Application of circular RNA as gastric cancer biomarker and therapeutic target

By detecting the expression amount of circular RNA circ-0055521 and using its siRNA inhibitor, the problem of diagnosis and treatment of gastric cancer is solved, and efficient diagnosis and treatment of gastric cancer is achieved.

CN120400344APending Publication Date: 2025-08-01JIANGSU UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510612145.5
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-05-13
Publication Date
2025-08-01

AI Technical Summary

Technical Problem

The lack of effective gastric cancer diagnostic biomarkers and therapeutic targets in the prior art leads to poor therapeutic effects on gastric cancer, especially in the advanced or advanced stages of the loss of surgical opportunities, with a 5-year overall survival rate of less than 30%.

Method used

Gastric cancer is diagnosed by detecting its expression level using circular RNA circ-0055521 as a biomarker, and siRNA inhibitors targeting circular RNA such as si-circ-0055521-1 and si-circ-0055521-2 are used to inhibit gastric cancer cell proliferation, migration, invasion and promote apoptosis.

Benefits of technology

The expression of circ-0055521 can effectively diagnose gastric cancer, with good specificity and sensitivity. After siRNA transfection, it significantly inhibits the proliferation, migration and invasion of gastric cancer cells, promotes apoptosis, and provides new therapeutic targets.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120400344A_ABST
    Figure CN120400344A_ABST
Patent Text Reader

Abstract

The invention belongs to the technical field of biological medicine, and particularly relates to application of circular RNA as a gastric cancer biomarker and a treatment target. The invention provides application of circular RNA (Ribonucleic Acid) as a biomarker in preparation of a product for diagnosing gastric cancer. The circular RNA is circ-0055521 and can positively regulate and control the development of the gastric cancer, and compared with para-carcinoma tissues and healthy people, the circ-0055521 is highly expressed in gastric cancer tissues and serum of patients. By inhibiting expression of circ-0055521, malignant processes such as in-vitro and in-vivo cell proliferation, clone formation, migration, invasion and the like of gastric cancer can be remarkably inhibited, and cell apoptosis is promoted. The invention provides a new target for diagnosis and treatment of gastric cancer, and has a wide application prospect in clinical treatment of gastric cancer.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the technical field of biomedicine, and specifically relates to the application of circular RNA as a biomarker and therapeutic target for gastric cancer. Background Art

[0002] Gastric cancer (GC) is a common malignant tumor of the digestive tract and ranks among the top in terms of incidence among various malignant tumors. Gastric cancer is characterized by late staging, high recurrence and metastasis rates, and poor prognosis, seriously threatening the life and health of patients. The traditional treatment methods for gastric cancer mainly include surgical treatment, supplemented by chemotherapy, targeted therapy, etc. However, due to its insidious onset and unclear symptoms, patients often have reached the advanced or late stage when seeking medical treatment, losing the opportunity for surgery, and the 5-year overall survival rate is less than 30%. In recent years, the application of targeted therapy and immunotherapy has significantly improved the survival period of some patients. However, the high heterogeneity of gastric cancer remains the core reason for treatment failure and has a great impact on the quality of life of patients. Therefore, in clinical treatment, there is an urgent need to find new diagnostic biomarkers and therapeutic targets for gastric cancer.

[0003] Circular RNA (circRNA) is a unique non-coding RNA with a closed circular structure generated by back-splicing. circRNA can act as a microRNA (miRNA) sponge, interact with proteins and translation templates, regulate gene expression and signal transduction, and thus participate in the occurrence and development of various malignant tumors. Compared with traditional linear RNA, circRNA lacks a 3' poly(A) tail and a 5' cap structure, forms a closed loop in the form of a covalent bond, and is insensitive to exonucleases. Due to its conservativeness, stability and tissue specificity, circRNA has been reported to be used as a diagnostic indicator and therapeutic target for certain tumors, but its mechanism of action in gastric cancer remains to be further explored, and there is currently no report on its use as a molecular target for precision treatment to achieve the prevention and treatment of gastric cancer. Summary of the Invention

[0004] The purpose of the present invention is to provide the application of circular RNA as a biomarker and therapeutic target for gastric cancer, and the circular RNA positively regulates the occurrence and development of gastric cancer and can be used as a biomarker and therapeutic target for gastric cancer.

[0005] The present invention provides the application of circular RNA as a biomarker in the preparation of a product for diagnosing gastric cancer; the nucleotide sequence of the circular RNA is as shown in SEQ ID NO.1.

[0006] As a preferred embodiment, the circular RNA positively regulates the occurrence and / or development of gastric cancer.

[0007] As a preferred embodiment, the product includes a primer pair for detecting the circular RNA.

[0008] As a preferred embodiment, the primer pair includes a forward primer with a nucleotide sequence shown in SEQ ID NO.2 and a reverse primer with a nucleotide sequence shown in SEQ ID NO.3.

