Moso bamboo stalk elongation regulation gene PeGPR10 and application thereof

Abstract

The invention belongs to the technical field of plant molecular biology. Specifically, the invention relates to a moso bamboo stalk elongation regulation and control gene PeGPR10 and application of the moso bamboo stalk elongation regulation and control gene PeGPR10. The invention provides a moso bamboo stalk elongation regulation gene PeGPR10. The nucleotide sequence (CDS coding sequence) of the moso bamboo stalk elongation regulation gene PeGPR10 is shown as SEQ ID No: 1. The invention also provides application of the gene, namely reverse regulation of internode length of rice and reverse regulation of plant height of rice. Namely, compared with wild rice Nipponbare, the internode length of the transgenic rice is reduced, and the plant height is reduced.

Description

Technical Field

[0001] The present invention belongs to the technical field of plant molecular biology; specifically, the present invention relates to a gene for regulating the elongation of Phyllostachys edulis culm PeGPR10 and its application. Background Art

[0002] Bamboo plants belong to the subfamily Bambusoideae ( Gramineae ), Poaceae ( Bambusoideae ), and are a unique and important forest resource. The morphogenesis of bamboo culms consists of shoot bud differentiation and the height growth of bamboo culms. The rapid growth of bamboo refers to the process from the emergence of bamboo shoots, their growth in height, the branching and leaf expansion, to the cessation of the height growth of bamboo. The height growth of bamboo culms follows a "slow-fast-slow" pattern, and the continuous differentiation, division, elongation, and maturation of the intercalary meristem drive the elongation growth of internodes, thereby achieving the elongation of bamboo culms.

[0003] The height growth of bamboo is regulated by the balance between different plant hormones, which affects the growth and development of bamboo shoots. Gibberellin, cytokinin, and auxin are the main hormones regulating cell division and elongation in culms. Among them, the key genes involved in the biosynthesis, degradation, and signal transduction of gibberellin also play an important regulatory role in the elongation process of Phyllostachys edulis culms. At the initial stage of the height growth of Phyllostachys edulis, the overall content of gibberellin is relatively low; the content in the top internodes is relatively high, and it rises sharply in the middle stage of growth, with the highest content in the middle internodes; in the later stage of growth, the content in the top internodes is higher than that in the middle and lower parts. In addition, exogenous application of GA3 can induce the elongation of internodes and the increase in plant height of Phyllostachys edulis seedlings, as well as the accumulation of lignin. Overexpression of the gibberellin biosynthesis gene of Phyllostachys edulis PeGA20ox1 gene causes an increase in the number of internodes and plant height in transgenic rice; the plant height, biomass, lignin, and cellulose content increase in transgenic Arabidopsis thaliana. Brassinolide specifically regulates cell elongation by modulating the metabolism of gibberellin. Low concentrations of BR promote GA synthesis, while high concentrations of BR inhibit GA synthesis, thereby regulating cell division and elongation in the intercalary meristem and affecting plant height. The PeGSK1The encoded GSK3 kinase, a negative regulator of cell elongation, can interact with BZR1, a key regulator in brassinosteroid signal transduction. By participating in the biosynthesis and signal transduction pathways of BR, it regulates the elongation of internode cells, thereby affecting the elongation of the stem. In addition to plant hormones, the heterotrimeric GTP-binding protein (G protein) signaling pathway, as a very conserved transmembrane signal transduction mechanism in eukaryotes, regulates signal perception, signal transduction, hormone responses, and immune responses, playing an important role in the plant height morphogenesis. The G protein complex consists of three subunits: Gα, Gβ, and Gγ. In rice, mutants of the G protein α subunit have shorter plant height, larger and darker green leaves, and are insensitive to exogenous GA. Depending on the C-terminal structure, the G protein γ subunit has different functions. In rice GS3 The Group III type encoding the Gγ subunit, overexpression of which negatively regulates the internode length of rice, may regulate the elongation of stem internode cells through cross-interactions in the hormone synthesis and signal transduction processes.

