Genetic structure variation at upstream of GHR gene and application thereof

Abstract

The invention provides a genetic structure variation at the upstream of a GHR gene and application of the genetic structure variation. Specifically, the invention provides a structural variation molecular marker related to duck growth and development, the structural variation molecular marker is located at the upstream 80kb of a GHR gene on a chromosome ChrZ, and the nucleotide sequence of the structural variation molecular marker is as shown in SEQ ID NO: 1. The structural variation molecular marker can regulate and control the expression of the GHR gene so as to regulate and control the growth and development of ducks, provides a theoretical basis and a genetic basis for breeding or cultivating duck varieties with excellent growth traits, and is beneficial to improving the breeding efficiency and accelerating the duck breeding process.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology. Specifically, the present invention relates to a genetic structural variation upstream of the GHR gene and its application. Background Art

[0002] China is one of the countries with the richest waterfowl genetic resources in the world. The waterfowl genetic resources are not only numerous in quantity, but also diverse in germplasm characteristics. Based on the different characteristics of local breeds, some specialized breeds have been cultivated. In traditional breeding, seeds are usually selected based on phenotypic traits determined by individual measurement, sib measurement or progeny measurement. However, traditional breeding methods cannot perform early seed selection, which increases the generation interval and reduces the selection response.

[0003] Molecular markers are developed based on polymorphic motifs within functional genes that cause phenotypic trait variations. Once the genetic effect is localized to a specific functional motif, functional markers developed based on this correlation can determine the presence or absence of the target gene in different genetic backgrounds without further verification, and reflect the performance of the target trait. Therefore, the target gene can be accurately detected and tracked, and its genetic effect value has universality and high reliability, which is effective for both artificial breeding populations and natural populations. Currently, there is still a lack of molecular markers that can be used for early seed selection.

[0004] Traditional breeding methods have problems of low efficiency and too long cycle. The rapid development of duck genomics and molecular biology technologies has brought new opportunities for the improvement of its production efficiency. Exploring and verifying candidate genes and molecular markers related to important economic traits of ducks using genomics and molecular biology technologies can not only improve breeding efficiency, shorten the breeding cycle, but also enhance the economic benefits of duck production.

[0005] Therefore, developing a breeding strategy based on molecular markers is of great significance for accelerating the cultivation of excellent duck local breeds with good production performance and improving the economic efficiency of the duck farming industry. Summary of the Invention

[0006] The present invention aims to solve at least one of the technical problems existing in the prior art to some extent. The present invention provides a structural variation (SV) molecular marker related to the growth and development of ducks. This structural variation molecular marker can effectively regulate the expression of the GHR gene, and thus has a regulatory effect on the growth and development of ducks. Therefore, this molecular marker provides a theoretical basis and genetic foundation for breeding or cultivating duck breeds with excellent growth traits, which is beneficial to improving breeding efficiency and accelerating the duck breeding process.

[0007] Therefore, in the first aspect of the present invention, the present invention provides a structural variant molecular marker related to duck growth and development. According to an embodiment of the present invention, the structural variant molecular marker is located 80 kb upstream of the GHR gene on chromosome ChrZ, and the structural variant molecular marker has a nucleotide sequence as shown in SEQ ID NO:1. Through a large number of experiments, the inventors found that the structural variant molecular marker of the present invention can regulate the expression of the GHR gene, and the GHR gene can regulate growth and development through the JAK-STAT signal, thereby regulating the growth rate and meat quality of ducks. Therefore, by identifying the type of this molecular marker present in the duck genome, the growth and development status of ducks can be judged through molecular screening at an early stage, and early selection and breeding of duck individuals can be carried out. While reducing the breeding cost, the growth traits can be improved, and the breeding process of ducks can be accelerated.

[0008] In the second aspect of the present invention, the present invention provides a primer pair for amplifying the structural variant molecular marker described in the first aspect. According to an embodiment of the present invention, the primer pair includes an upstream primer and a downstream primer. The sequence of the upstream primer is as shown in SEQ ID NO:2, and the sequence of the downstream primer is as shown in SEQ ID NO:3. Using the primer pair of the present invention for amplification experiments can specifically amplify the structural variant molecular marker described in the first aspect. Therefore, using this primer pair, the genomic DNA of the duck to be tested can be amplified, and based on the amplified product, the duck to be tested with the sequence of SEQ ID NO:1 can be selected for breeding or cultivation, which speeds up the duck breeding process.