[0009] The present invention also provides the use of a circular RNA as a therapeutic target in the preparation of a drug for preventing and / or treating gastric cancer; the nucleotide sequence of the circular RNA is shown in SEQ ID NO.1.

[0010] As a preferred embodiment, the drug includes an expression inhibitor of the circular RNA.

[0011] As a preferred embodiment, the expression inhibitor includes siRNA targeting the circular RNA.

[0012] As a preferred embodiment, the siRNA includes si-circ-0055521-1 and / or si-circ-0055521-2; si-circ-0055521-1 consists of a sense strand with a nucleotide sequence shown in SEQ ID NO.4 and an antisense strand with a nucleotide sequence shown in SEQ ID NO.5; si-circ-0055521-2 consists of a sense strand with a nucleotide sequence shown in SEQ ID NO.6 and an antisense strand with a nucleotide sequence shown in SEQ ID NO.7.

[0013] As a preferred embodiment, the effects of the drug include at least one of the following: 1) inhibiting the proliferation of gastric cancer cells; 2) inhibiting the migration of gastric cancer cells; 3) inhibiting the invasion of gastric cancer cells; 4) promoting the apoptosis of gastric cancer cells.

[0014] As a preferred embodiment, the gastric cancer cells include MKN-45 and / or HGC-27.

[0015] Beneficial effects: The present invention provides the use of a circular RNA as a biomarker in the preparation of a product for diagnosing gastric cancer; the nucleotide sequence of the circular RNA is as shown in SEQ ID NO.1. The circular RNA of the present invention is circ-0055521, and the structure of circ-0055521 is stable. Verified by clinical samples, compared with adjacent tissues, the expression level of circ-0055521 in gastric cancer tissues is significantly increased; compared with the control group of healthy people, the expression level of circ-0055521 in the serum of gastric cancer patients is also higher. It shows that gastric cancer can be effectively diagnosed by the expression level of circ-0055521, which has good specificity and sensitivity and meets the criteria for being a biomarker. In addition, the proliferation rate, plate cloning, migration and invasion abilities of gastric cancer cells transfected with small interfering RNA (siRNA) of circ-0055521 are much lower than those of the control group, and it can promote the apoptosis of gastric cancer cells. Knocking down circ-0055521 can inhibit the proliferation and metastasis of gastric cancer cells in vitro, providing a new target for the treatment of gastric cancer. Brief Description of the Drawings

[0016] In order to more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required for use in the embodiments.

[0017] Figure 1 Schematic diagram of the expression level of circ-0055521 in gastric cancer; among them, A shows the expression levels of circ-0055521 in human gastric mucosal epithelial cells GES-1 and gastric cancer cells MKN-45, HGC-27; B shows the expression levels of circ-0055521 in gastric cancer tissues and their paired adjacent tissues; ** in the figure indicates p < 0.01; *** indicates p < 0.001;

[0018] Figure 2 Expression diagram and ROC curve of circ-0055521 in the serum of gastric cancer patients; among them, A shows the expression levels of circ-0055521 in the sera of gastric cancer patients and normal physical examination subjects, and *** in the figure indicates p < 0.001; B is the ROC curve diagram of circ-0055521 in the sera of gastric cancer patients;

[0019] Figure 3 Knockdown efficiency diagram of different circ-0055521 small interfering RNAs; among them, A is MKN-45 cells; B is HGC-27 cells; ** in the figure indicates p < 0.01; *** indicates p < 0.001;

[0020] Figure 4Schematic diagram of CCK8 results after transfection with different circ-0055521 small interfering RNAs; among them, A is MKN-45 cells; B is HGC-27 cells; *** in the figure indicates p < 0.001; **** indicates p < 0.0001;

[0021] Figure 5 Schematic diagram of EdU results after transfection with different circ-0055521 small interfering RNAs; among them, A is the fluorescence photograph of EdU; B is the statistical chart of the proportion of EdU-positive cells; **** in the figure indicates p < 0.0001;

[0022] Figure 6 Schematic diagram of colony formation results; among them, A is the microscopic photograph of colony formation; B is the statistical chart of the number of cloned cells; * in the figure indicates p < 0.05, ** indicates p < 0.01;

[0023] Figure 7 Schematic diagram of migration results; among them, A is the microscopic photograph of migration; B is the statistical chart of the number of migrated cells; ** in the figure indicates p < 0.01, **** indicates p < 0.0001;

[0024] Figure 8 Schematic diagram of invasion results; among them, A is the microscopic photograph of invasion; B is the statistical chart of the number of invaded cells; ** in the figure indicates p < 0.01; *** indicates p < 0.001;

[0025] Figure 9 Schematic diagram of apoptosis results; among them, A is the flow cytometry diagram of apoptosis; B is the statistical chart of the proportion of apoptotic cells; **** in the figure indicates p < 0.0001. Detailed implementation method

