SNP (Single Nucleotide Polymorphism) site related to marketing weight of 70-day-old rabbits and application

Abstract

The invention discloses an SNP (Single Nucleotide Polymorphism) site related to the slaughtering weight of a rabbit at the age of 70 days and application, and belongs to the technical field of molecular marker-assisted breeding. The SNP site is located at 129803bp of chromosome 3 of a reference genome of the Kangbig meat rabbit, and the polymorphism of the SNP site is T / G. According to the SNP locus and the detection method provided by the invention, an efficient and accurate molecular marker-assisted breeding technology can be established, and when the molecular marker-assisted breeding technology is applied to genetic improvement of the marketing body weight character of the breeding rabbits at the age of 70 days, the breeding period can be shortened, the feed cost can be reduced, the marketing efficiency can be improved, and the overall benefits of rabbit breeding can be further improved.

Description

Technical Field

[0001] The present invention relates to the technical field of molecular marker-assisted breeding, and particularly relates to an SNP locus related to the 70-day-old slaughter weight of rabbits and its application. Background Art

[0002] The 70-day-old slaughter weight of meat rabbits is one of the important indicators to measure their production level and breeding efficiency. A large slaughter weight means that rabbits can grow more meat in the same feeding time, thereby increasing the output value. At the same time, it can improve the feed conversion rate, reduce the proportion of feed cost, shorten the breeding cycle, increase the number of slaughter times, and improve the overall income of rabbit breeding. A large 70-day-old slaughter weight means more muscle growth, and at the same time makes the rabbit meat more tender and better in taste, meeting the needs of consumers for high-quality rabbit meat, thereby enhancing the market value of rabbit products. However, in the prior art, conventional genetic evaluation and selection and mating are often carried out according to the phenotypes of rabbits, resulting in low breeding efficiency and slow genetic progress.

[0003] Modern molecular biology can assist in the selective breeding of important economic traits such as the growth rate of rabbits by means of molecular markers. However, the trait of the 70-day-old slaughter weight of rabbits is controlled by numerous minor genes, and the possible molecular markers are very complex. Therefore, it has practical application significance to fully study and determine the molecular markers for the 70-day-old slaughter weight of rabbits. Summary of the Invention

[0004] The purpose of the present invention is to provide an SNP locus related to the 70-day-old slaughter weight of rabbits and its application to solve the problems existing in the above prior art. According to the SNP locus provided by the present invention, an efficient and accurate molecular marker-assisted breeding technology can be established. Applying it to the genetic improvement of the 70-day-old slaughter weight trait of breeding rabbits can increase the rabbit meat yield, shorten the breeding cycle, reduce the feed cost, increase the number of slaughter times, and thus improve the overall income of rabbit breeding.

[0005] To achieve the above purpose, the present invention provides the following solutions:

[0006] The present invention provides an SNP locus related to the 70-day-old slaughter weight of rabbits. The SNP locus is located at 129,803 bp on chromosome 3 of the Kangda meat rabbit reference genome, and its polymorphism is T / G. The project number of the Kangda meat rabbit reference genome in the NCBI BioProject database is PRJNA1020055.

[0007] The present invention also provides an SNP molecular marker related to the 70-day-old slaughter weight of rabbits. The nucleotide sequence of the SNP molecular marker is as shown in SEQ ID NO.1, and there is a T / G base mutation at the 125th position of the nucleotide sequence.

[0008] The present invention also provides a primer set for detecting the SNP molecular marker, which includes an upstream primer with a nucleotide sequence as shown in SEQ ID NO.2 and a downstream primer with a nucleotide sequence as shown in SEQ ID NO.3.

[0009] The present invention also provides a detection reagent or a detection kit for the SNP molecular marker, which contains the primer set.

[0010] The present invention also provides the application of the primer set, or the detection reagent, or the detection kit in identifying individuals with advantages in the 70-day-old slaughter weight of rabbits.

