaAP2L11. The expression level of the target gene in the transgenic lines was 5-10 times that of the LaAP2L11 transgenic lines obtained by genetic transformation using a known conventional plant expression vector as a backbone vector ( Figure 4). Compared with the control and transgenic larch obtained by genetically transforming LaAP2L11 into a well-known conventional plant expression vector, at the same growth stage, the transgenic larch expressing the target gene LaAP2L11 driven by the strong larch promoter disclosed in the present invention as the core element exhibits significant fast-growing characteristics ( Figure 5 ).

Claims

1. A nucleotide sequence of the strong promoter LarEF1-1 of Larix gmelinii, characterized in that The gene sequence is as shown in SEQ ID NO.

1.

2. A method for constructing a plant expression vector suitable for highly efficient working in larch gymnosperms by using the nucleotide sequence of the larch strong promoter LarEF1-1 described in claim 1, characterized in that It is carried out according to the following steps: (1) Extraction of larch genomic DNA; (2) Design and synthesis of amplification primers for larch promoter sequence with restriction enzyme sites; (3) Preparation of larch promoter LarEF1-1 fragment with sticky ends of restriction enzyme digestion; (4) Preparation of linearized expression vector with sticky ends of restriction enzyme digestion; (5) Construction of expression vector with nucleotide sequence of larch strong promoter LarEF1-1.

3. A method for creating a plant expression vector suitable for working efficiently in larch gymnosperms and cultivating transgenic larch with targeted agronomic traits directionally improved by using the larch strong promoter LarEF1-1 described in claim 1, which includes the following steps: (1) Construction of recombinant expression vector for expressing target gene driven by larch promoter LarEF1-1 and preparation of infection solution; (2) Preparation of receptor materials for larch genetic transformation; (3) Infection and co-culture; (4) Bacteria-free culture; (5) Differentiation culture; (6) Identification of positive transformed lines obtained by genetic transformation; (7) Evaluation of the expression level of target gene in transgenic materials.

4. Application of the nucleotide sequence of the larch strong promoter LarEF1-1 described in claim 1 in creating a plant expression vector suitable for working efficiently in larch gymnosperms and cultivating transgenic larch with targeted agronomic traits directionally improved.

5. The application described in claim 4, wherein the application in creating and cultivating transgenic larch with targeted agronomic traits directionally improved refers to: - creating and cultivating larch coniferous woody plants with fast growth, salt resistance, drought resistance, disease resistance, and excellent wood properties.

6. In the method for creating a plant expression vector suitable for working efficiently in larch and other gymnosperms and cultivating transgenic larch with targeted agronomic traits directionally improved by using the larch strong promoter LarEF1-1 described in claim 3, the resistance screening medium used in the identification of positive transformed lines obtained by genetic transformation refers to the DCR medium containing 0.1 mg / L 6-BA + 0.01 mg / L NAA + 1 g / L AC + 3 mg / L Basta.

Images