[0004] So far, the functional studies of plant G protein signals have mainly focused on a few species such as Arabidopsis thaliana, rice, and maize, and there are few reports on the cross-interactions between plant hormones and the coordinated control of plant growth with external environmental signals in woody plants. The stem of bamboo elongates very rapidly. In-depth study of the molecular mechanism of the cross-interaction of the synthesis and signal transduction processes of multiple hormones in Phyllostachys edulis regulating the rapid elongation of the stem has important theoretical significance. SUMMARY OF THE INVENTION

[0005] The technical problem to be solved by the present invention is to provide a Phyllostachys edulis stem elongation regulatory gene that can change the plant height (such as the height of the rice stem) PeGPR10 and its application.

[0006] To solve the problems of the prior art, the present invention provides a Phyllostachys edulis stem elongation regulatory gene PeGPR10 , whose nucleotide sequence (CDS coding sequence) is as shown in SEQ ID No: 1.

[0007] As an improvement of the gene of the present invention: the nucleotide sequence further includes mutants, alleles, or derivatives generated by adding, substituting, inserting, or deleting one or more nucleotides in the nucleotide sequence shown in SEQ ID No: 1.

[0008] The present invention also simultaneously provides the protein encoded by the above-mentioned Phyllostachys edulis stem elongation regulatory gene PeGPR10 , whose amino acid sequence is as shown in SEQ ID No.2.

[0009] Improvement of the protein of the present invention: The amino acid sequence further includes an amino acid sequence or derivative generated by adding, substituting, inserting or deleting one or more amino acids or homologous sequences of other species in the amino acid sequence shown in SEQ ID NO. 2.

[0010] The present invention also simultaneously provides a plasmid containing the above-mentioned Phyllostachys edulis culm elongation regulation gene PeGPR10 as: ProUbi::PeGPR10-GFP-Flag .

[0011] The present invention also simultaneously provides an overexpression vector (plant expression vector) containing the Phyllostachys edulis culm elongation regulation gene PeGPR10 . The overexpression vector is a plant expression vector in which a UBI promoter, PeGPR10 gene, GFP and Flag gene are successively connected in the multiple cloning site region. ProUbi::PeGPR10-GFP-Flag

[0012] The present invention also simultaneously provides the use of the above gene: regulating (inversely regulating) the internode length of rice and regulating (inversely regulating) the plant height of rice.

[0013] Improvement of the use of the gene of the present invention: Compared with the wild-type rice Nipponbare, the internode length of the transgenic rice is reduced and the plant height is reduced. Specifically, the plant height is reduced, and the panicle length, the length of the first internode from the top, the second internode from the top, and the third internode from the top are all reduced.

[0014] The present invention also simultaneously provides a method for regulating (negatively regulating) the internode length of rice: transforming the PeGPR10 gene overexpression vector into rice to obtain transgenic rice plants (cultivating the transformed rice cells into plants), thereby regulating (negatively regulating) the internode length of rice. The transformation can be carried out by the conventional Agrobacterium-mediated method or the gene gun method.

[0015] The present invention also provides a primer pair for cloning the above-mentioned Phyllostachys edulis culm elongation regulation gene PeGPR10 . The primer pair includes an upstream primer and a downstream primer.

[0016] The present invention also provides a host cell, which contains the above-mentioned plant overexpression vector, or the sequence of an exogenous gene such as the Phyllostachys edulis culm elongation regulation gene PeGPR10 is integrated into its genome. The cell is an Escherichia coli cell, an Agrobacterium cell or a plant cell.

[0017] The γ subunit of the G protein of Phyllostachys edulis in the present invention PeGPR10 gene is of great significance in the regulation of plant culm elongation.