[0026] The present invention provides an application of a circular RNA as a biomarker in the preparation of a product for diagnosing gastric cancer; the nucleotide sequence of the circular RNA is shown as SEQ ID NO.1: 5′-GAAUCCUACGGC CCCUGAAUAUUUUGGCAUCUUCAACCUACCGCAACUGUGUCAAGAAUGCCUCUCUUAUUUCUGCAUUGUCCACUGGACGUUUUAGUCAUAUUCAGACACCAGUUGUUUCCUCCACUCCCAGACUUACCACAUCUGAGAGAAACCUGACAUGUGGGCAUACCUCAGUGAUCCUUAAUAGAAUGGCCCCCGUGCUUCCAAGUGUCCUGAAGCUGCCAGUCAGAUCUCUAACAUACUUCAGUGCAAGAAAAGGCAAGAGAAAGACCGUGAAAGCUGUCAUCGAUAGGUUUCUUCGACUUCAUUGUGGCCUUUGGGUGAGGAGAAAG-3′.

[0027] As an embodiment, the circular RNA positively regulates the occurrence and / or development of gastric cancer. The circular RNA of the present invention is circ-0055521, and circ-0055521 is significantly differentially expressed in gastric cancer and adjacent tissues, and shows up-regulated expression. Verified by qRT-PCR using clinical samples, compared with adjacent tissues, the expression level of circ-0055521 in gastric cancer tissues is significantly increased; compared with normal controls, the expression level of circ-0055521 in the sera of gastric cancer patients is also higher. This indicates that the detection of the expression level of circular RNA circ-0055521 can effectively diagnose gastric cancer, with good specificity and sensitivity, meeting the criteria for a biomarker, and can be used for the preparation of reagents or kits for diagnosing gastric cancer.

[0028] As an embodiment, the product includes a primer pair for detecting the circular RNA. As an embodiment, the primer pair includes a forward primer with a nucleotide sequence shown as SEQ ID NO.2 and a reverse primer with a nucleotide sequence shown as SEQ ID NO.3. As an embodiment, the product of the present invention further includes an internal reference gene detection primer. In a specific embodiment of the present invention, the internal reference gene is β-actin; the internal reference gene detection primer includes a forward primer with a nucleotide sequence shown as SEQ ID NO.8 and a reverse primer with a nucleotide sequence shown as SEQ ID NO.9.

[0029] As an implementation mode, the primer pair of the present invention realizes accurate characterization of the expression level of circ-0055521 through qPCR detection; as another implementation mode, the product further includes a reaction buffer for qPCR detection and / or reverse transcription reagents. The present invention has no special limitation on the sources of the reaction buffer for qPCR detection and / or reverse transcription reagents, and the well-known reaction buffer for qPCR detection and / or reverse transcription reagents in the art can be used. In a specific embodiment of the present invention, both the reaction buffer for qPCR detection and the reverse transcription reagents are purchased from Nanjing Novozymes Biotech Co., Ltd.

[0030] The present invention also provides an application of a circular RNA as a therapeutic target in the preparation of a drug for preventing and / or treating gastric cancer; the nucleotide sequence of the circular RNA is as shown in SEQ ID NO.1. The circular RNA (circ-0055521) of the present invention positively regulates the occurrence and / or development of gastric cancer. The expression level of circular RNA circ-0055521 in gastric cancer tissues is significantly up-regulated. By transgenic means to inhibit the expression of circ-0055521, the occurrence and development of gastric cancer can be effectively inhibited, and it can be used as a therapeutic target for gastric cancer.

[0031] As an implementation mode, the drug includes an expression inhibitor of the circular RNA. As an implementation mode, the expression inhibitor includes siRNA targeting the circular RNA. As another implementation mode, the siRNA includes si-circ-0055521-1 and / or si-circ-0055521-2; si-circ-0055521-1 is composed of a sense strand with a nucleotide sequence as shown in SEQ ID NO.4 and an antisense strand with a nucleotide sequence as shown in SEQ ID NO.5; si-circ-0055521-2 is composed of a sense strand with a nucleotide sequence as shown in SEQ ID NO.6 and an antisense strand with a nucleotide sequence as shown in SEQ ID NO.7. The siRNA targeting circ-0055521 of the present invention has a relatively high targeting knockdown efficiency, which is beneficial to inhibiting the expression of circ-0055521 in gastric cancer cells, thereby improving the drug treatment effect.

[0032] As an implementation mode, the functions of the drug include at least one of the following: 1) inhibiting the proliferation of gastric cancer cells; 2) inhibiting the migration of gastric cancer cells; 3) inhibiting the invasion of gastric cancer cells; 4) promoting the apoptosis of gastric cancer cells.

