Method for judging drought tolerance efficiency of Hv14-3-3A gene on plant and application of Hv14-3-3A gene

Abstract

The invention provides a method for judging the drought tolerance efficiency of an Hv14-3-3A gene on plants and application of the Hv14-3-3A gene, expression of the gene is inhibited through a gene silencing technology, drought stress is applied to silent plants, and physiological parameter changes are observed to evaluate the drought tolerance of the plants. The method for judging the drought tolerance efficiency of the Hv14-3-3A gene on the plant comprises the following steps: acquiring a gene sequence, constructing a BSMV virus vector, carrying out in-vitro transcription, carrying out friction inoculation and the like, and verifying the gene silencing efficiency by utilizing qRT-PCR (Quantitative Reverse Transcription-Polymerase Chain Reaction). The Hv14-3-3A gene can be used for regulating and controlling stomatal conductance, photosynthesis efficiency and water utilization efficiency of plants, so that drought tolerance is enhanced.

Description

Technical Field

[0001] This application relates to the technical field of transgenic plants, and particularly to a method for determining the drought tolerance efficacy of the Hv14-3-3A gene in plants and its application. Background Art

[0002] Drought is one of the main environmental factors affecting global crop production and poses a serious threat to food crops such as barley. Therefore, developing plant varieties with strong drought resistance is of great significance for increasing crop yields and ensuring food security.

[0003] Traditional drought-resistant breeding methods mainly rely on variety screening and conventional genetic improvement means. Although these methods can improve the drought resistance of crops to a certain extent, they are often inefficient and it is difficult to deeply understand the functions of drought-resistant genes at the molecular mechanism level. With the development of genetic engineering technology, it has become possible to improve the drought resistance of crops through gene regulation means. Summary of the Invention

[0004] To solve the deficiencies of the prior art, the purpose of this application is to provide a method for determining the drought tolerance efficacy of the Hv14-3-3A gene in plants, Hv14-3-3A the use of the gene, and a genetic engineering method for enhancing the drought tolerance of plants, aiming to study the specific action mechanism and function of the specific 14-3-3 protein Hv14-3-3A in drought response.

[0005] To achieve the above purpose, this application adopts the following technical solutions: This application provides a method for determining the drought tolerance efficacy of the Hv14-3-3A gene in plants. The method for determining the drought tolerance efficacy of the Hv14-3-3A gene in plants includes: suppressing the expression of the gene in plants through gene silencing technology; imposing drought stress on the plants after gene silencing; and determining the regulatory effect of the gene on drought tolerance through changes in physiological parameters, where the physiological parameters include at least one of the transpiration rate of plants, the CO2 assimilation rate, and the relative water content of leaves. Hv14-3-3A Hv14-3-3A As a preferred technical solution, the suppressing the expression of the gene in plants through gene silencing technology includes: obtaining

[0006] Hv14-3-3A Hv14-3-3A Hv14-3-3A Hv14-3-3A Hv14-3-3AThe complete sequence of the gene; obtaining vectors for the α, β, and γ RNA strands of Barley stripe mosaic virus (BSMV); performing in vitro transcription on the vectors for the α, β, and γ RNA strands of BSMV respectively to obtain RNAα, RNAβ, and RNAγ molecules; ligating a partial fragment of the Hv14-3-3A gene into the BSMV RNAγ vector to obtain RNAγ:14-3-3A; mixing equal amounts of RNAγ and RNAγ:14-3-3A with RNAα and RNAβ respectively to obtain a mixture of RNAα, RNAβ, and RNAγ molecules and a mixture of RNAα, RNAβ, and RNAγ:14-3-3A; using the friction inoculation method to infect two groups of plant leaves with the mixture of RNAα, RNAβ, and RNAγ and the mixture of RNAα, RNAβ, and RNAγ:14-3-3A respectively.

[0007] As a preferred technical solution, ligating a partial fragment of the Hv14-3-3A gene into the BSMV RNAγ vector to obtain the RNAγ:14-3-3A vector includes: extracting the RNA of the plant, reverse transcribing the RNA of the plant into cDNA; amplifying Hv14-3-3A the cDNA fragment of the gene to obtain Hv14-3-3A the gene fragment; using agarose gel electrophoresis to detect the obtained Hv14-3-3A gene fragment and recovering and purifying the Hv14-3-3A gene fragment; extracting the plasmid DNA of the BSMV RNA γ vector, using a restriction endonuclease to digest the γ vector to generate a linearized vector fragment, and recovering and purifying the linearized vector fragment; performing the same restriction endonuclease digestion on the recovered and purified Hv14-3-3A gene fragment and the recovered and purified linearized vector fragment to ensure that they have the same sticky ends, and ligating the target gene fragment with the vector fragment to form a recombinant vector.

[0008] As a preferred technical solution, the determination of the regulatory effect of the Hv14-3-3A gene on drought tolerance by physiological parameter changes further includes verifying the Hv14-3-3A gene silencing efficiency by qRT-PCR method, including: sampling the plant leaves treated with drought for 0 days and 10 days respectively, collecting the samples of the largest functional leaves, immediately freezing them in liquid nitrogen, then storing them at -80°C, and extracting the total plant RNA; reverse transcribing the obtained total plant RNA into cDNA; performing qRT-PCR experiments, selecting the HvActin gene as an internal reference, performing several biological replicates for each treatment group, and calculating the gene expression level by the 2 -ΔΔCt method.

[0009] As a preferred technical solution, the inhibition of the expression of the Hv14-3-3A gene in plants by gene silencing technology further includesHv14-3-3A Subcellular localization of the gene, including: Hv14-3-3A Cloning the gene into a GFP vector, transforming plant leaves for subcellular localization, and observing its distribution in cells through a fluorescence microscope; Hv14-3-3A Cloning the gene into the pNC-Green-SubN vector, extracting the plasmid after ensuring the correctness of the cloning result, and storing the bacterial solution with correct sequencing; performing plant transformation and subcellular localization detection through the Agrobacterium-mediated method.

[0010] As a preferred technical solution, the Agrobacterium-mediated method for tobacco transformation and subcellular localization detection includes: Inoculating a monoclonal of the target Agrobacterium into a liquid LB medium containing kanamycin and rifampicin, culturing overnight, centrifuging and resuspending to OD600 = 0.8; Mixing two Agrobacteria and injecting them in a 1:1 volume ratio; Selecting fully expanded plant leaves and injecting the mixture of the two Agrobacteria from the back of the leaves, injecting 3 - 5 plant leaves with each bacterial solution; Culturing in a moisturized environment in the dark for 2 - 3 days, and then sampling and observing.