[0018] The present invention has the following beneficial effects: The present invention first provides a Phyllostachys edulis stem elongation regulation gene related to regulating the internode length of rice (thereby regulating the plant height of rice). PeGPR10 And its encoded protein and applications. Through the Agrobacterium-mediated transformation method of rice mature embryo callus, PeGPR10 the overexpression vector of the gene was transferred into the japonica rice variety Nipponbare. The results showed that compared with the wild-type lines, the internode lengths of the overexpression lines changed significantly, and the stem lengths were significantly shortened. This result provides a theoretical basis for studying the stem elongation and rapid growth of Phyllostachys edulis, and also provides important resources for improving the rice plant type.

[0019] It should be noted that: the known rice grain size regulation gene GS3 , the cDNA of which has 88.09% identity with that of the present invention. However, this locus is the major QTL controlling rice grain weight and grain length, and is completely different from the use of the PeGPR10 gene of the present invention. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] The specific embodiments of the present invention will be further described in detail below with reference to the drawings.

[0021] Figure 1 It is a diagram of the domain division of the protein encoded by the PeGPR10 gene of the present invention.

[0022] Figure 2 It is a bar graph of the expression pattern analysis of the PeGPR10 gene of the present invention in different parts of the rapidly growing internodes of Phyllostachys edulis.

[0023] Figure 3 It is the PeGPR10 overexpression vector constructed by the present invention---- -ProUbi::PeGPR10-GFP-Flag map information.

[0024] Figure 4 It is the positive identification diagram of the PeGPR10 overexpression transgenic rice of the present invention; N is the negative control, P is the positive control, and 1-9 are the transgenic plant numbers.

[0025] Figure 5 It is the phenotype analysis diagram of the overexpression PeGPR10 transgenic rice of the present invention; Figure 5 Among them: A is the phenotype diagram of the overexpression transgenic rice at the heading stage; B is the bar graph of the relative expression level of the overexpression transgenic rice PeGPR10 ; C is the bar graph of the plant height of the overexpression transgenic rice; Bar = 10 cm; NPB represents the wild-type variety Nipponbare (control), PeGPR10 -OE-1 is the overexpression PeGPR10Transgenic rice line 1, PeGPR10 -OE-2 is overexpression PeGPR10 Transgenic rice line 2.

[0026] Figure 6 is overexpression PeGPR10 Analysis chart of internode length of transgenic rice; Figure 6 In it: A is overexpression PeGPR10 Phenotype chart of internode length of transgenic rice; B is statistical analysis chart of internode length of transgenic rice; Bar = 10 cm; PL represents panicle length, I represents the first internode from top to bottom, II represents the second internode from top to bottom, III represents the third internode from top to bottom, IV represents the fourth internode from top to bottom; NPB represents the wild-type variety Nipponbare (control), PeGPR10 -OE-1 is overexpression PeGPR10 Transgenic rice line 1, PeGPR10 -OE-2 is overexpression PeGPR10 Transgenic rice line 2. Detailed implementation manners

[0027] The following is a detailed description of specific embodiments of the present invention. These embodiments are implemented on the premise of the technical solution of the present invention, and detailed implementation manners and specific operation processes are given. However, the protection scope of the present invention is not limited to the following embodiments.

[0028] The following methods of the present invention can all be operated and carried out with reference to the experimental methods in the conventional "Compendium of Molecular Biology Experiments" in this industry.

[0029] Example 1: Moso bamboo PeGPR10 Cloning and expression pattern analysis 1.1 Cloning of the G protein gamma subunit of moso bamboo PeGPR10 and protein domain analysis (1) Gene sequence acquisition and bioinformatics analysis: Based on the genome information of moso bamboo (Phyllostachys edulis) included in the plant genome database PLAZA, use the keyword [G protein gamma subunit] for retrieval, and screen and determine the annotation gene number of the target G protein gamma subunit gene ( PH02Gene39775 ). Download the predicted coding sequence (CDS) and the corresponding protein sequence of this gene from the database.

[0030] The predicted PeGPR10 protein sequence was submitted to the InterPro protein domain and function classification database for online analysis. The analysis results showed that this protein contains a typical G protein gamma subunit domain (G_gamma_2 domain), confirming its functional characteristics as a G protein gamma subunit ( Figure 1 ).