[0009] In the third aspect of the present invention, the present invention provides a kit. According to an embodiment of the present invention, the kit includes the primer pair described in the second aspect. The kit provided by the present invention can quickly, simply, and conveniently perform PCR amplification on the genomic DNA of ducks to obtain molecular markers, and select the duck to be tested with the sequence of SEQ ID NO:1 for breeding or cultivation according to the sequence of the molecular marker, which speeds up the duck breeding process.

[0010] In the fourth aspect of the present invention, the structural variant molecular marker described in the first aspect, the primer pair described in the second aspect, or the kit described in the third aspect has at least one of the following uses: for predicting or assisting in predicting the growth and development phenotype of ducks; for screening or assisting in screening duck individuals, duck lines, or duck breeds with fast growth and development; for determining or assisting in determining duck lines or duck breeds.

[0011] In the fifth aspect of the present invention, a method for evaluating the growth and development of ducks is proposed. According to an embodiment of the present invention, the method includes: using the genomic DNA of the duck to be tested as a template, performing PCR amplification with the primer pair described in the second aspect, and comparing the amplification result with the structural variation molecular marker described in the first aspect; based on the comparison result, determining the growth and development status of the duck to be tested. As described above, the structural variation molecular marker of the present invention can regulate the expression of the GHR gene, and the GHR gene can regulate the growth and development of ducks. Therefore, by using the method of the present invention, the growth and development status of the duck to be tested can be evaluated quickly and simply, thereby improving the breeding efficiency and accelerating the duck breeding process.

[0012] In the sixth aspect of the present invention, a method for duck breeding is proposed. According to an embodiment of the present invention, the method includes: using the genomic DNA of the duck to be tested as a template, performing PCR amplification with the primer pair described in the second aspect, and comparing the amplification result with the structural variation molecular marker described in the first aspect; selecting the duck to be tested with the sequence shown in SEQ ID NO: 1 for breeding or cultivation. As described above, the structural variation molecular marker of the present invention can regulate the expression of the GHR gene, and the GHR gene can regulate the growth and development of ducks. Therefore, by using the method of the present invention, the duck to be tested with excellent growth traits and economic traits can be quickly and simply screened for breeding, thereby improving the breeding efficiency and accelerating the duck breeding process.

[0013] In the seventh aspect of the present invention, the use of the structural variation molecular marker described in the first aspect, the primer pair described in the second aspect, the kit described in the third aspect, the method for evaluating the growth and development of ducks described in the fourth aspect, or the method for duck breeding described in the fifth aspect in assisted breeding is proposed.

[0014] In the eighth aspect of the present invention, a method for cultivating a duck breed is proposed. According to an embodiment of the present invention, the method includes: using gene editing technology to insert the structural variation molecular marker described in the first aspect into the upstream 80 kb of the GHR gene on chromosome ChrZ of the duck to be cultivated. The structural variation molecular marker of the present invention can regulate the expression of the GHR gene, and the GHR gene can regulate the growth and development of ducks. Therefore, by this method, a duck breed with relatively excellent growth traits and economic traits can be cultivated, which is beneficial to improving the breeding efficiency and accelerating the duck breeding process.

[0015] In a ninth aspect of the present invention, the present invention provides a method for determining duck breeds. According to an embodiment of the present invention, the method includes: using the genomic DNA of the duck to be tested as a template, performing PCR amplification with the primer pair described in the second aspect, and comparing the amplification result with the structural variation molecular marker described in the first aspect; based on the comparison result, determining the breed of the duck to be tested. The structural variation molecular marker of the present invention mainly exists in domesticated ducks, and this structural variation molecular marker can cause a decrease in the expression level of the duck GHR gene. Therefore, by using the method of the present invention, the breed of the duck to be tested can be determined quickly and simply, thereby improving the breeding efficiency and accelerating the duck breeding process.

[0016] Additional aspects and advantages of the present invention will be given in part in the following description, become apparent in part from the following description, or be learned through the practice of the present invention. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] The above and / or additional aspects and advantages of the present invention will become apparent and be readily understood from the description of the embodiments in conjunction with the following drawings, in which:

[0018] The above and / or additional aspects and advantages of the present invention will become apparent and be readily understood from the description of the embodiments in conjunction with the following drawings, in which:

[0019] Figure 1 is a distribution diagram of the genetic differentiation index (FST value) of structural variation among five population groups according to an embodiment of the present invention;

[0020] Figure 2 is a grouping diagram of dividing 185 duck samples into 15 combinations according to an embodiment of the present invention (sub-pre is the abbreviation of subcutaneous preadipocyte, representing subcutaneous fat pre-cells; sebum represents sebum; liver represents liver; breast-muscle represents pectoralis major muscle; brain represents brain);