[0011] As a preferred technical solution, the photoperiod in the plant growth chamber is set to 16 hours of light and 8 hours of darkness, the temperature is 25°C, and the relative humidity is 60%; When the plant seedlings grow to the three-leaf stage, start the water-deficient drought treatment, with the plants watered normally as the control.

[0012] As a preferred technical solution, the plant is a gramineous crop, preferably barley, rice or wheat.

[0013] This application also provides a Hv14-3-3A Use of the gene, and this use is: regulating the stomatal conductance, photosynthesis efficiency and water use efficiency of plants, thereby enhancing the tolerance of plants under drought conditions.

[0014] This application also provides a genetic engineering method for enhancing plant drought tolerance, including: obtaining target plant materials; Hv14-3-3A Introducing the gene into the target plant materials; Screening to obtain transgenic plants expressing the barley Hv14-3-3A gene; Measuring the drought tolerance of the transgenic plants under drought stress.

[0015] Compared with the prior art, the beneficial effects of this application are as follows: 1. This application clarifies the important role of the barley Hv14-3-3A gene in regulating physiological processes such as plant stomatal conductance, photosynthesis efficiency and water use efficiency, thereby enhancing the tolerance of plants under drought conditions. This discovery fills the gap in the research on the response of barley 14-3-3 protein to drought stress, providing a new perspective for understanding the drought resistance mechanism of barley.

[0016] 2. Traditional drought-resistant breeding methods mainly rely on variety screening and conventional genetic improvement, which are time-consuming and have limited effects. This application proposes a genetic engineering method for enhancing plant drought tolerance. Through genetic engineering techniques, Hv14-3-3A genes are introduced into target plant materials, and transgenic plants expressing these genes are screened. This method provides a new technical approach for drought-resistant improvement of crops. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 For Hv14-3-3A 、 Hv14-3-3B 、 Hv14-3-3C 、 Hv14-3-3D 、 Hv14-3-3E and Hv14-3-3F expression pattern diagrams in different tissues under drought; Figure 2 For Hv14-3-3A 、 Hv14-3-3B 、 Hv14-3-3C 、 Hv14-3-3D 、 Hv14-3-3E and Hv14-3-3F subcellular localization analysis diagrams; Figure 3 For Hv14-3-3A barley Figure 4 gene-silenced phenotype diagrams in response to drought; HvPDS For Figure 5 wild barley XZ141 leaves Hv14-3-3A relative expression level diagrams; Figure 6 For Figure 7 stomatal density diagrams of BSMV:γ and BSMV:Hv14-3-3A barley seedlings under drought stress for one week; DETAILED DESCRIPTION OF THE EMBODIMENTS

[0018] To enable those skilled in the art to better understand the solution of this application, the technical solutions in the specific embodiments of this application will be clearly and completely described below with reference to the accompanying drawings in the embodiments of this application.

[0019] The 14-3-3 protein family is a highly conserved protein family in plants, participating in various physiological processes of plants, such as growth and development, environmental adaptation, and stress resistance responses. 14-3-3 proteins regulate physiological activities such as stomatal movement, ion channels, and ABA signal transduction by interacting with a variety of target proteins.

[0020] In eukaryotes, 14-3-3 proteins are highly conserved and form homo- or hetero-dimers by binding to target proteins, thereby regulating the structure, activity, transcription, subcellular localization, and stability of target proteins, and further regulating their functions (Wei Jiang et al., 2024). However, so far, no 14-3-3 genes have been found in prokaryotes. So far, researchers have resolved the crystal structures of some plant 14-3-3 proteins, which are very similar to animal 14-3-3 proteins (W. Jiang et al., 2022).

[0021] Studies have shown that when oranges ( Citrus sinensis are exposed to drought stress, the expression levels of most CitGF14 genes increase (Lyu, Chen, Pan, Chen, & She, 2021). In chickpeas ( Cicer arietinum under drought stress, CaGF14 genes show higher expression in roots than in shoots (Chakraborty, Soudararajan, & Kumar, 2022). In mangoes ( Mangifera indica L.), under drought stress, the expression levels of Mi14-3-3-6A / A1 , Mi14-3-3- 3B / B2 and Mi14-3-3-E2 / I2 increase significantly at 12 h, but decrease at 24 / 72 h (Xia et al., 2022). In addition, the expression level of tomato SlTFT1 / 2 / 3 / 8 / 9 increases significantly at 3 h of drought stress and then decreases at 12 or 24 h (Jia et al., 2022). When drought-treated common soybeans ( Phaseolus vulgaris ) for 0, 1, 3, 5, 7, and 9 days, the PvGF14 gene shows different degrees of decrease or increase (Li et al., 2015). In tea plants ( Camellia sinensis ), the expression level of CsGRF21 is induced by drought, while CsGRF9 decreases under drought stress (Z. B. Zhang et al., 2022). In Arabidopsis, overexpression of GCN4 ( GENERAL CONTROL NONREPRESSIBLE-4 ) genes leads to the degradation of GRFs and RPM1-INTERACTING PROTEIN4 (RIN4), thereby reducing H +The activity of -ATPase and induces stomatal closure, ultimately reducing water loss and enhancing drought tolerance (Kaundal et al., 2017). Thus, 14-3-3 proteins play an important role in plants' response to drought stress. However, it is unclear whether barley 14-3-3 proteins are involved in drought stress.

[0022] In 1967, in bovine brain tissue, researchers Moore and Perez isolated some acidic soluble proteins. These proteins were separated by a diethylaminoethyl cellulose column (DEAE-cellulose), and based on results such as their mobility after starch gel electrophoresis, they were finally named 14-3-3 proteins (Zhao, Li, & Li, 2021). The 14-3-3 binding motif has four types, including 946 YpTV, (R / K)XX(pS / pT)XP, (R / K)XXX(pS / pT)XP, and pS / pT-X 1-2 -COOH, which is very important for the interaction with various target proteins. Plant 14-3-3 proteins are involved in numerous physiological processes, such as the regulation of the activity of ion channels (Ca 2+ , KAT, AHA, and GORK) (Cotelle & Leonhardt, 2015), hormone signaling (Camoni, Visconti, Aducci, & Marra, 2018), metabolism (Fulgosi et al., 2002), and stomatal movement, etc. (Cotelle & Leonhardt, 2015). Environmental stress can affect the function of 14-3-3 proteins in various ways (Denison, Paul, Zupanska, & Ferl, 2011), including activating signal pathways and the phosphorylation of corresponding proteins (Paul, Denison, Schultz, Zupanska, & Ferl, 2012), affecting the transcriptional activity of 14-3-3 and signaling molecules (such as Ca 2+and AMP) (Jaspert, Throm, & Oecking, 2011), as well as changing the post-translational modification sites (PTMs) of 14-3-3 isoforms, etc. (de Boer, van Kleeff, & Gao, 2013; Wilson, Swatek, & Thelen, 2016). In plant 14-3-3 proteins, phosphorylation occurs at different sites in an isoform-specific manner, which is involved in the dimerization and interaction of 14-3-3 with target proteins (Johnson et al., 2010). In addition, 14-3-3 proteins can be autophosphorylated or phosphorylated after interacting with target proteins (Schoonheim et al., 2007), thereby regulating the catalytic activity, stability, and substrate specificity of themselves or their target proteins, as well as the disassembly or assembly of macromolecular complexes (Ormancey, Thuleau, Mazars, & Cotelle, 2017).