[0033] As an implementation mode, the gastric cancer cells include MKN-45 and / or HGC-27. In the embodiments of the present invention, it has been verified at the cell level that inhibiting the expression of circ-0055521 has an inhibitory effect on the proliferation, migration, and invasion of gastric cancer cells, and at the same time can promote the apoptosis of gastric cancer cells.

[0034] To further illustrate the present invention, the technical solutions provided by the present invention will be described in detail below in conjunction with the accompanying drawings and embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0035] Expression of circ-0055521 in human gastric mucosal epithelial cells and gastric cancer cells in Example 1

[0036] (1) Extract cell RNA

[0037] A. Respectively take human gastric mucosal epithelial cells GES-1 and gastric cancer cells HGC-27 and MKN-45 with good growth conditions, wash them 2 times with PBS, and discard the supernatant.

[0038] B. Add 1 mL of TRIzol lysate and let it stand at 4°C for 10 min.

[0039] C. Add 200 μL of chloroform solution to each tube, vortex and mix well, and let it stand at 4°C for 5 min.

[0040] D. Centrifuge at 4°C and 11200 rpm for 15 min, carefully aspirate 600 μL of the upper aqueous phase containing RNA into a new EP tube, and try to avoid aspirating the white middle layer and the lower red organic phase as much as possible.

[0041] E. Add an equal volume of isopropanol solution to each tube, gently mix the mixture in the tube several times, and let it stand at 4°C for 10 min.

[0042] F. Centrifuge at 4°C and 11200 rpm for 10 min, discard the supernatant in small amounts and multiple times, and avoid aspirating the RNA precipitate at the bottom of the tube.

[0043] G. Add 1 mL of 75% anhydrous ethanol freshly prepared with DEPC water, gently wash the RNA precipitate; centrifuge at 4°C and 11200 rpm for 5 min, carefully aspirate and discard the supernatant, and let it dry naturally at room temperature. When the RNA precipitate becomes semi-transparent, add an appropriate amount of DEPC water to resuspend the precipitate.

[0044] H. After dissolving overnight at 4°C, pipette and mix well. Take 1 μL of DEPC water as a blank control, aspirate 1 μL of the sample to be tested, and detect the RNA concentration and purity on a NanoDrop spectrophotometer, and store it at -80°C for a long time.

[0045] (2) Reverse transcription

[0046] A. Remove genomic DNA: Prepare the mixture shown in Table 1 in an RNase-free EP tube on ice; gently pipette and mix well; react at 42°C for 2 min.

[0047] Table 1 Reverse transcription reaction system 1

[0048] <![CDATA[RNase-free ddH2O]]> Make up to 10 μL 5× gDNAwiper Mix 2 μL Total RNA 1 μg

[0049] B. Prepare the cDNA synthesis reaction solution according to Table 2, heat it at 37°C for 15 min after preparation, and heat it at 85°C for 5 s.

[0050] Table 2 Reverse transcription reaction system 2

[0051] The mixture from the previous step 10 μL 10× RT Mix 2 μL HiScript Enzyme Mix 2 μL Oligo(dT) 1 μL Random hexamers 1 μL <![CDATA[RNase-free ddH2O]]> 4 μL

[0052] (3) qPCR

[0053] A. Prepare the following mixture in the qPCR tube according to Table 3:

[0054] Table 3 Preparation of qPCR system

[0055] 2× AceQ Universal SYBR qPCR Master Mix 10 μL Forward primer (10 μM) 0.4 μL Reverse primer (10 μM) 0.4 μL cDNA 2 μL <![CDATA[RNase-free ddH2O]]> 7.2 μL

[0056] B. Perform qPCR to detect the relative expression level of circ-0055521 using β-actin as the internal reference gene; the primers for circ-0055521 are shown as SEQ ID NO.2 and SEQ ID NO.3; the primers for β-actin are shown as SEQ ID NO.8 and SEQ ID NO.9:

[0057] circ-0055521-F (SEQ ID NO.2): 5′-AGGAGAAAGGAATCCTACGGC-3′;

[0058] circ-0055521-R (SEQ ID NO.3): 5′-TGTGGTAAGTCTGGGAGTGG-3′;

[0059] β-actin-F (SEQ ID NO.8): 5′-CACGAAACTACCTTCAACTCC-3′;

[0060] β-actin-R (SEQ ID NO.9): 5′-CATACTCCTGCTTGCTGATC-3′.

[0061] The qPCR amplification procedure: ① Pre-denature at 95°C for 5 min; ② Denature at 95°C for 10 s; ③ Anneal and extend at 57°C for 30 s; steps ② - ③ are repeated 40 cycles; ⑤ Finally, set the melting curve acquisition program as 95°C for 15 s, 60°C for 60 s, 95°C for 15 s. The detection results are as shown in Figure 1 A and Table 4.