[0021] Figure 3 is a gene expression map of the downstream genes adjacent to highly differentiated structural variations (SVs) according to an embodiment of the present invention; among them, from left to right in the figure are: the normalized FPKM values of genes in different samples; the P values of 15 pairs of RNA-seq data sets between Pekin ducks or domestic ducks and mallards;

[0022] Figure 4 is the relative position of the structural variation molecular marker and its adjacent genes according to an embodiment of the present invention;

[0023] Figure 5 is the expression of the GHR gene in different tissues of Pekin ducks (Pekin) and mallards (MA) according to an embodiment of the present invention;

[0024] Figure 6 It is a result diagram of gel electrophoresis of PCR products of Pekin ducks and mallard ducks (MA) according to an embodiment of the present invention;

[0025] Figure 7 It is a result diagram of a dual-luciferase reporter experiment on structural variation in DF-1 cells according to an embodiment of the present invention. The data are expressed as mean ± standard deviation, showing the activity difference between the Pekin allele (SV) and the Mallard allele (non-SV) at these four SV sites. *** The p value < 0.001. Detailed implementation manners

[0026] Embodiments of the present invention will be described in detail below. The following described embodiments are exemplary and are only used to explain the present invention and should not be construed as a limitation to the present invention.

[0027] It should be noted that the terms "first" and "second" are only used for descriptive purposes and should not be construed as indicating or implying relative importance or implicitly specifying the quantity of the indicated technical features. Thus, features defined with "first" and "second" may explicitly or implicitly include one or more of such features. Further, in the description of the present invention, unless otherwise specified, the meaning of "plurality" is two or more.

[0028] Detailed description of the present invention

[0029] Definitions and general terms

[0030] To make the present invention easier to understand, certain technical and scientific terms are specifically defined below. Unless otherwise clearly defined elsewhere in this document, all other technical and scientific terms used herein have the meanings commonly understood by those of ordinary skill in the art to which the present invention pertains.

[0031] In this document, the term "comprising" or "including" is an open expression, that is, it includes the content specified by the present invention, but does not exclude other aspects.

[0032] In this document, the terms "optionally", "optional" or "option" generally mean that the subsequent event or condition may or may not occur, and this description includes the case where the event or condition occurs and the case where the event or condition does not occur.

[0033] In this document, the term "domestic" refers to domesticated ducks or domesticated ducks, simply referred to as domestic ducks, which may specifically include Pekin ducks, Shaoxing ducks and other local breed ducks.

[0034] In this document, the term "MA" is Mallard, referring to mallard ducks.

[0035] In this article, the term "IND" refers to indigenous ducks, which may specifically include Shaoxing ducks or other local breed ducks.

[0036] In this article, "Pekin" refers to Pekin ducks.

[0037] Structural variations (SVs), also known as genetic structural variations, are variations in the structure of biological chromosomes, which are composed of various variations in the genome of a species, usually including deletions, duplications, copy number variations, insertions, inversions, and translocations, etc. Research has shown that genomic structural variations are related to individual phenotypic variations and the occurrence of diseases. Structural variations (SVs) are widely present in animal genomes. Wanhong Li et al (Liwanhong.et al, 2015) used PCR technology to detect the inhibin α-subunit gene fragment in the genomic DNA of Large White pigs and found that there was a 283bp structural variation in the inhibin α-subunit gene. When the 283bp was present, it would increase the risk of follicular cysts in sows. The structural variations of genes can regulate the production traits and disease resistance of livestock and poultry. For example, there is a 110kb fragment deletion in the MIMT1 gene that causes bovine abortion and stillbirth, a 450kb replicative insertion in the KIT gene that determines white coat color in pigs, and a 176kb fragment containing the PRLR and SPEF2 genes that is presented in multiple copies and is related to the chicken feather growth rate (Zhao Pengju, 2015). These research results indicate that structural variations play an important role in the phenotypic diversity of livestock and poultry.

[0038] The growth hormone receptor (GHR) is on the GH-GHR-IGF axis and regulates the expression of IGFs by mediating growth hormone (GH), thus playing an important role in regulating growth and development in vivo. The binding of GH and GHR can regulate animal growth and has functions such as regulating nutrient distribution, promoting protein synthesis, reducing fat deposition, promoting skeletal muscle growth, increasing animal growth rate and feed conversion ratio, and participating in the regulation of physiological functions and metabolism such as animal immunity, reproduction, and lactation. The GHR gene regulates growth and development through the JAK-STAT signaling pathway. Research has shown that the expression level of the GHR gene and the activity of its signal transduction pathway directly affect the growth rate and body size of animals. In livestock and poultry production, the research on the GHR gene provides a theoretical basis for improving animal growth rate and meat quality. By regulating the GHR gene through gene editing technology, it is expected to breed livestock and poultry varieties with faster growth and better meat quality.