[0023] Studies have shown that 14-3-3 proteins are involved in the response to drought stress in multiple plants (Huang et al., 2022). For example: Overexpression of wheat Nicotiana tabacum in tobacco ( TaGF14b ) can regulate ABA-induced stomatal closure and thus improve drought resistance (Y. Zhang et al., 2018); OsCDPK1 in rice activates the expression of 14-3-3 proteins by transducing Ca 2+ signals to improve drought resistance (Ho et al., 2013). Plasma membrane H + -ATPase (AHA) is one of the target proteins interacting with 14-3-3 proteins. Reducing its activity can promote membrane depolarization-mediated stomatal closure under drought stress (Merlot et al., 2007). In addition, OsGF14b / c / e / f genes are significantly upregulated under PEG6000 conditions, indicating their important role under drought stress (F. Chen, Li, Sun, & He, 2006). Constitutive expression of OsGF14f in rice improves plant drought resistance by increasing the endogenous ABA level, which shows the 14-3-3s 's key role in the drought stress response (Q. Liu, Zhang, & Liu, 2016). The F-Box-encoding protein OsFBX257 mediates the drought stress response through interaction with the rice 14-3-3 proteins GF14b / c (Sharma et al., 2023). However, OsGF14b overexpression plants of the gene show sensitivity to drought stress, while OsGF14bThe knockout plants showed tolerance to drought stress, which may be related to the abscisic acid (ABA) signaling pathway (J. Liu et al., 2019). Overexpression of AtGRF6 / 9 in Arabidopsis thaliana can allocate more carbon to the roots and improve root proton secretion, thereby regulating its drought tolerance (He et al., 2015). Overexpression of AtGRF6 ( GF14λ ) in cotton can also improve the ability of cotton to resist drought stress. Further analysis showed that this was due to the induced stomatal opening in transgenic plants resulting in higher photosynthesis and transpiration rates (Yan et al., 2004). The drought tolerance regulated by 14-3-3 proteins may also be partly attributed to changes in plant stomatal size and root hair development (Q. Liu et al., 2016). In addition, studies have shown that arbuscular mycorrhizal symbiosis can regulate 14-3-3 genes through ABA signal transduction and antioxidant / osmotic regulation, and enhance the drought resistance of tomatoes (Xu et al., 2018) and Populus cathayana Rehd. ( Populus cathayana ) (Han, Lou, Zhang, Xu, & Tang, 2022). In Arabidopsis thaliana, overexpression of the seagrass ​ gene can increase the expression levels of ​ , ​ and ​ , and increase its resistance to osmotic stress, which may be through the ABA-dependent pathway (S. Chen & Qiu, 2022). However, wild soybean ( ​ ) ​ showed a negative effect in drought resistance. In addition, overexpression of ​ in Arabidopsis thaliana also increased the drought sensitivity during seedling growth and seed germination, while silencing of ​ ( ​ , the gene with the highest homology to ​ ) enhanced the drought resistance during seed germination and seedling stage (Sun et al., 2014). Further analysis showed that ​ inhibited root hair development and stomatal size, thereby reducing water absorption and transpiration rates (Sun et al., 2014). The above research results indicate that 14-3-3 proteins play an extremely important role in regulating plant drought resistance.

[0024] 14-3-3 can also interact with receptors, ion pumps, channels, and protein kinases in guard cells, thereby participating in stomatal signaling and further responding to biotic and abiotic stresses (Cotelle & Leonhardt, 2015). The activation of AHA by 14-3-3 proteins can promote blue light-induced stomatal opening (Wilson et al., 2016). During long-term white light, the interaction between phototropin (PHOT), AHA, and 14-3-3 proteins plays an important role in promoting stomatal opening (Kostaki et al., 2020). Multiple K + channel expressions can be detected in guard cells, including K + channels (KAT1), K + transporters (AKT2), and outward-rectifying K + ion channels (GORK) (Cotelle & Leonhardt, 2015). These potassium channel proteins have all been reported to interact with 14-3-3 proteins (Jaspert et al., 2011) and respond to different plant physiological processes. For example, the binding of ZmGF14-6 protein to KAT1 can regulate the opening and the number of plasma membrane potassium channels, thus conferring channel activity (Cotelle & Leonhardt, 2015; Sottocornola et al., 2008). In addition, based on mass spectrometry-based proteomic analysis, through the 14-3-3ω complex purified by tag affinity, GORK is considered a target protein of 14-3-3 (Chang et al., 2009). AtTPK1 / 3 / 5 can also bind to 14-3-3s to respond to plant physiological processes (Sinnige et al., 2005), and the phosphorylation of the 14-3-3 binding motif in TPK1 / 5 is a prerequisite for their interaction (Cotelle & Leonhardt, 2015). In addition, the phosphorylation of Abscisic Acid Responsive Elements-Binding Factor3 (ABF3) protein at T451 by OST1 enhances the affinity of its C4 domain for 14-3-3 proteins (Sirichandra et al., 2010). OST1 and SLAC1 are important response proteins for stomatal closure, but there are few reports on whether 14-3-3 proteins interact with OST1 and SLAC1 (Cotelle & Leonhardt, 2015).

[0025] In barley, most ​The gene is expressed at low levels in senescent leaves and developing grains (https: / / apex.ipk-gatersleben.de / apex / f?p=284:57). ​ It is mainly expressed in inflorescences and roots, indicating its involvement in the development of reproductive and vegetative tissues. ​ It is expressed at low levels in different organs, developmental stages, and responses to various environmental stresses, and may be a pseudogene. ​ and ​ show similar expression profiles in major organs such as internodes, roots, developing grains, and lodicules. Additionally, ​ and ​ have similar expression levels in most tissues such as the epidermal layer and young shoots in seedlings.