[0062] Table 4 Relative expression levels of circ-0055521 in each group

[0063] Group GES-1 HGC-27 MKN-45 Expression level 1.00 2.31 1.67

[0064] According to Figure 1 A and Table 4 in, compared with human gastric mucosa epithelial cell line GES-1, circ-0055521 is highly expressed in gastric cancer cell lines.

[0065] Example 2 Expression of circ-0055521 in gastric cancer clinical tissues and adjacent tissues

[0066] (1) Extract RNA from 35 samples of gastric cancer tissues and adjacent tissues. The tissue samples are gastric cancer and adjacent tissues collected from a hospital in Nantong, Jiangsu Province from June 2019 to March 2024, and verify whether circ-0055521 is highly expressed in gastric cancer tissues.

[0067] A. Take out the frozen gastric cancer tissues and adjacent tissue samples from the -80 °C refrigerator and place them on ice to thaw.

[0068] B. After the tissues are thawed, take 15 mg of tissue and put it into a 1.5 mL RNase-free EP tube, and add 200 μL of Trizol lysate to each tube.

[0069] C. Grind the tissue blocks as thoroughly as possible on ice with a tissue grinder, grind for 15 s each time, let it stand on ice for 45 s, repeat the operation 5 times, and then supplement Trizol lysate to 1 mL in each EP tube. After mixing well, let it stand at 4 °C for 10 min.

[0070] D. The subsequent operations are carried out according to the operations of steps (1) C-H in Example 1.

[0071] (2) Reverse transcription is carried out according to the operation in step (2) of Example 1.

[0072] (3) qPCR is carried out according to the operation in step (3) of Example 1.

[0073] The detection results are as shown in Figure 1 B and Table 5 in. Compared with adjacent tissues (normal tissues), circ-0055521 is highly expressed in gastric cancer tissues.

[0074] Table 5 Mean relative expression levels of circ-0055521 in gastric cancer tissues and adjacent tissues

[0075] Group Pericancerous tissue (normal tissue) Gastric cancer tissue Mean expression level -0.21 1.19

[0076] Example 3 Expression of circ-0055521 in the sera of gastric cancer patients and normal physical examination subjects

[0077] (1) Additionally, RNA was extracted from the sera of 25 gastric cancer patients and 25 normal subjects undergoing physical examinations. The serum samples were from gastric cancer patients and normal subjects undergoing physical examinations collected from a certain hospital in Nantong, Jiangsu Province from January 2021 to July 2024, and were used to verify the expression of circ-0055521. The sera of gastric cancer patients in this example and the 35 gastric cancer tissues in Example 2 were from different gastric cancer patients. The RNA in the samples was extracted using a BIOG free RNA extraction kit (purchased from Changzhou BioDai Biotechnology Co., Ltd.). The specific operation was as follows:

[0078] A. Take 200 μL of serum sample and place it in a 1.5 mL RNase-free EP tube. Add 4 μL of RNA Carrier and mix well. Then add 200 μL of lysis buffer and 20 μL of digestion buffer, and mix by oscillation. Incubate in a water bath at 65 °C for 10 min.

[0079] B. Add 900 μL of absolute ethanol, mix well and transfer to an adsorption column. Centrifuge at 4 °C and 12,000 rpm for 1 min, and discard the waste liquid.

[0080] C. Add 500 μL of Wash Buffer A containing 30% absolute ethanol, let stand for 2 min, centrifuge at 4 °C and 12,000 rpm for 1 min, and discard the waste liquid.

[0081] D. Add 500 μL of Wash Buffer B containing 70% absolute ethanol, centrifuge at 4 °C and 12,000 rpm for 1 min, discard the waste liquid, and then centrifuge for 3 min.

[0082] E. Take out the adsorption column and place it in a new EP tube. Add preheated elution buffer, let stand for 2 min, centrifuge at 4 °C and 12,000 rpm for 2 min, collect the RNA solution and detect its concentration and purity, and directly use it for the next experiment or store it at -80 °C.

[0083] (2) Reverse transcription was carried out according to the operation in step (2) of Example 1.

[0084] (3) qPCR was carried out according to the operation in step (3) of Example 1, and the ROC curve was used to evaluate the sensitivity and specificity of circ-0055521 in diagnosing gastric cancer. The detection results are as Figure 2 and shown in Table 6.

[0085] Table 6 Mean relative expression levels of circ-0055521 in sera of gastric cancer patients and healthy individuals

[0086]

[0087]

[0088] According to Figure 2As shown in Table 6, compared with healthy people, circ-0055521 was highly expressed in the serum of gastric cancer patients. In terms of diagnostic efficacy, the AUC of circ-0055521 reached 0.806, and the sensitivity reached 76%, indicating that it could be used as a biomarker for gastric cancer diagnosis.