[0039] The present invention provides structural variation molecular markers, primer pairs, kits related to duck growth and development, and their uses, which will be described in detail below respectively.

[0040] Structural variation molecular markers, primer pairs, kits

[0041] In one aspect of the present invention, a structural variant molecular marker related to the growth and development of ducks is proposed. According to an embodiment of the present invention, the structural variant molecular marker is located 80 kb upstream of the GHR gene on chromosome ChrZ, and the structural variant molecular marker has a nucleotide sequence as shown in SEQ ID NO: 1. Through a large number of experiments, the inventors found that the structural variant molecular marker of the present invention mainly exists in domesticated ducks and can regulate the expression of the GHR gene, and the GHR gene can regulate growth and development through the JAK-STAT signal, thereby regulating the growth rate and meat quality of ducks. Therefore, by identifying the type of this molecular marker present in the duck genome, the growth and development status of ducks can be judged through molecular screening at an early stage, and early selection and breeding of duck individuals can be carried out. While reducing the breeding cost, the growth traits can be improved, and the breeding process of ducks can be accelerated.

[0042] In some embodiments of the present invention, the locus of the structural variant molecular marker sequence is at ChrZ: 14961808 - 14962585 of the reference genome Pekin_C18, GCA_037218355.1, and the corresponding assembled chromosome number is CM074424.1.

[0043] In some embodiments of the present invention, the GHR gene in the reference genome Pekin_C18 is CM074424.1: 15049077 - 15192201, with a length of 143,125.

[0044] TAGAATCATAGAATCATAGAATATCCTGAGTTGGAAGGGACCCTTAAGGATCATCAAGTCCAACTCTTGACACCGCACAGGTCTACCCAAGTTCAGACCATGTGACTAAGTGCACAGTCCAATCTCTTCTTAAATTCAGTCAGGCTCGGTGCAGTGACCACTTCCCTGGGGAGCCTGTTCCAGTGTGCAACCACTCTCTCTGTGAAGAACCCCTTCCTGATGTCCAGCCTAAACTTCCCCTGCCTCAGCTTAACTCCATTCCCGCGGGTCCTGTCGCTGGTGTTAATGGAGAAAAGGTCTCCTGCCTCTCGACACCCCCTTACGAGGAAGTTGTAGACTGCGATGAGGTCTCCCCTCAGCCTCCTCTTCTCCAGGCTGAACAGGCCCAGTGCCCTCAGCCGTTCCTCGTACGTCTTCCCCTCCAGGCCTTTCACCATCTTCATAGCCCTCCTCTGGACACTCTCCAACAGTTTCATGTCCTTTTTATACTGTGGTGCCCAGAACTGCACACAGTACTCGAGGTGAGGCCGCACCAGCGCAGAGTAGAGCGGGACAATCACCTCCCTCGACCTACTAGCGATGCCGTGCTTGATGCACCCCAGGACACGGTTGGCCCTCCTGGCTGCCAGGGCACACTGCTGGCTCATATTCAACTTGCTGTCTACCACGACCCCCAGATCCCTCTCTTCTAGGCTGCTCTCCAGCGTCTCATCGCCCAGTCTGTACGTGCAGCCAGGGTTTCCCCGTCCCAGGTGCAGGACCCGGCACTTGCTCTTAT(SEQ ID NO:1)

[0045] In some embodiments of the present invention, the growth and development or growth traits include growth rate, body type, meat quality, etc.

[0046] In another aspect of the present invention, the present invention provides a primer pair for amplifying the aforementioned structural variation molecular marker. According to an embodiment of the present invention, the primer pair includes: an upstream primer and a downstream primer. The upstream primer has the sequence shown in SEQ ID NO:2, and the downstream primer has the sequence shown in SEQ ID NO:3. Using the primer pair of the present invention for amplification experiments can specifically amplify the aforementioned structural variation molecular marker. Thus, the primer pair can be used to amplify the genomic DNA of the duck to be tested. Based on the amplified product, the duck to be tested with the sequence of SEQ ID NO:1 is selected for breeding or cultivation, which accelerates the duck breeding process.

[0047] Upstream primer: 5’-CGGGGTACCTCTATGCCCAAACACAGAGACA-3’ (SEQ ID NO:2) Downstream primer: 5’-CCCAAGCTTAGAGAAGCTGTAGGTGTCCCAT-3’ (SEQ ID NO:3)

[0048] In yet another aspect of the present invention, the present invention provides a kit. According to an embodiment of the present invention, the kit includes the aforementioned primer pair. The kit provided by the present invention can quickly, simply, and conveniently perform PCR amplification on the genomic DNA of ducks to obtain molecular markers, and select the duck to be tested with the sequence of SEQ ID NO:1 for breeding or cultivation based on the sequence of the molecular marker, which accelerates the duck breeding process.