[0026] ​ 、 ​ 、 ​ 、 ​ 、 ​ and ​ The expression patterns in different tissues under drought are as shown in ​ .

[0027] ​ 、 ​ 、 ​ 、 ​ 、 ​ and ​ The subcellular localization analysis diagrams are as shown in ​ .

[0028] To study the localization patterns of ​ , six members were separately constructed into the vector pNC-Green-SubN for transient expression in tobacco. In the ​ family, ​ is localized to the nucleus. While ​ is localized to the nucleus and plasma membrane, and there is obvious overlap between the GFP fluorescence and the RFP fluorescence of the membrane protein. RFP uses the reported gene (AtPIP2A) as a control and is localized to the plasma membrane. ​ and ​ have weak fluorescence signals, which is consistent with their tissue expression results.

[0029] To further study the role of specific genes in the 14-3-3 protein in plant drought resistance, this application provides a method for determining the drought tolerance efficacy of the Hv14-3-3A gene in plants.

[0030] The method for determining the drought tolerance efficacy of the Hv14-3-3A gene in plants includes:[[]] Step 1, inhibiting the expression of the ​ gene in plants through gene silencing technology; Step 2: Apply drought stress to the plants after gene silencing; Step 3: Determine ​ the regulatory effect of the gene on drought tolerance, where the physiological parameters include at least one of the plant transpiration rate, CO2 assimilation rate, and relative leaf water content.

[0031] Specifically, use a LI-6800 photosynthesis measurement device to measure the photosynthetic characteristics of the plants under drought treatment, including CO2 assimilation rate, leaf transpiration rate, and stomatal conductance, etc. Stomatal conductance is used to determine the relative leaf water content.

[0032] The beneficial effects of this method are mainly reflected in the following aspects: I. Clarify gene function Precise positioning: Through gene silencing technology, the expression of the gene can be specifically inhibited ​ so as to accurately study the role of the gene in plant drought tolerance. This method avoids the interference caused by gene function redundancy or complex genetic background in traditional genetic methods.

[0033] Function verification: After gene silencing, apply drought stress to the plants and observe the changes in physiological parameters to directly verify ​ whether the gene is involved in the regulation of plant drought tolerance. This method provides direct and effective evidence for the verification of gene function.

[0034] II. Reliability of physiological parameter evaluation Transpiration rate: The transpiration rate is an important indicator to measure the water loss of plants. Under drought stress, if Hv14- 3-3A the transpiration rate of the plants significantly decreases after the gene is silenced, it indicates that the gene may be involved in regulating the stomatal opening and closing or water transport process of the plants, thus affecting drought tolerance.

[0035] CO2 assimilation rate: The CO2 assimilation rate reflects the photosynthetic ability of plants. Under drought stress, if Hv14- 3-3A gene silencing leads to a decrease in the CO2 assimilation rate, it indicates that the gene may be related to the photosynthesis or energy metabolism of plants, and thus affects plant drought tolerance.

[0036] Relative leaf water content: The relative leaf water content is a direct indicator to measure the water status in plants. Under drought stress, if Hv14-3-3A the relative leaf water content of the plants remains at a high level after gene silencing, it indicates that the gene may be involved in regulating the water retention or absorption process of the plants, contributing to improving plant drought tolerance.

[0037] III. Application value in scientific research and agricultural production Scientific research: This method provides a powerful tool for in-depth study of the mechanism of plant drought tolerance. By comparing the physiological responses of plants under drought stress before and after gene silencing, the specific Hv14-3-3A pathways and molecular mechanisms of gene regulation in drought tolerance can be revealed.

[0038] Agricultural production: This method has potential application value in agricultural production. If it is confirmed that Hv14-3-3A the gene is a key gene for plant drought tolerance, then this gene can be introduced into other crops by genetic engineering means, thereby improving the drought tolerance of crops and providing strong support for agricultural production in arid regions.

[0039] In summary, by using gene silencing technology to inhibit the expression of plant Hv14-3-3A genes and observing the changes in physiological parameters of plants after gene silencing under drought stress, this method not only helps to clarify gene functions, but also has the reliability of physiological parameter evaluation and application value in scientific research and agricultural production.

[0040] As a preferred technical solution, the inhibition of the expression of plant Hv14-3-3A genes by gene silencing technology includes: Step 1, obtain the complete sequence of Hv14-3-3A the gene. Specifically, use the PFAM database (PF00244) and NCBI GeneBank to screen and align the Hv14-3-3A gene to obtain the complete sequence.

[0041] Step 2, obtain the vectors of the α, β, and γ RNA strands of the plant stripe mosaic virus BSMV (from the research group of Professor Wufei Bo of Zhejiang University).

[0042] Step 3, perform in vitro transcription on the vectors of the α, β, and γ RNA strands of BSMV respectively to obtain RNAα, RNAβ, and RNAγ molecules.

[0043] Step 4, ligate a partial fragment of the Hv14-3-3A gene into the RNAγ vector of BSMV to obtain the RNAγ:14-3-3A vector.

[0044] Step 5, mix equal amounts of RNAγ and RNAγ:14-3-3A with RNAα and RNAβ respectively to obtain a mixture of RNAα, RNAβ, and RNAγ and a mixture of RNAα, RNAβ, and RNAγ:14-3-3A.

[0045] Step 6, use the friction inoculation method to infect the leaves of two groups of plants with the mixture of RNAα, RNAβ, and RNAγ and the mixture of RNAα, RNAβ, and RNAγ:14-3-3A respectively. The silencingHv14-3-3A The plants with the Hv14-3-3A gene silenced were set as the experimental group, and the plants without

[0046] gene silencing were set as the control group. As a preferred technical solution, the plant is a gramineous crop, preferably barley, rice or wheat. In this application, the plant materials selected were wild barley from Tibet (drought-sensitive: XZ54, XZ147; drought-tolerant: XZ141) and cultivated barley (drought-tolerant: Tadmor; drought-sensitive: ZJU9; moderately drought-tolerant: GP).

[0047] In this application, the second leaf at the three-leaf stage of barley was selected for friction inoculation. After inoculation, the plants were placed in a barley growth chamber (22°C / 18°C, day / night) and kept moist by regularly spraying DEPC water. Ten days after inoculation, when the control group (PDS) showed an albino phenotype, drought treatment was started. After the drought treatment was completed, the corresponding physiological indexes were measured, and the expression of the target gene was verified by fluorescence quantitative PCR (qRT-PCR).