[0031] (2)Primer design and synthesis: Based on the obtained PeGPR10 full-length CDS sequence of the gene, specific amplification primers were designed: Forward primer ( PeGPR10 -cDNA-F): 5'- ATG GCGATGGCGGCGAAGCCC-3' (SEQ ID NO.3), Reverse primer ( PeGPR10 -cDNA-R): 5'-TAAACACACGCAACACCGA-3' (SEQ ID NO.4); Among them, it contains the start codon ATG (underlined part) and the stop codon TGA. The primers can be synthesized by Zhejiang Shangya Biotechnology Co., Ltd., and the purity is purified by PAGE.

[0032] (3)cDNA template preparation: Samples of moso bamboo seedlings were collected, quickly frozen in liquid nitrogen, and stored at -80 °C. Total RNA was extracted using the Zhongdao Life ZDSM-RE100 RNA Extraction Kit. The quality of the RNA was qualified by 1% agarose gel electrophoresis and NanoDrop ND-1000 spectrophotometer detection (A260 / A280 ≈ 1.8 - 2.0, A260 / A230 > 1.8, 28S / 18S bands were clear). The PrimeScript™ II 1st Strand cDNA Synthesis Kit produced by Takara Biotechnology was selected for the first strand synthesis of cDNA. The RNA sample was 2 μg, and the volume of the RNA sample was no more than 8 μL. The operation steps are as follows: Configure the following reaction mixture in a PCR tube, and the system is shown in Table 1 below: Table 1. RNA denaturation and reverse transcription reaction mixture

[0033] After mixing the above reaction mixture, perform annealing and denaturation reactions at 65 °C for 5 min, and then cool on ice.

[0034] Continue to prepare the reverse transcription reaction solution in the above reaction solution (10 μL), and the system is shown in Table 2 below: Table 2. Reverse transcription reaction solution

[0035] Continue the reverse transcription in the PCR instrument according to the following program (Table 3); Table 3. Reaction program

[0036] Obtain Phyllostachys edulis cDNA and store it in a -20°C refrigerator for later use.

[0037] (4)PCR amplification and product verification Using the Phyllostachys edulis gene cDNA prepared in step (3) as a template, use primers PeGPR10 -cDNA-F and PeGPR 10-cDNA-R for PCR amplification, and use the 2×Phanta Max Master Mix (Dye Plus) high-fidelity DNA polymerase from Novoprotein to amplify PeGPR10 the complete coding sequence (CDS) of the gene.

[0038] The PCR reaction system is as shown in Table 4 below: Table 4. PCR reaction system

[0039] After pipetting and mixing the above reaction mixture, set the following program (Table 5) in the PCR instrument for amplification reaction: Table 5. PCR amplification program

[0040] Observe whether the PCR product amplifies the band of the target gene through agarose gel electrophoresis experiment, and use the DNA gel recovery kit for recovery and purification.

[0041] Amplify the full-length CDS sequence of 573bp, as shown in SEQ ID NO.1, and its corresponding amino acid sequence is as shown in SEQ ID NO.2.

[0042] 1.2 PeGPR10 Expression pattern analysis in the rapidly growing culms of Phyllostachys edulis (1)Sample collection and treatment: Take Phyllostachys edulis bamboo shoots in the rapid growth period (plant height about 2m), cut 10 cm long internodes, and immediately divide the internodes into three sections: top (Up), middle (Mid), and base (Basal). The collected samples are quickly frozen in liquid nitrogen and stored in a -80°C ultra-low temperature refrigerator for later use.

[0043] (2)RNA extraction and cDNA synthesis: Total RNA was extracted from the frozen samples of the above three sections using an RNA extraction kit (Zhongdao Life, ZDSM-RE100, RNA Extraction Kit). The extracted RNA was detected by agarose gel electrophoresis and a spectrophotometer (NanoDrop) to confirm its integrity and concentration / purity. Using the PrimeScriptTM RT reagent Kit with gDNA Eraser (TaKaRa) kit, strictly following the instructions, genomic DNA (gDNA) was removed from an equal amount (1 μg) of total RNA and the first-strand cDNA was synthesized. The synthesized cDNA was diluted by an appropriate multiple (5 - 10 times) and used as a template for qPCR, and stored at -20 °C.