[0089] Example 5

[0090] (1) Synthesis of SiRNA

[0091] Two small interfering RNAs, si-circ-0055521-1 and si-circ-0055521-2, were designed and synthesized for circ-0055521, denoted as si-1 and si-2 respectively, and a small interfering RNA control group (si-NC) was designed. The nucleotide sequences of the SiRNAs are as follows:

[0092] si-1-S (SEQ ID NO.4): 5′-CGAUAGGUUUCUUCGACUU-3′;

[0093] si-1-AS (SEQ ID NO.5): 5′-AAGUCGAAGAAACCUAUCG-3′;

[0094] si-2-S (SEQ ID NO.6): 5′-GGUAGAGUCUAUUUCAAUA-3′;

[0095] Si-2-AS (SEQ ID NO.7): 5′-UAUUGAAAUAGACUCUACC-3′;

[0096] si-NC-S (SEQ ID NO.10): 5′-UUCUCCGAACGUGUCACGU-3′;

[0097] si-NC-AS (SEQ ID NO.11): 5′-ACGUGACACGUUCGGAGAA-3′.

[0098] Meanwhile, TT overhang series were added to the ends of the sense and antisense strands of si-1, si-2 and Si-NC to form sticky ends, which could enhance the stability of siRNA, promote binding to the target sequence, improve ligation efficiency, facilitate screening and identification, and promote cell uptake.

[0099] (2) Cell transfection

[0100] A. Gastric cancer cells HGC-27 and MKN-45 with good growth conditions were respectively taken and inoculated into 6-well plates 18 h before transfection, so that the cell confluence before transfection reached 30% - 50%.

[0101] B. Take 5 μL of 20 nM siRNA and add it to an EP tube containing 250 μL of medium. Gently mix well.

[0102] C. Take 5 μL of Lipofectamine TM2000 transfection reagent and add it to another EP tube containing 250 μL of medium. Gently mix well and incubate at room temperature for 5 min.

[0103] D. Mix the liquids in steps B and C, incubate at room temperature for 20 min, add the mixture to the 6-well plate in step A, supplement the medium to 2 mL, and perform transfection in an incubator. Remove the mixture 4 - 6 h later and add 2 mL of complete medium.

[0104] E. Trypsinize the cells after culturing for 48 h and proceed with subsequent experiments.

[0105] (3) Determination of transfection efficiency

[0106] A. Wash the cells in step (2) with pre-cooled PBS. After discarding the PBS, add 1 mL of Trizol lysis solution and pipette to mix. Collect the pipetted solution into a 1.5 mL RNase-free EP tube. Place the processed centrifuge tube in a 4°C refrigerator and let it stand for 10 min.

[0107] B. After standing, add 200 μL of chloroform to each tube and mix. Shake it by hand 15 times to fully mix the chloroform and Trizol, and then place it in the refrigerator or ice box and let it stand for 5 min.

[0108] C. Centrifuge at 12,000 g for 15 min at 4°C. Carefully aspirate the upper aqueous phase into a new EP tube, add an equal volume of pre-cooled isopropanol, invert the tube up and down to mix well, and let it stand at room temperature for 10 min.

[0109] D. Centrifuge at 12,000 g for 10 min at 4°C. A white flocculent precipitate can be seen at the bottom of the tube. Carefully discard the supernatant, add 1 mL of 75% ethanol (prepared with DEPC water), and wash the precipitate thoroughly.

[0110] E. Centrifuge at 12,000 g for 5 min at 4°C. Try to discard as much ethanol as possible. Dry the precipitate in an open environment in a clean area for 2 - 5 min. When the precipitate becomes a semi-transparent thin film, add an appropriate amount of DEPC water to fully dissolve the RNA.

[0111] F. Reverse transcription is carried out according to the operation in step (2) of Example 1, and qPCR is carried out according to the operation in step (3) of Example 1. The detection results are as Figure 3 and shown in Table 7.

[0112] Table 7 Detection results of circ-0055521 expression level

[0113] Group MNK-45 HGC-27 si-NC 1.00 1.00 si-circ-0055521-1 0.38 0.42 si-circ-0055521-2 0.47 0.64

[0114] According to Figure 3 and Table 7, it can be seen that the knockdown efficiencies of si-circ-0055521-1 and si-circ-0055521-2 are relatively good.

[0115] Example 6 Effects of inhibiting circ-0055521 expression on the proliferation, migration, invasion, and apoptosis of gastric cancer cells

[0116] (1) Cell transfection was carried out according to the operation in Example 5.

[0117] (2) CCK8 proliferation assay

[0118] A. The transfected cells were digested and counted, and the cells in each group were prepared into a cell suspension of 5×10 4 cells / mL. 100 μL was pipetted into a 96-well plate and cultured in an incubator at 37°C.

[0119] B. After the cells adhered, a mixture of 90 μL of complete medium and 10 μL of CCK8 reagent was added, and after incubation for 2 h, the absorbance value was measured at 450 nm using an enzyme-linked immunosorbent assay (ELISA) reader.