[0049] In some embodiments of the present invention, the kit further includes one or more of dNTPs, PCR reaction buffer, and DNA polymerase.

[0050] Method

[0051] In yet another aspect of the present invention, the present invention provides a method for evaluating the growth and development of ducks. According to an embodiment of the present invention, the method includes: using the genomic DNA of the duck to be tested as a template, performing PCR amplification with the aforementioned primer pair, and comparing the amplification result with the aforementioned structural variation molecular marker; based on the comparison result, determining the growth and development status of the duck to be tested. As described above, the structural variation molecular marker of the present invention can regulate the expression of the GHR gene, and the GHR gene can regulate the growth and development of ducks. Thus, using the method of the present invention can quickly and simply evaluate the growth and development status of the duck to be tested, thereby improving the breeding efficiency and accelerating the duck breeding process.

[0052] According to an embodiment of the present invention, the amplification result having the aforementioned structural variation molecular marker is an indication that the duck to be tested has fast growth and development.

[0053] In yet another aspect of the present invention, the present invention provides a method for duck breeding. According to an embodiment of the present invention, the method includes: using the genomic DNA of the duck to be tested as a template, performing PCR amplification with the aforementioned primer pair, and comparing the amplification result with the aforementioned structural variation molecular marker; selecting the duck to be tested with the sequence shown in SEQ ID NO:1 for breeding or cultivation. As described above, the structural variation molecular marker of the present invention can regulate the expression of the GHR gene, and the GHR gene can regulate the growth and development of ducks. Therefore, by using the method of the present invention, ducks to be tested with excellent growth traits and economic traits can be quickly and easily screened for breeding, thereby improving the breeding efficiency and accelerating the duck breeding process.

[0054] In yet another aspect of the present invention, the present invention provides a method for determining the duck breed. According to an embodiment of the present invention, the method includes: using the genomic DNA of the duck to be tested as a template, performing PCR amplification with the aforementioned primer pair, and comparing the amplification result with the aforementioned structural variation molecular marker; based on the comparison result, determining the breed of the duck to be tested. The inventors found through experiments that the structural variation molecular marker of the present invention mainly exists in domesticated ducks, and this structural variation molecular marker can cause a decrease in the expression level of the duck GHR gene. Therefore, by using the method of the present invention, the breed of the duck to be tested can be quickly determined, thereby improving the breeding efficiency and accelerating the duck breeding process.

[0055] In some embodiments of the present invention, the amplification result having the aforementioned structural variation molecular marker, that is, the amplification result having the sequence shown in SEQ ID NO:1, is an indication that the duck to be tested is a domesticated duck.

[0056] In some embodiments of the present invention, the amplification result not having the aforementioned structural variation molecular marker, that is, the amplification result not having the sequence shown in SEQ ID NO:1, is an indication that the duck to be tested is a mallard.

[0057] In yet another aspect of the present invention, the present invention provides a method for cultivating a duck breed. According to an embodiment of the present invention, the method includes: using gene editing technology to insert the aforementioned structural variation molecular marker into the upstream 80 kb of the GHR gene on chromosome ChrZ of the duck to be cultivated. The structural variation molecular marker of the present invention can regulate the expression of the GHR gene, and the GHR gene can regulate the growth and development of ducks. Therefore, by this method, a duck breed with relatively excellent growth traits and economic traits can be cultivated, which is beneficial to improving the breeding efficiency and accelerating the duck breeding process.

[0058] In some embodiments of the present invention, the gene editing technologies include, but are not limited to, CRISPR-Cas9 combined with homology-directed repair (HDR), prime editing, transposon systems (such as PiggyBac, Sleeping Beauty, etc.).

[0059] It should be noted that inserting the structural variant molecular marker at 80 kb upstream of the GHR gene on chromosome ChrZ of the duck to be cultivated may refer to inserting the sequence of the structural variant molecular marker, i.e., SEQ ID NO:1, into the 80 kb upstream of the GHR gene on chromosome ChrZ of the duck by gene editing technology, or generating the structural variant molecular marker with the sequence of SEQ ID NO:1 at 80 kb upstream of the GHR gene on chromosome ChrZ of the duck by gene editing technology. As long as the precise positioning of the structural variant molecular marker can be ensured to effectively play its role.