[0044] (3)Real-time fluorescence quantitative PCR (qPCR): Target gene primers: Primers used for detecting PeGPR10 the gene expression were as follows: Forward primer ( PeGPR10 -RT-F): 5'-CGAACCATTCATAACGATTTCA-3' (SEQ ID NO.5), Reverse primer ( PeGPR10 -RT-R): 5'-AGATCCACGAGAGGTAGCTCAA-3' (SEQ ID NO.6).

[0045] Reference gene primers: Primers used for detecting the reference gene NTB expression were as follows: Forward primer (NTB-RT-F): 5'-TCTTGTTTGACACCGAAGAGGA-3' (SEQ ID NO.7), Reverse primer (NTB-RT-R): 5'-AATAGCTGTCCCTGGAGGAGTTT-3' (SEQ ID NO.8).

[0046] qPCR reaction system (20 μl): 2 × Q3 SYBR qPCR Master Mix (Universal) (TOLOBIO, #22204) 10 μl, Forward primer (10 μM): 0.4 μl (final concentration 0.2 μM), Reverse primer (10 μM): 0.4 μl (final concentration 0.2 μM), cDNA template 1 μl (corresponding to approximately 5 - 10 ng of total RNA before reverse transcription), and sterile nuclease-free water was added to make up to 20 μl.

[0047] qPCR amplification program (two-step method): Pre-denaturation: 95 °C, 3 min; Cycling stage (40 cycles): Denaturation 95 °C, 15 s; Annealing / extension / fluorescence acquisition: 60 °C, 60 s.

[0048] Experimental setup: Each sample (top, middle, and base) was set up with at least three biological replicates, and each biological replicate was set up with three technical replicates. No template was also set up to exclude contamination.

[0049] (4) Data analysis: The cycle threshold value (Ct value) of each reaction well was obtained using the qPCR instrument supporting software; the target gene ( PeGPR10 ) and internal reference genes ( NTB ) in each biological replicate; Calculate the ΔCt value: For each biological replicate, ΔCt = Ct( PeGPR10 ) - Ct (NTB ); Calculate the ΔΔCt value: take the sample at the top of the internode (Up) as the control group, and calculate the ΔΔCt value of the experimental group (Mid, Basal) relative to the control group: ΔΔCt = ΔCt(experimental group) - ΔCt(control group); Calculate the relative expression level: The relative expression level of the target gene in the experimental group relative to the control group (Relative expression level) is calculated as: Relative expression level = 2 ^(-ΔΔCt) Statistical Analysis: Analyze the differences between the top, middle, and base samples using appropriate statistical methods (e.g., one-way ANOVA with Tukey's HSD multiple comparison test). PeGPR10 The significance level was set at P < 0.05.

[0050] (5) Results and Conclusions qPCR analysis results showed that ( Figure 2 ), PeGPR10 The gene expression level was highest in the top (Up) region of the fast-growing internode of the bamboo stem, and its relative expression level was set to 1 (control group). The relative expression levels in the middle (Mid) and base (Basal) regions were significantly lower than those in the top (P<0.05), at 0.42 and 0.37, respectively. The difference in expression between the middle and base regions did not reach a statistically significant level. This result indicates that PeGPR10 During the rapid elongation of bamboo stems, the gene is highly expressed mainly in the top area of the internode (i.e., the active cell elongation area), while the expression level in the middle and base (the area where cell elongation slows down or stops) is significantly reduced. PeGPR10 The expression pattern of the gene is closely related to the rapid elongation growth of internodes in bamboo stems.