[0048] As a preferred technical solution, a partial fragment of the Hv14-3-3A gene was ligated into the RNAγ vector of BSMV to obtain the RNAγ:14-3-3A vector, including: Step 1: Extract the RNA of barley using the RN38-EASYspin Plus (Aidlab) kit, and reverse transcribe the RNA of H barley into cDNA using the qScript cDNA Synthesis Kit (Takara, Japan).

[0049] Step 2: Amplify the cDNA fragment of the Hv14-3-3A gene using primers with restriction enzyme sites to obtain the Hv14-3-3A gene fragment, and clone it into the pTOPO vector (Aidlab) for the next step of sequencing.

[0050] Step 3: Linearize the vector by digesting with restriction enzymes MluI (RNAα, RNAγ) and SpeI (RNAβ); Step 4: Detect the obtained Hv14-3-3A gene fragment using agarose gel electrophoresis, and recover and purify the Hv14-3- 3A gene fragment.

[0051] Step 5: Extract the plasmid DNA of the BSMV RNA γ vector, digest the γ vector with the restriction enzyme NheI (NEB) to generate a linearized vector fragment, and recover and purify the linearized vector fragment.

[0052] Step 6: Recover and purify the Hv14-3-3AThe gene fragment and the recovered and purified linearized vector fragment are digested with the same restriction endonuclease to ensure that they have the same sticky ends, and the target gene fragment is ligated with the vector fragment to form a recombinant vector.

[0053] Step 7, Use the γ-stain-F primer and the forward primer of the target gene to verify the reverse insertion and perform sequencing.

[0054] In this application, in a RNase-free environment, use the RiboMAX™ Large Scale RNA Production System-T7 kit and the Ribo m7G Cap Analog kit for in vitro transcription. The in vitro transcription product will show an additional band of 1500 bp or 2000 bp in gel electrophoresis.

[0055] As a preferred technical solution, the determination by physiological parameter changes Hv14-3-3A The regulatory effect of the gene on drought tolerance also includes verification by qRT-PCR method Hv14-3-3A The silencing efficiency of the gene, including: Step 1, Sample the plant leaves treated with drought for 0 days and 10 days respectively, collect the samples of the largest functional leaves, immediately freeze them in liquid nitrogen, and then store them at -80°C. Use a plant RNA extraction kit (Aidlab, RN38EASYspin Plus) to extract the total plant RNA; Step 2, Use the qScript cDNA Synthesis Kit (Takara) to reverse transcribe the obtained total plant RNA into cDNA; Step 3, Use SYBR Green PCR Master Mix (Aidlab) and QuantStudio 6 (ABI) to perform qRT-PCR experiments. Select the HvActin gene as the internal reference, perform several biological replicates for each treatment group, and calculate the gene expression level by the 2 −ΔΔCt method.

[0056] As a preferred technical solution, the inhibition of plants by gene silencing technology Hv14-3-3A The expression of the gene also includes Hv14-3-3A The subcellular localization of the gene, including: Step 1, Use the Nimble Cloning kit (NC Biotech) to Hv14-3-3A Clone the gene into the GFP vector, transform the plant leaves for subcellular localization, and observe its distribution in the cells through a fluorescence microscope; Step 2, Use the Nimble Cloning kit (NC Biotech) toHv14-3-3 The gene was cloned into the pNC-Green-SubN vector. After ensuring the correctness of the cloning results, plasmid extraction was performed, and the bacterial solution with correct sequencing was stored (15% glycerol). Step 3: Through the Agrobacterium-mediated method, plant transformation and subcellular localization detection were carried out.

[0057] As a preferred technical solution, the Agrobacterium-mediated method for tobacco transformation and subcellular localization detection includes: Step 1: Inoculate the monoclonal Agrobacterium of interest into a liquid LB medium containing kanamycin and rifampicin, culture overnight, and resuspend after centrifugation to OD600 = 0.8. Step 2: Mix two kinds of Agrobacterium and inject them in a volume ratio of 1:1. Step 3: Select fully expanded plant leaves (about 4 weeks old), and inject the mixture of the two kinds of Agrobacterium from the back of the leaves. Each bacterial solution is injected into 3 - 5 plant leaves. Step 4: Culture in the dark in a moisturized environment for 2 - 3 days, and then sample and observe.

[0058] As a preferred technical solution, select seeds with consistent germination, sow them in small pots filled with nutrient soil (substrate: vermiculite = 3:1), grow in a plant growth chamber, set the light cycle of the plant growth chamber to 16 hours of light and 8 hours of darkness, the temperature is 25°C, and the relative humidity is 60%. When the plant seedlings grow to the three-leaf stage, start the water-deficient drought treatment, with the plants watered normally as the control.

[0059] The growth status photos of the plant experimental group and the control group are as Figure 3 shown. Barley plants inoculated with BSMV:Hv14-3-3A showed more drought-induced damage than plants inoculated with the empty vector, indicating that Hv14-3-3A it is related to the drought tolerance of barley.

[0060] Figure 3 Shows the phenotype of barley in response to drought after gene silencing. Bar phenotype = 5 cm.

[0061] Figure 4 Shows the phenotypic characteristics of wild barley XZ141 leaves after gene HvPDS silencing by BSMV-VIGS..

[0062] Figure 5 Shows the relative expression level of Hv14-3-3A in the leaves of XZ141. The expression level of BSMV:γ (control) plants was set to 1.0. The values are the averages of three biological replicates. Different letters indicate significant differences (P < 0.05).

[0063] Figure 6 Stomatal density of BSMV:γ and BSMV:Hv14-3-3A barley seedlings under drought stress for one week is shown.

[0064] Figure 7 Changes in physiological parameters of BSMV:γ and BSMV:Hv14-3-3A barley seedlings in response to drought are shown. Photosynthetic parameters include CO2 assimilation rate (A), leaf transpiration rate (E), intercellular CO2 concentration (Ci), stomatal conductance (g s ), vapor pressure deficit (VPD), and intrinsic water use efficiency (iWUE). Physiological parameters were measured after one week of drought, and the values are the means of three independent biological replicates. Different letters represent significant differences (P<0.05).

[0065] It is concluded from Figure 7 that barley plants inoculated with BSMV:Hv14-3-3A showed more drought-induced damage than those inoculated with the empty vector, indicating that Hv14-3-3A is related to the drought tolerance of barley. In the XZ141 material, silencing Hv14-3-3A significantly reduced the CO2 assimilation rate (A), leaf transpiration rate (E), and stomatal conductance (g s ) of plants under drought conditions, while the decreases in A, E, and g s of plants inoculated with the control BSMV:γ were smaller.