[0060] Use

[0061] In another aspect of the present invention, the present invention provides that the foregoing structural variant molecular marker, the foregoing primer pair or the foregoing kit has at least one of the following uses: for predicting or assisting in predicting the growth and development phenotypes of ducks; for determining or assisting in determining duck strains or duck breeds; for screening or assisting in screening duck individuals, duck strains or duck breeds with fast growth and development. As described above, the structural variant molecular marker of the present invention can regulate the expression of the GHR gene, and the GHR gene can regulate the growth and development of ducks. Therefore, by using this molecular marker, duck individuals with relatively good growth and development and economic traits can be screened.

[0062] In another aspect of the present invention, the present invention provides the use of the foregoing structural variant molecular marker, the foregoing primer pair, the foregoing kit, the foregoing method for evaluating duck growth and development or the foregoing method for duck breeding in assisted breeding. As described above, the structural variant molecular marker of the present invention can regulate the expression of the GHR gene, and the GHR gene can regulate the growth and development of ducks. Therefore, by using this molecular marker, duck individuals with relatively good growth and development and economic traits can be screened for breeding.

[0063] The embodiments of the present invention will be described in detail below. The following described embodiments are exemplary and are only used to explain the present invention and should not be construed as limiting the present invention. For those not specified in the embodiments regarding specific technologies or conditions, they shall be carried out according to the technologies or conditions described in the literature in the art or according to the product instructions. For reagents or instruments not indicated by the manufacturer, they are all conventional products that can be obtained through commercial purchase.

[0064] Example 1: Detection of GHR gene structural variation (SV)

[0065] The inventors utilized the Pekin duck genome (SKLA1.0 in the literature, Pekin_C18, GCA_037218355.1 in NCBI), the newly constructed Shaoxing duck and wild duck genomes, and constructed a pan-genome of the genus Anas through the Minigraph pipeline. Using the variant detection pipeline of the pan-genome, SV variant information of 200 resequencing data from 22 breeds / lines was obtained, and population-specific SVs of different lines were obtained.

[0066] Subsequently, highly differentiated SVs were divided into the following five groups to calculate the genetic differentiation index (Fixation index, Fst) between populations: domestic-MA (domestic breed ducks - mallards), Pekin-MA (Pekin ducks - mallards), IND-MA (Shaoxing ducks - mallards), Pekin-IND (Pekin ducks - Shaoxing ducks), Pekin-IND&MA (Pekin ducks - Shaoxing ducks and mallards). SVs with Fst > 0.5 were selected for these 5 groups, and the results are shown in Figure 1 As shown, the number of SVs in Pekin-IND&MA is 32, the number of SVs in IND-MA is 35, the number of SVs in domestic-MA is 39, the number of SVs in Pekin-IND is 102, and the number of SVs in Pekin-MA is 171. At the same time, 185 duck samples (including domesticated ducks, mallard wild ducks) were grouped as shown in Figure 2 and divided into 15 combinations, and then differential expression analysis was performed. The results are shown in Figure 3 As shown, 77.7% (101 / 130) of the genes associated with these SVs showed significant differential expression between domestic ducks (Pekin ducks, Shaoxing ducks and other local breed ducks) and wild ducks (mallard ducks and other breeds).

[0067] One SV that is almost present in all domesticated ducks and rarely seen in mallard wild ducks was selected. It is located 80 kb upstream of the GHR gene, as shown in Figure 4 As shown. Through the genomic sequence and annotation information (Pekin_C18), the specific location of this SV was obtained, as shown in Table 1. At the same time, the specific sequence of this SV was detected, as shown in SEQ ID NO:1.

[0068] Table 1

[0069] Chr Start End Near gene SV Z 14961808 14962585 DUCK_16920GHR

[0070] The specific sequence of the SV

[0071] TAGAATCATAGAATCATAGAATATCCTGAGTTGGAAGGGACCCTTAAGGATCATCAAGTCCAACTCTTGACACCGCACAGGTCTACCCAAGTTCAGACCATGTGACTAAGTGCACAGTCCAATCTCTTCTTAAATTCAGTCAGGCTCGGTGCAGTGACCACTTCCCTGGGGAGCCTGTTCCAGTGTGCAACCACTCTCTCTGTGAAGAACCCCTTCCTGATGTCCAGCCTAAACTTCCCCTGCCTCAGCTTAACTCCATTCCCGCGGGTCCTGTCGCTGGTGTTAATGGAGAAAAGGTCTCCTGCCTCTCGACACCCCCTTACGAGGAAGTTGTAGACTGCGATGAGGTCTCCCCTCAGCCTCCTCTTCTCCAGGCTGAACAGGCCCAGTGCCCTCAGCCGTTCCTCGTACGTCTTCCCCTCCAGGCCTTTCACCATCTTCATAGCCCTCCTCTGGACACTCTCCAACAGTTTCATGTCCTTTTTATACTGTGGTGCCCAGAACTGCACACAGTACTCGAGGTGAGGCCGCACCAGCGCAGAGTAGAGCGGGACAATCACCTCCCTCGACCTACTAGCGATGCCGTGCTTGATGCACCCCAGGACACGGTTGGCCCTCCTGGCTGCCAGGGCACACTGCTGGCTCATATTCAACTTGCTGTCTACCACGACCCCCAGATCCCTCTCTTCTAGGCTGCTCTCCAGCGTCTCATCGCCCAGTCTGTACGTGCAGCCAGGGTTTCCCCGTCCCAGGTGCAGGACCCGGCACTTGCTCTTAT(SEQ ID NO:1)