[0051] Example 2: Overexpression of bamboo PeGPR10 Functional verification 2.1 Overexpression vector ProUbi::PeGPR10-GFP-Flag Construction (1) Amplification and purification of target gene fragments Primer design: Based on the full-length CDS sequence (SEQ ID NO.1) of the Moso bamboo gene, specific primers with specific homologous recombination arms were designed to amplify the target fragment. Forward primer ( PeGPR10 -OE-F): 5'-tgttacttctgcaggagctc PeGPR10 GCGATGGCGGCGAAGCCC-3' (SEQ ID NO.9), reverse primer ( ATG -OE-R): 5'-ctcaccatggatccggtaccTAAACACACGCAACACCGA-3' (SEQ ID NO.10); where the lowercase letters are homologous recombination arms. PeGPR10

[0052] PCR amplification: Using the Moso bamboo cDNA prepared in Example 1 as a template, primers PeGPR10 -OE-F and PeGPR10 -OE-R, and the 2×Phanta Max Master Mix (Dye Plus) high-fidelity DNA polymerase from Novoprotein were used for PCR amplification. The reaction conditions refer to the PCR program in Example 1, and the annealing temperature was optimized to 60°C.

[0053] Product verification and purification: The PCR product was analyzed by 1% agarose gel electrophoresis to confirm the presence of a single clear band at the expected size (about 573 bp). The target band was recovered by cutting the gel using the AxyPrep DNA Gel Extraction Kit (Axygen). The purified DNA was dissolved in an appropriate amount of sterile nuclease-free water, and the concentration was determined by a spectrophotometer. The sequence was the same as that shown in SEQ ID NO.1.

[0054] (2) Linearization of the overexpression vector Vector information: The basic vector used in this experiment was named ProUbi::GFP-Flag . This vector is an existing known vector, namely the pUbi-GFP- Flag in the patent CN118620953B "Application of Rice GS2 Gene in Regulating Rice Panicle Type".

[0055] Take 2 μg of vector plasmid DNA, and use the restriction endonuclease Sac I (NEB, R3156) to incubate at 37°C for 2 hours for enzymatic digestion. The enzymatic digestion system was carried out according to the manufacturer's instructions. The linearized vector fragment was purified using a nucleic acid purification kit (AxyPrep DNA Gel Extraction Kit (Axygen)) and dissolved in sterile nuclease-free water.

[0056] (3) Homologous recombination connection diagram​ The purified PeGPR10 gene fragment (with homologous arms) and the purified linearized ProUbi:: GFP-Flag vector fragment (with complementary homologous arms) obtained in step (2) were used with the ClonExpress® II One Step Cloning Kit recombinase kit from Novoprotein Scientific Inc. to further ligate the obtained PCR recovery product of the target gene to the vector.

[0057] Prepare the ligation reaction mixture as shown in Table 6 below.

[0058] Table 6. Homologous recombination ligation reaction system

[0059] (4) Transformation and positive clone screening: The homologous recombination product from step (3) was transformed into TSINGKE TSC-C14 DH5α competent cells, ice-bathed for 30 min and then heat-shocked at 42 °C for 45 s; after recovery, it was spread on an LB solid plate containing Kna antibiotic and incubated upside down at 37 °C for 12 - 16 hours; single colonies were picked and positive clones were identified using the universal vector primers. The forward primer sequence for sequencing was detF: TTGATATACTTGGATGATGGCATA (SEQ ID NO.11), and the reverse primer sequence was detR: CACTGCACGCCGTAGGTGA (SEQ ID NO.12).

[0060] (5) Sequencing of positive clones and obtaining of recombinant plasmids: The single colonies positive for colony PCR were sent to Zhejiang Shangya Biotechnology Co., Ltd. for sequencing, and sequencing was performed using the det primers from step (4). The sequencing results confirmed that the inserted fragment sequence was exactly the same as SEQ ID NO: 1 and the reading frame was correct, forming ProUbi::PeGPR10-GFP-Fla g fusion gene plasmid ( Figure 3 ).