[0120] C. Four replicate wells were set for each group of cells, and the OD values of the cells were detected at 0, 24, 48, 72, and 96 h. The detection results are as Figure 4 shown in Table 8.

[0121] Table 8 Detection results of cell OD values

[0122]

[0123]

[0124] According to Figure 4 and Table 8, it can be seen that the proliferation ability of gastric cancer cells transfected with si-circ-0055521-1 and si-circ-0055521-2 is much lower than that of the control group.

[0125] (3) EdU proliferation assay

[0126] A. The transfected cells were digested and counted, and the cells in each group were prepared into a cell suspension of 2×10 5 cells / mL. 100 μL of the cell suspension was added to each well (96-well plate) and incubated overnight in an incubator at 37°C.

[0127] B. When the confluence reached about 70% on the second day, 1× EdU working solution was added to each well and incubated in an incubator at 37°C for 5 h to ensure that EdU was fully incorporated into the newly synthesized DNA.

[0128] C. Fixed with 4% paraformaldehyde for 15 min, washed 3 times with PBS containing 3% BSA, permeabilized with PBS containing 0.3% Triton X-100, incubated with the reaction solution for 30 min, and washed 2 times.

[0129] D. After washing, add Hoechst and incubate in the dark at room temperature for 30 min. Observe the Hoechst and EdU staining conditions under a fluorescence microscope and take pictures. The cells with blue-stained nuclei are the total number of cells, and the cells with red-stained nuclei are EdU-positive cells, that is, proliferating cells. Count the number of positive cells and the total number of cells in 3 fields of view per well, take the average value, and calculate the proportion of EdU-positive cells according to formula ①. The test results are as Figure 5 shown in Table 9.

[0130] Proportion of EdU-positive cells (%) = number of positive cells / total number of cells × 100% ①.

[0131] Table 9 Proportion of EdU-positive cells

[0132] Group MNK-45 HGC-27 si-NC 48.57% 54.73% si-circ-0055521-1 25.27% 23.84% si-circ-0055521-2 30.68% 36.30%

[0133] According to Figure 5 and Table 9, the proliferation ability of gastric cancer cells transfected with si-circ-0055521-1 and si-circ-0055521-2 is much lower than that of the control group.

[0134] (4) Colony formation

[0135] A. Digest and count the transfected cells, inoculate 1000 cells per well into a 6-well plate containing 2 mL of complete medium.

[0136] B. Incubate in a cell culture incubator for 8 - 10 days, and change the medium once every 2 - 3 days.

[0137] C. When cell colonies are visible to the naked eye, discard the medium, wash with PBS, add 1 mL of 4% paraformaldehyde to fix for 30 min and then discard, add 1 mL of crystal violet staining solution to stain for 15 min. Remove the staining solution, rinse with running water until no purple staining solution drips, and air dry.

[0138] D. Take pictures and count the number of cell colonies per well. The test results are as Figure 6 shown in Table 10.

[0139] Table 10 Number of cell colonies

[0140] Group MNK-45 HGC-27 si-NC 260 275 si-circ-0055521-1 132 122 si-circ-0055521-2 144 172

[0141] According to Figure 6As shown in Table 10, the colony formation of gastric cancer cells transfected with si-circ-0055521-1 and si-circ-0055521-2 was much lower than that of the control group.

[0142] (4) Transwell migration assay

[0143] A. Trypsinize the transfected cells, resuspend the cells in basal medium and count them. Adjust the cell density to 2.5×10 5 cells / mL, and take 200 μL and add it to the Tranwell chamber.

[0144] B. Place the Tranwell chamber in a 24-well plate containing 600 μL of complete medium and culture it in a cell incubator for 24 h.

[0145] C. Discard the medium and wash with PBS. Add 1 mL of 4% paraformaldehyde to fix for 30 min, then discard it. Add 1 mL of crystal violet staining solution to stain for 15 min.

[0146] D. Carefully wipe off the non-migrated cells with a cotton swab, take pictures under a microscope, and count the number of migrated cells. The detection results are as Figure 7 shown in Table 11.

[0147] Table 11 Number of migrated cells

[0148] Group MNK-45 HGC-27 si-NC 188 81 si-circ-0055521-1 61 37 si-circ-0055521-2 81 41

[0149] According to Figure 7 and Table 11, the migration ability of gastric cancer cells transfected with si-circ-0055521-1 and si-circ-0055521-2 was lower than that of the control group.

[0150] (5) Matrigel invasion assay

[0151] A. One day before the experiment, take out the Matrigel matrix glue from -20 °C and put it in the 4 °C refrigerator overnight to melt it from a solid state to a liquid state.

[0152] B. Prepare 20% Matrigel matrix glue on ice, take 50 μL and spread it evenly on the upper layer of the chamber, and place it at 37 °C for 30 min until the matrix glue solidifies.