[0072] Example 2: Expression of GHR gene in different duck breeds

[0073] To determine whether there are differences in the expression of the GHR gene between domesticated ducks and mallards. The inventors performed transcriptome expression analysis of multiple tissues, that is, using the high-quality RNA-Seq sequencing data of 185 duck samples (including domesticated ducks and mallards), and aligned them to the Pekin duck reference genome SKLA1.0 using HISAT2. The effective reads mapped to the genome were counted using the featureCounts software (version 2.0.3), and the FPKM (fragments per kilobase of exon per million reads) values were calculated using the Python bioinformatics toolkit bioinfokit (v0.9.1). To identify differentially expressed genes between mallards and domesticated ducks, a total of 15 pairs of RNA-seq datasets were analyzed. Samples with low correlation with other samples (criterion for determination: R 2 <0.95) were excluded (considered invalid biological replicates). The fold change and adjusted p-value of the expression of each gene were calculated using the DESeq2 software (v1.24.0). The gene expression levels were visualized by normalizing the FPKM values to the maximum FPKM value of each gene in the 15 RNA-seq datasets. The experimental results are shown in Figure 5 As shown, it was found that the GHR expression level in mallards was significantly higher than that in Pekin ducks in the liver and preadipocytes of subcutaneous fat before differentiation at 2-6 weeks of age, indicating that in Pekin ducks and mallards, the SV upstream of GHR can affect the expression of the GHR gene in some tissues, and the decrease of the GHR gene may be related to the domestication of domestic ducks.

[0074] Example 3: Experimental verification of the insertion of the structural variant SV sequence

[0075] 1. Design PCR primers according to the genomic sequences before and after the SV in Example 1. The specific primer information is as follows:

[0076] The upstream primer F is 5’-CGGGGTACCTCTATGCCCAAACACAGAGACA-3’ (SEQ ID NO:2);

[0077] The downstream primer R is 5’-CCCAAGCTTAGAGAAGCTGTAGGTGTCCCAT-3’ (SEQ ID NO:3).

[0078] 2. Extract the genomic DNA of Pekin ducks and mallards, and then use Es Taq DNA Polymerase and set up the reaction system according to the official instructions. The PCR reaction system is shown in Table 2, and the PCR reaction conditions are shown in Table 3. After the reaction, PCR products are obtained.

[0079] Table 2

[0080] Component Dosage Genomic DNA 100 ng Forward primer F 10 μM 10 μL Reverse primer R 10 μM 10 μL 2×Taq Plus MasterMix Dye 25 μL <![CDATA[ddH2O]]> Make up to 50 μL

[0081] Table 3

[0082]

[0083] 3. Use a part of the PCR product for gel electrophoresis and a part for vector construction:

[0084] (1) Electrophorese the PCR product in 1.5% agarose gel. The electrophoresis results are as Figure 6 shown. Analyze the length of the target band (SV length ≈ Pekin band length - Mallard band length). The gel results show that the band length basically meets the expectation.

[0085] (2) Use the RNA Kit kit to purify the PCR product according to the instructions. Then use the pGL3-basic vector and use the method of double digestion with KpnI / HindIII for vector ligation according to the instructions to obtain the ligation products pGL3-Pekin-SV vector and pGL3-MA-control vector.

[0086] Next, add 5 μl of the ligation products (pGL3-Pekin-SV vector, pGL3-MA-control vector, and pGL3-basic control vector) to EP tubes together with 50 μl of competent cells respectively, and process them according to the following steps: 1) Incubate on ice for 30 minutes; 2) Heat in a 42°C water bath for 30 seconds and then immediately place on ice for 1 - 2 minutes; 3) Add 700 μl of LB medium, and resuscitate by shaking at 37°C for 60 minutes; 4) Centrifuge at 4000g for 5 minutes, discard 650 μl of the supernatant, and resuspend the remaining liquid at the bottom and spread it on an LB plate containing 01.% (V / V) ampicillin or kanamycin. 5) Incubate at 37°C for 12 hours.