[0061] 2.2 Overexpression PeGPR10 Obtaining of transgenic rice The constructed recombinant overexpression vector was introduced into the japonica rice variety 'Nipponbare' using the Agrobacterium tumefaciens ( Agrobacterium tumefaciens )-mediated genetic transformation method (Zhao et al., 2011; Plant Cell Tissue & Organ Culture. 2011, 106(3):475). The specific steps are as follows: ProUbi::PeGPR10-GFP-Flag The recombinant plasmid was transferred into the Agrobacterium strain by electroporation through electroporation, ProUbi::PeGPR10-GFP-Flag into theEHA105 Using the callus induced from the mature embryos of the japonica rice variety Nipponbare, after 2 weeks of induction in the induction medium, select the vigorously growing callus as the receptor material and place it into the ProUbi::PeGPR10-GFP-Flag Agrobacterium EHA105 suspension, and shake for infection for 30 minutes; spread the infected callus of Nipponbare on the sterile filter paper, and after the bacterial liquid is absorbed, transfer the callus to co-culture at 28 °C in the dark for 3 days; wash the co-cultured callus with sterile water containing 400 mg / L carbenicillin, and spread the callus on the selection medium containing 50 mg / L Hygromycin and 400 mg / L carbenicillin for light culture for about 20 days; transfer the pre-differentiated callus to the differentiation medium and continue to culture under light conditions until resistant callus seedlings grow; transfer to the rooting medium and continue to culture. When the seedlings grow to 10 - 15 cm and take root, open the sealing film of the vial, pour in sterilized water, and harden the seedlings for 3 days, then transplant them into the greenhouse, and the obtained is named overexpression PeGPR10 transgenic rice.

[0062] Note: For the selection medium, differentiation medium, and rooting medium mentioned above, please refer to "Agrobacterium tumefaciens-mediated genetic transformation of japonica rice" in Chapter 8 of "Rice Protocole-book".

[0063] 2.3 Overexpression PeGPR10 Screening and identification of positive transgenic plants (1) Genomic DNA extraction: Extract the genomic DNA of the leaf tissue of overexpression transgenic rice plants by the CTAB method. PeGPR10

[0064] (2) PCR detection: Use the genomic DNA extracted in (1) above as the PCR amplification template (with a concentration of about 50 - 100 ng / µL). The specific primer sequences are forward primer F: 5'-TTGATATACTTGGATGATGGCATA-3' (SEQ ID NO.13), reverse primer R: 5'-ATGTGGCACTGCACCTAGGAC-3' (SEQ ID NO.14), and perform PCR molecular detection.

[0065] Use 2×Taq Master Mix (Dye) for PCR amplification, and the reaction system is as shown in Table 7 below: Table 7. PCR amplification reaction system

[0066] Set the following program (Table 8) in the PCR instrument for amplification: Table 8. PCR reaction program

[0067] After subjecting the PCR reaction product to 1.5% agarose gel electrophoresis, observe it in a gel imaging system ( Figure 4 ). Among them, Figure 4 the negative control N in is the transgenic rice transformed with the empty vector, and the positive control P is the plasmid ProUbi::PeGPR10- GFP-Flag , and lanes 1 - 9 are the 9 obtained transgenic rice seedlings.

[0068] The results show that: in the gel imaging results ( Figure 4 ), the sizes shown in lanes 1, 2, 4, 7, 8, and 9 are similar to that of the positive control P, indicating that the gene expression cassette has been successfully integrated into the genomic DNA of these plants, and they are determined as positive transgenic plants. The negative control (lane N, transgenic rice transformed with the empty vector) did not show the expected bands. The positive control (lane P, plasmid PeGPR10 ) showed bands of the expected size, verifying the effectiveness of the PCR detection system. Self - cross the above 6 positive transgenic plants respectively, and finally obtain 6 independent transgenic rice lines overexpressing ProUbi::PeGPR10-GFP-Flag . PeGPR10

[0069] 2.4 Phenotypic analysis of the plant height and internode length of transgenic rice overexpressing PeGPR10 Perform phenotypic observation on 6 independent transgenic rice lines (Nipponbare background) overexpressing PeGPR10 obtained by screening through the above step 2.3. Select two lines with significant differences in both PeGPR10 expression level and plant height phenotype for detailed analysis: PeGPR10 - OE1 (line 1) and PeGPR10 - OE2 (line 2) ( Figure 5 A).