[0066] In addition, it is concluded from Figure 6 that under drought stress, compared with the control, silencing Hv14-3-3A significantly increased the stomatal density on the leaf epidermis of barley by 17%, resulting in an increase in drought sensitivity. After silencing the Hv14-3-3A gene in different barley genotypes, the changes in photosynthetic parameters under drought stress were slightly different. Overall, Hv14-3-3A silencing significantly reduced A and g s in barley leaves, resulting in the sensitivity of barley seedlings to drought.

[0067] This application also provides a use of the Hv14-3-3A gene, and the use is: regulating the stomatal conductance, photosynthesis efficiency, and water use efficiency of plants, thereby enhancing the tolerance of plants under drought conditions.

[0068] This application also provides a genetic engineering method for enhancing the drought tolerance of plants, including: obtaining target plant materials; introducing the Hv14-3-3A gene into the target plant materials; screening and obtaining transgenic plants expressing the barley Hv14-3-3A gene; and measuring the drought tolerance of the transgenic plants under drought stress.

[0069] Hv14-3-3A Gene Sequence Listing: >HORVU.MOREX.r2.4HG0301490.1.mrna1-F ATGGAGGAGAGGGGGAAGGTGGTGTGCATGGCGAAGCTGGCCGAGCAGGCGGAGAGATACGATGATATGGTGGATTTTATGAAGAAGCTTGCTAGGATGGATGTGGATATGAGTGCTGAAGAGAGGCATTTATTTTCAGTCGGTTTTAAGAATACAATTGGTGCAAGGAGGGCATCATGGAGAATCCTTTCTTCACTTGAGCAAAAGGTGACAAAGGGTGAGCAGGCTGGCCAGATGATAAGTGTCTACAGAAAGAGAGTTGAGGATGAACTAAGGATGGTTTGCAATGAAATATTGTCAATCATCGCTATTCATTGCCTTCCCTTGGCTAATACGGGTGAAAACGTTGTGTTCTTTTATAAAATGAAAGGTGACTACTACCGTTACCTGGCCGAATTTAGCACTGGAACTGAAAAGAAGTCTGCGGCTGACCAATCACTCATGGCCTATCAGCATGCCATGGTTGTCGCCTCCACTGAGCTTTCACCTGCTCATCCAGTCAGGCTTGGTCTTGCACTCAATTTCTCAGTGTTCTTTTATGAGATAATGAACTGTCATCAGAGAGCTTGCCAAGTTGCAAGACAAGCATTTGATGAGGCTACTACTGAGATTAATTCCGCTGGTATGGACGGCCACAACGATAGCACACTAATGATGCAGCTTCTGAACGACAACCTAGCATTGTGGAAGTCAGAACTAACTGAAGGTGAAACCTCGAAGGACAGCGACATCGATATGGAG The above Hv14-3-3F gene sequence corresponds to sequence ID Number 1 in the sequence listing; >HORVU.MOREX.r2.2HG0143420.1.mrna1-C ATGTCGGCACCAGGGGAGCTTTCCCGTGAGGAGAATGTGTACATGGCTAAGCTCGCCGAGCAGGCTGAGAGGTACGAGGAGATGGTTGAGTTCATGGAGAAGGTGGCCAAGACCGTCGACTCCGAGGAACTCACTGTGGAGGAGCGCAACCTCCTCTCTGTTGCATACAAGAATGTGATTGGAGCCCGCCGTGCCTCATGGCGCATCATCTCCTCCATTGAACAGAAGGAGGAGAGCCGTGGCAACGAGGACCGGGTCACACTCATCAAGGAATACCGTGGCAAGATCGAAACTGAGCTTAGCAAGATATGTGATGGCATTCTCAAGCTGCTTGAAACCCACCTTGTTCCGTCTTCCACTGCCCCTGAGTCCAAGGTCTTCTATCTTAAGATGAAGGGTGACTACTACAGGTATCTTGCGGAATTCAAGAGTGGGCCTGAGAGGAAGGATGCTGCTGAGAATACCATGGTGGCATACAAGGCTGCTCAGGATATTGCTTTGGCTGAGCTGGCTCCAACACATCCGATTAGGCTTGGGCTGGCACTAAACTTCTCAGTGTTCTATTATGAGATCCTCAACTCGCCTGATCGTGCTTGCAATCTTGCAAAGCAGGCATTCGATGAGGCCATTTCGGAGCTGGACACACTAAGCGAAGAATCCTACAAGGACAGCACCTTGATCATGCAACTCCTTCGTGATAACTTGACCCTCTGGACTTCCGACATCACGGAGGACACCGCGGAGGAGGAGATCAGGGAGGCTCCGAAGCATGACTCGAGCGAGGGGCAGTAA The above Hv14-3-3C gene sequence corresponds to sequence ID Number 2 in the sequence listing; >HORVU.MOREX.r2.4HG0281090.1.mrna1-A ATGTCTACCGCTGAGGCAACCCGTGAGGAGAATGTGTACATGGCCAAGCTCGCTGAGCAGGCTGAGCGTTACGAGGAAATGGTCGAATTCATGGAGAAGGTTGCAAAGACCGCTGATGTCGGTGAGCTCACTGTTGAGGAGCGCAACCTGCTGTCTGTGGCTTACAAGAATGTGATTGGTGCCCGGAGGGCATCCTGGAGGATCATCTCCTCCATTGAGCAGAAGGAGGAGAGCCGTGGGAACGAGGCCTATGTCGCTTCGATCAAGGAGTACCGTACCAGGATTGAAACTGAGCTCAGCAAGATCTGCGATGGCATCCTCAAGCTTCTGGACTCCCACCTCGTCCCCTCTGCCACTGCAGCAGAGTCCAAGGTGTTCTATCTGAAAATGAAGGGTGATTACCACAGGTACCTTGCGGAGTTCAAGGCCGGTGCTGAGAGGAAAGAAGCAGCTGAGAACACTCTTGTTGCGTACAAGTCAGCCCAGGACATTGCTCTTGCTGACTTGCCTACCACTCACCCGATTAGGCTTGGGCTTGCACTCAACTTCTCAGTGTTCTACTATGAAATCCTGAACTCTCCAGACCGTGCTTGCAACCTTGCCAAGCAGGCATTTGATGAAGCTATTGCTGAGCTGGACTCCCTCGGCGAGGAATCCTACAAGGACAGCACCTTGATCATGCAACTTCTTCGTGACAACTTGACCCTCTGGACCTCCGATAACGCAGAGGAGGGTGGTGATGAGATCAAGGAAGCTGCCTCAAAGCCTGAGGGAGAGGGGCACTGA The above Hv14-3-3A gene sequence