[0087] (3) Extract plasmid DNA from the competent cells containing different vectors after the culture is completed. Then perform vector transfection on the extracted plasmid DNA. The specific process is as follows: After subculturing DF-1 (chicken embryo fibroblasts) (37°C, 5% CO2), use the Lipofectamine 3000 (Invitrogen) transfection kit to perform vector transfection on the plasmid DNA strictly according to the instructions. Set three replicates for each vector, and finally continue to culture the cells for 48 hours (37°C, 5% CO2).

[0088] (4) After the culture is completed, process the cells according to The luciferase activity was detected according to the instruction manual of the Luciferase Assay System (Promega), and finally the ratio of Firefly Luciferase / Renilla Luciferase (F / R) was used as the relative reporter gene activity.

[0089] The results of the dual-luciferase reporter gene assay were as Figure 7 shown. Compared with DF-1 cells that did not express MA (mallard) SV, the luciferase activity in DF-1 cells expressing Pekin duck SV was significantly decreased. This result indicates that structural variation (SV) plays a key role in the domestication process of ducks by altering gene expression levels.

[0090] In the description of this specification, the descriptions with reference to terms such as "one embodiment", "some embodiments", "example", "specific example", or "some examples" mean that the specific features, structures, materials, or characteristics described in connection with the embodiment or example are included in at least one embodiment or example of the present invention. In this specification, the schematic representations of the above terms do not necessarily refer to the same embodiment or example. Moreover, the specific features, structures, materials, or characteristics described can be combined in a suitable manner in any one or more embodiments or examples. In addition, without contradiction, those skilled in the art can combine and combine the different embodiments or examples described in this specification and the features of different embodiments or examples.

[0091] Although the embodiments of the present invention have been shown and described above, it can be understood that the above embodiments are exemplary and should not be construed as limiting the present invention. Those of ordinary skill in the art can make changes, modifications, substitutions, and variations to the above embodiments within the scope of the present invention.

Claims

1. A structural variation molecular marker related to duck growth and development, characterized in that, The structural variant molecular marker is located 80 kb upstream of the GHR gene on chromosome ChrZ, and the structural variant molecular marker has the nucleotide sequence shown in SEQ ID NO:

1.

2. The structural variant molecular marker according to claim 1, characterized in that, The locus of the structural variant molecular marker sequence is in the reference genome Pekin_C18, GCA_037218355.1, ChrZ: 14961808-14962585.

3. A primer pair for amplifying the structural variant molecular marker described in claim 1 or 2, characterized in that, The primer pair includes an upstream primer and a downstream primer. The upstream primer has the sequence shown in SEQ ID NO: 2, and the downstream primer has the sequence shown in SEQ ID NO:

3.

4. A kit, characterized in that, It includes the primer pair described in claim 3.

5. The structural variant molecular marker described in claim 1 or 2, the primer pair described in claim 3, or the kit described in claim 4 has at least one of the following uses: For predicting or assisting in predicting the growth and development phenotypes of ducks; For determining or assisting in determining duck lines or duck breeds; For screening or assisting in screening duck individuals, duck lines, or duck breeds with fast growth and development.

6. A method for evaluating the growth and development of ducks, characterized in that, It includes: Using the genomic DNA of the duck to be tested as a template, performing PCR amplification with the primer pair described in claim 3, Comparing the amplification result with the structural variant molecular marker described in claim 1 or 2; Based on the comparison result, determining the growth and development status of the duck to be tested.

7. The method according to claim 6, wherein The amplification result having the structural variant molecular marker described in claim 1 or 2 is an indication that the duck to be tested has fast growth and development.

8. A method for duck breeding, characterized in that, It includes: Using the genomic DNA of the duck to be tested as a template, performing PCR amplification with the primer pair described in claim 3, Comparing the amplification result with the structural variant molecular marker described in claim 1 or 2; Selecting the duck to be tested with the sequence shown in SEQ ID NO: 1 for breeding or cultivation.

9. The use of the structural variant molecular marker described in claim 1 or 2, the primer pair described in claim 3, the kit described in claim 4, the method for evaluating duck growth and development described in claim 6 or 7, or the method for duck breeding described in claim 8 in assisting breeding.

10. A method for cultivating a duck breed, characterized in that, It includes: Using gene editing technology to insert the structural variant molecular marker described in claim 1 or 2 into the 80 kb upstream of the GHR gene on chromosome ChrZ of the duck to be cultivated; Optionally, the gene editing technology includes CRISPR-Cas9, prime editing, transposon system.

Images