[0153] C. Trypsinize the transfected cells, resuspend the cells in basal medium and count them. Adjust the cell density to 5×10 5 cells / mL, and take 200 μL and add it to the Tranwell chamber.

[0154] D. Place the Tranwell chamber in a 24-well plate containing 600 μL of complete medium and culture it in a cell incubator for 48 h.

[0155] E. After the culture was completed, the culture medium was discarded and the cells were washed with PBS. 1 mL of 4% paraformaldehyde was added to fix the cells for 30 min and then discarded. 1 mL of crystal violet staining solution was added to stain the cells for 15 min.

[0156] F. The non-invasive cells were carefully wiped off with a cotton swab, photographed under a microscope, and the number of invasive cells was counted. The detection results are as Figure 8 shown in and Table 12.

[0157] Table 12 Number of invasive cells

[0158] Group MNK-45 HGC-27 si-NC 197 76 si-circ-0055521-1 65 47 si-circ-0055521-2 87 50

[0159] According to Figure 8 and Table 12, the invasion ability of gastric cancer cells transfected with si-circ-0055521-1 and si-circ-0055521-2 was lower than that of the control group.

[0160] (6) Cell apoptosis assay

[0161] A. The transfected cells were digested with trypsin without EDTA.

[0162] B. After washing the cells twice with ice-cold PBS, 1× binding buffer was added and the cell concentration was adjusted to 1×10 6 cells / mL.

[0163] C. 100 μL of the cell suspension was taken into a flow tube, 10 μL of propidium iodide (20 μg / mL) and 5 μL of Annexin Alexa Fluor 647 were added, and the mixture was vortexed.

[0164] D. Incubate at room temperature in the dark for 15 min, add 400 μL of PBS, and detect with a flow cytometer. The proportion of apoptotic cells was counted. The results are as Figure 9 shown in and Table 13.

[0165] Table 13 Proportion of apoptotic cells

[0166] Group MNK-45 HGC-27 si-NC 4.83% 7.10% si-circ-0055521-1 21.06% 27.01% si-circ-0055521-2 20.13% 22.62%

[0167] According to Figure 9 and Table 13, the apoptosis ability of gastric cancer cells transfected with si-circ-0055521-1 and si-circ-0055521-2 was higher than that of the control group.

[0168] In summary, the proliferation rate, plate cloning, migration and invasion abilities of gastric cancer cells transfected with si-circ-0055521-1 and si-circ-0055521-2 were much lower than those of the control group. Moreover, the results of flow cytometry showed that knockdown of circ-0055521 promoted cell apoptosis. The above results indicate that knockdown of circ-0055521 can inhibit the proliferation and metastasis of gastric cancer cells in vitro, promote cell apoptosis, and provide a new target for the treatment of gastric cancer.

[0169] Although the above embodiments have described the present invention in detail, they are only a part of the embodiments of the present invention, rather than all embodiments. People can also obtain other embodiments based on these embodiments without creative efforts, and these embodiments all fall within the protection scope of the present invention.

Claims

1. Use of a circular RNA as a biomarker in the preparation of a product for diagnosing gastric cancer; the nucleotide sequence of the circular RNA is as shown in SEQ ID NO.

1.

2. The application according to claim 1, characterized in that, The circular RNA positively regulates the occurrence and / or development of gastric cancer.

3. The application according to claim 1, characterized in that, The product includes a primer pair for detecting the circular RNA.

4. The application according to claim 3, wherein The primer pair includes a forward primer with a nucleotide sequence as shown in SEQ ID NO.2 and a reverse primer with a nucleotide sequence as shown in SEQ ID NO.

3.

5. Use of a circular RNA as a therapeutic target in the preparation of a drug for preventing and / or treating gastric cancer; the nucleotide sequence of the circular RNA is as shown in SEQ ID NO.

1.

6. The application according to claim 5, characterized in that, The drug includes an expression inhibitor of the circular RNA.

7. The application according to claim 6, wherein The expression inhibitor includes siRNA targeting the circular RNA.

8. The application according to claim 7, wherein The siRNA includes si-circ-0055521-1 and / or si-circ-0055521-2; si-circ-0055521-1 is composed of a sense strand with a nucleotide sequence as shown in SEQ ID NO.4 and an antisense strand with a nucleotide sequence as shown in SEQ ID NO.5; si-circ-0055521-2 is composed of a sense strand with a nucleotide sequence as shown in SEQ ID NO.6 and an antisense strand with a nucleotide sequence as shown in SEQ ID NO.

7.

9. The application according to any one of claims 5 to 8, characterized in that, The effects of the drug include at least one of the following: 1) inhibiting the proliferation of gastric cancer cells; 2) inhibiting the migration of gastric cancer cells; 3) inhibiting the invasion of gastric cancer cells; 4) promoting the apoptosis of gastric cancer cells.

10. The application according to claim 9, characterized in that, The gastric cancer cells include MKN-45 and / or HGC-27.