corresponds to sequence ID Number 3 in the sequence listing; >HORVU.MOREX.r2.4HG0311100.1.mrna1-E ATGTCGCCGGCGGAGCCGACGCGAGACGAGAGCGTCTACATGGCGAAGCTTGCGGAGCAGGCCGAGCGCTACGAGGAGATGGTCGAGTTCATGGAGCGCGTGGCCAAGGCCACCGGCGGGGCAGGGCCCGGGGAGGAGCTATCCGTGGAGGAGCGCAACCTGCTCTCTGTGGCTTACAAGAACGTCATCGGGGCCCGGCGCGCGTCCTGGAGGATTATCTCCTCAATCGAGCAGAAGGAGGAAGGTCGGGGCAACGAGGCGCACGCCGCCACCATCCGCTCCTACCGCACCAAGATCGAGGCCGAGCTCGCAAAGATCTGCGACGGCATCCTCGCGCTGCTCGATTCCCATCTCGTGCCATCCGCCGGAGCCGCCGAGTCCAAAGTCTTCTATCTGAAGATGAAGGGCGACTACCACAGGTACCTTGCAGAGTTTAAGTCTGGTGCGGAGAGGAAGGAAGCCGCCGAGAGCACCATGAATGCGTACAAAGCTGCTCAGGATATCGCTCTAGCAGATTTGGCGCCAACCCACCCCATCAGGCTTGGGCTTGCACTCAACTTCTCTGTGTTCTACTATGAGATCTTGAACTCCCCTGACCGCGCCTGCAACCTTGCAAAACAGGCCTTTGATGAGGCTATATCAGAGCTGGACAGCTTAGGCGAGGAATCCTACAAGGATAGCACTTTAATCATGCAGCTCCTACGTGACAATTTGACTCTATGGACATCCGACACCAATGAGGATGACGTTGATGAGATAAAGGAAGCCCCAGCTCCAAAAGAATCGGGAGACGGGCAGTGA The above Hv14-3-3E gene sequence corresponds to sequence ID Number 4 in the sequence listing; >HORVU.MOREX.r2.7HG0574300.1.mrna1-D ATGGCAGCGGCAGCGGGAACGAGGGAGGAGATGGTCTACATGGCGAAGCTGGCGGAGCAGGCCGAGCGGTACGAGGAGATGGTCGAGTTCATGGAGAGGGTCGTGGCAGCGACGGGGACCGGCGAGCTCAGCGTCGAGGAGAGGAACCTGCTTTCAGTAGCGTACAAGAACGTCATCGGGGCGCGTCGTGCTTCCTGGCGCATCGTGTCCTCCATCGAGCAGAAGGAGGAAGGGCGCGGAGCTGCGGGGCACGCCGCCGCGGCGCGCGGGTACCGCGCACGTGTCGAGGCCGAACTCTCCAACATCTGCGCGGGGATCCTCCGTCTCCTCGACGAACGCCTAGTCCCCGCCGCCGCCGCCGTCGATGCCAAGGTATTCTACCTGAAGATGAAGGGAGACTACCACCGCTACCTCGCGGAGTTCAAGTCGGCCGCCGAGCGCAAGGATGCCGCCGACTCCACCCTCGGTGCCTACCAGGCCGCTCAGGACATAGCCATGAAGGAGCTGCCACCGACTCACCCCATCAGGCTGGGCCTCGCGCTCAACTTCTCTGTGTTCTACTACGAGATCCTCAACTCGCCTGATCGCGCGTGCTCGCTCGCCAAGCAGGCTTTCGATGAAGCCATTGCTGAGCTGGATTCCCTCGGGGAAGATTCCTACAAGGACAGCACCCTGATCATGCAACTTCTCCGTGACAATCTCACCTTGTGGACCTCTGATATGCAGGATGACGCTGGCGATGAAACGAGGGATTCAAGCAAGCCTGAGGATGAGCAGTAG The above Hv14-3-3D gene sequence corresponds to sequence ID Number 5 in the sequence listing; >HORVU.MOREX.r2.3HG0189120.1.mrna1-B ATGGCGCAGCCTGCTGAGCTTTCCCGTGAGGAGAATGTGTACATGGCTAAGCTTGCAGAGCAGGCTGAGAGGTACGAGGAGATGGTTGAGTTCATGGAGAAGGTGGCCAAGACGGTTGACTCCGAGGAGCTCACCGTCGAAGAGCGCAACCTTCTATCAGTTGCTTACAAGAATGTTATTGGTGCCCGCCGTGCCTCGTGGCGCATCATTTCCTCCATCGAGCAGAAGGAAGAGAGCCGTGGCAACGAGGACCGTGTCACACTCATCAAGGACTACCGTGGAAAGATTGAAGTTGAGCTCACTAAGATTTGTGATGGTATCCTCAAGCTTCTTGATTCCCACCTTGTCCCCTCATCTACCGCTCCAGAGTCCAAGGTCTTCTACCTGAAGATGAAGGGTGATTACTACAGGTACCTTGCAGAGTTCAAGAGTGGAACTGAGAGGAAGGATGCTGCTGAGAACACCATGGTGGCATACAAAGCTGCTCAGGAGATTGCACTGGCAGAGCTGCCCCCGACTCATCCTATTAGGCTTGGGCTGGCACTCAACTTCTCGGTGTTCTACTATGAGATCCTCAACTCTCCTGACCGTGCTTGCGACCTCGCCAAGCAGGCTTTTGACGAGGCCATCTCGGAATTGGACTCACTGAGCGAGGAGTCCTACAAGGACAGCACTTTGATCATGCAGCTTCTCCGTGATAACCTGACGCTGTGGACTTCCGACATCTCGGAGGACGCCGCTGAAGAAATGAAGGATGCTCCCAAGGGTGAATCTGGAGATGGACAGTAA The above Hv14-3-3B gene sequence corresponds to sequence ID Number 6 in the sequence listing.

[0070] It should be noted that the terms "first", "second" and similar terms used in the description and claims of this application do not denote any order, quantity or importance, but are merely used to distinguish different components. Similarly, terms such as "a" or "an" do not denote a quantity limitation, but rather indicate the presence of at least one. "Multiple" or "several" means at least two. Unless otherwise indicated, terms such as "front", "rear", "left", "right", "lower" and / or "upper" are for convenience only and are not limited to a single position or a spatial orientation. The terms "comprising" or "including" and similar terms are intended to mean that the elements or items appearing before "comprising" or "including" cover the elements or items listed after "comprising" or "including" and their equivalents, and do not exclude other elements or items. The terms "connected" or "coupled" and similar terms are not limited to physical or mechanical connections, and may include electrical connections, whether direct or indirect.