[0070] Plant growth stage: When the rice plants grow to the mature stage, measure the phenotypes of wild - type Nipponbare and transgenic lines overexpressing PeGPR10.

[0071] Determination of gene expression level: The determination method is carried out according to the method described in step 1.2 of Example 1 to measure the expression levels of the PeGPR10 gene in the control wild - type Nipponbare and the overexpressing PeGPR10 overexpressing lines.

[0072] Phenotype determination: Measure and record wild - type Nipponbare (NPB), PeGPR10 - OE1 (line 1) and PeGPR10The following agronomic traits of -OE2 (line 2), including plant height, ear length, and lengths of the first, second, and third internodes from top to bottom, were analyzed for significant differences between the transgenic lines and wild-type controls using t-tests. Significance was set at P < 0.05 or P < 0.01.

[0073] The results showed that when rice grows to maturity, PeGPR10 -OE-1 PeGPR10 The expression level of Nipponbare (NPB) is 323 times that of the receptor. PeGPR10 -OE-2 PeGPR10 The expression level of the receptor Nipponbare is 521 times higher than that of Figure 5 B). Compared with wild-type rice Nipponbare (NPB), overexpression PeGPR10 The plant height of transgenic rice was significantly reduced ( Figure 5 C), and the spike length (PL), the length of the first internode, the second internode, and the third internode from top to bottom were significantly reduced ( Figure 6 ), resulting in the transgenic rice plant height being significantly shorter than that of the wild-type Nipponbare.

[0074] Finally, it should be noted that the above examples are merely specific embodiments of the present invention. Obviously, the present invention is not limited to the above examples and is subject to numerous variations. All variations that can be directly derived or conceived by a person of ordinary skill in the art from the disclosure of the present invention are considered to be within the scope of protection of the present invention.

Claims

1. Phyllostachys edulis culm elongation regulation gene PeGPR10 , characterized in that: The nucleotide sequence is shown as SEQ ID No:

1.

2. The gene according to claim 1, characterized in that: The nucleotide sequence also includes mutants, alleles or derivatives generated by adding, substituting, inserting or deleting one or more nucleotides in the nucleotide sequence shown as SEQ ID No:

1.

3. The moso bamboo culm elongation regulation gene as described in claim 1 PeGPR10 The encoded protein is characterized in that: The amino acid sequence is shown as SEQ ID No.

2.

4. The protein according to claim 3, characterized in that: The amino acid sequence also includes an amino acid sequence or derivative generated by adding, substituting, inserting or deleting one or more amino acids or homologous sequences of other species in the amino acid sequence shown as SEQ ID NO.

2.

5. A plasmid containing the moso bamboo culm elongation regulation gene as described in claim 1 PeGPR10 , characterized in that: For ProUbi::PeGPR10-GFP-Flag .

6. An overexpression vector containing the moso bamboo culm elongation regulation gene as described in claim 1 PeGPR10 , characterized in that: The overexpression vector is a plant expression vector in which a UBI promoter, the PeGPR10 gene as described in claim 1, and a GFP gene are successively linked in the multiple cloning site region. ProUbi::PeGPR10-GFP-Flag ​ 7. Use of the gene according to claim 1 or 2, characterized in that: Regulate the internode length of rice and regulate the plant height of rice.

8. Use of the gene according to claim 7, characterized in that: Compared with the wild-type rice Nipponbare, the internode length of the transgenic rice is reduced and the plant height is reduced.

9. A method for regulating the internode length of rice, characterized in that: Transform the PeGPR10 gene overexpression vector into rice to obtain transgenic rice plants, thereby regulating the internode length of rice.

Images