[0071] The singular forms "a", "the" and "said" used in the description and appended claims of this application are also intended to include the plural forms, unless the context clearly dictates otherwise. It should also be understood that the term "and / or" as used herein refers to and encompasses any and all possible combinations of one or more of the associated listed items.

[0072] It should be understood that those of ordinary skill in the art can make improvements or modifications based on the above description, and all such improvements and modifications shall fall within the scope of protection of the appended claims of this application.

Claims

1. A method for determining the drought tolerance efficacy of the Hv14-3-3A gene, characterized in that, The method for determining the drought tolerance efficacy of the Hv14-3-3A gene in plants includes: Inhibiting the expression of plant Hv14-3-3A genes by gene silencing technology; Applying drought stress to the plants after gene silencing; Determination by physiological parameter changes Hv14-3-3A The regulatory effect of genes on drought tolerance, wherein the physiological parameters include at least one of plant transpiration rate, CO2 assimilation rate, and relative water content of leaves.

2. The method for determining the drought tolerance efficacy of the Hv14-3-3A gene in plants according to claim 1, characterized in that, The suppression of the expression of a plant Hv14-3-3A gene by gene silencing technology includes: Obtain Hv14-3-3A the complete sequence of the gene; Obtaining vectors of the α, β, and γ RNA strands of the plant stripe mosaic virus BSMV; Performing in vitro transcription on the vectors of the α, β, and γ RNA strands of BSMV respectively to obtain RNAα, RNAβ, and RNAγ molecules; Inserting a partial fragment of the Hv14-3-3A gene into the BSMV RNAγ vector to obtain RNAγ:14-3-3A; Mixing equal amounts of RNAγ molecules and RNAγ:14-3-3A with RNAα and RNAβ respectively to obtain a mixture of RNAα, RNAβ, and RNAγ molecules and a mixture of RNAα, RNAβ, and RNAγ:14-3-3A; Using the friction inoculation method to infect the mixtures of RNAα, RNAβ, and RNAγ and RNAα, RNAβ, and RNAγ:14-3-3A into two groups of plant leaves respectively.

3. The method for determining the drought tolerance efficacy of the Hv14-3-3A gene in plants according to claim 2, wherein The RNAγ vector of BSMV is inserted Hv14-3-3A After inserting the fragment of the gene, in vitro transcription is carried out to obtain RNAγ:14-3-3A, including: Extracting the RNA of the plants and reverse transcribing the RNA of the plants into cDNA; Amplification Hv14-3-3A the cDNA fragment of the gene to obtain Hv14-3-3A the gene fragment The obtained Hv14-3-3A gene fragments were detected by agarose gel electrophoresis and recovered and purified Hv14-3-3A gene fragments; Extracting the plasmid DNA of the BSMV RNAγ vector, digesting the γ vector with a restriction enzyme to produce a linearized vector fragment, and recovering and purifying the linearized vector fragment; For recycling and purification Hv14-3-3A Perform the same restriction enzyme digestion on the recycled and purified gene fragment and the recycled and purified linearized vector fragment to ensure that they have the same sticky ends, and ligate the target gene fragment and the vector fragment to form a recombinant vector.

4. The method for determining the drought tolerance efficacy of the Hv14-3-3A gene in plants according to claim 2, characterized in that, The determination by physiological parameter changes Hv14-3-3A The regulatory effect of the gene on drought tolerance also includes verification by qRT-PCR method Hv14-3-3A The silencing efficiency of the gene, including: Sampling the plant leaves treated with drought for 0 days and 10 days respectively, collecting the samples of the largest functional leaves, immediately freezing them in liquid nitrogen, then storing them at -80°C, and extracting the total plant RNA; Reverse transcribing the obtained total plant RNA into cDNA; Perform qRT-PCR experiments and select HvActin genes as internal references. Conduct several biological replicates for each treatment group and calculate the gene expression levels by the -ΔΔCt method.

5. The method for determining the drought tolerance efficacy of the Hv14-3-3A gene in plants according to claim 1 or 2, characterized in that The suppression of the expression of a plant gene by gene silencing technology also includes Hv14-3-3A the subcellular localization of the gene, including: Hv14-3-3A ​ Clone the Hv14-3-3A gene into the GFP vector, transform plant leaves for subcellular localization, and observe its distribution in cells through a fluorescence microscope; Clone the Hv14-3-3A gene into the pNC-Green-SubN vector. After ensuring the correctness of the cloning result, extract the plasmid and store the bacterial solution with correct sequencing results. Performing plant transformation and subcellular localization detection by the Agrobacterium-mediated method.

6. The method for determining the drought tolerance efficacy of the Hv14-3-3A gene in plants according to claim 5, wherein The method for performing tobacco transformation and subcellular localization detection by the Agrobacterium-mediated method includes: Inoculating a single clone of the target Agrobacterium into a liquid LB medium containing kanamycin and rifampicin, culturing overnight, and resuspending it to OD600 = 0.8 after centrifugation; Mixing two Agrobacteriums and injecting them in a volume ratio of 1:1; Selecting fully expanded plant leaves and injecting the mixture of the two Agrobacteriums from the back of the leaves, injecting 3 - 5 plant leaves with each bacterial solution; Culturing in a moisturized environment in the dark for 2 - 3 days, and then sampling and observing.

7. The method for determining the drought tolerance efficacy of the Hv14-3-3A gene in plants according to claim 1, wherein The photoperiod in the plant growth chamber is set to 16 hours of light and 8 hours of darkness, the temperature is 25°C, and the relative humidity is 60%; When the plant seedlings grow to the three-leaf stage, start the water-deficient drought treatment, with the plants watered normally as the control.

8. The method for determining the drought tolerance efficacy of the Hv14-3-3A gene in plants according to claim 1, wherein The plant is a gramineous crop, preferably barley, rice or wheat.

9. Hv14-3-3A Use of a gene, wherein the use is to regulate the stomatal conductance, photosynthesis efficiency and water use efficiency of a plant, so as to enhance the tolerance of the plant under drought conditions.

10. A genetic engineering method for enhancing plant drought tolerance, characterized in that, Including: Obtaining the target plant materials; Introduce Hv14-3-3A the gene into the target plant material; Screening to obtain transgenic plants expressing barley Hv14-3-3A genes; Determine the drought tolerance of transgenic plants under drought stress.

Images