[0011] The present invention also provides a method for identifying individuals with advantages in the 70-day-old slaughter weight of rabbits, including:

[0012] Using the genomic DNA of the rabbit to be tested as a template, performing PCR amplification on the template with the primer set, sequencing the amplification product, and judging the genotype of the SNP locus according to the sequencing result;

[0013] Individuals with the genotype GG have a significantly higher 70-day-old slaughter weight than individuals with the genotypes TT and TG.

[0014] Furthermore, the reaction system for the PCR amplification is: 1 μL of DNA template, 1 μL each of the upstream and downstream primers (10 pmole / μL), 10 μL of PCR Mix, and 7 μL of ddH2O.

[0015] Furthermore, the reaction program for the PCR amplification is: 94°C for 3 min; 94°C for 25 s, 55 - 58°C for 20 s, 72°C for 10 s, for 28 cycles; 72°C for 5 min; 4°C, ∞.

[0016] The present invention also provides the application of the primer set, or the detection reagent, or the detection kit in screening or predicting individuals with advantages in the 70-day-old slaughter weight of rabbits.

[0017] The present invention also provides the application of the primer set, or the detection reagent, or the detection kit in molecular marker-assisted breeding of individuals with advantages in the 70-day-old slaughter weight of rabbits.

[0018] The present invention discloses the following technical effects:

[0019] The present invention provides a molecular marker related to the 70-day-old slaughter weight of rabbits, verifies its influence effect on the 70-day-old slaughter weight trait, can establish an efficient and accurate molecular marker-assisted breeding technology based on this molecular marker, and apply it to the genetic improvement of the 70-day-old slaughter weight trait of breeding rabbits, which can reduce feed costs, shorten the breeding cycle, increase the number of slaughter times, and thus improve the overall income of rabbit breeding. Brief Description of the Drawings

[0020] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the accompanying drawings required in the embodiments. Obviously, the accompanying drawings in the following description are only some embodiments of the present invention. For those of ordinary skill in the art, without creative efforts, other accompanying drawings can be obtained based on these drawings.

[0021] Figure 1 It is a Manhattan plot for SNP screening related to the slaughter weight of rabbits at 70 days of age; among them, the SNPs related to the slaughter weight of rabbits at 70 days of age screened are marked by red circles, and this locus is located on chromosome 3 of rabbits.

[0022] Figure 2 It is the result of electrophoresis detection of PCR products in 1% agarose gel. M is Marker with a molecular weight of 2000bp. The band sizes from top to bottom are 2000bp, 1000bp, 750bp, 500bp, 250bp, and 100bp in sequence. 1 is the amplification product, and the band size is approximately 274bp. Detailed implementation manners

[0023] Now, the various exemplary implementation manners of the present invention will be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, characteristics, and implementation schemes of the present invention.

[0024] It should be understood that the terms described in the present invention are only for describing specific implementation manners and are not used to limit the present invention. Additionally, for the numerical ranges in the present invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any intermediate value within any stated value or stated range, as well as each smaller range between any other stated value or intermediate value within the stated range, is also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded from the range.

[0025] Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by those of ordinary skill in the art to which the present invention pertains. Although the present invention only describes the preferred methods and materials, any methods and materials similar or equivalent to those described herein can also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials related to the documents. In case of conflict with any incorporated document, the content of this specification shall prevail.

[0026] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments described herein without departing from the scope or spirit of the invention. Other embodiments will be apparent to those skilled in the art from the description of the invention. The description and examples are intended to be illustrative only.

[0027] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0028] The experimental rabbit group used in the examples of the present invention was derived from Qingdao Kangda Rabbit Industry Development Co., Ltd. The experimental rabbit group used for SNP site screening came from the same batch of 1512 Kangda V-series meat rabbits, and the experimental rabbit group used for testing the correlation between SNP site genotype and 70-day-old slaughter weight came from another batch of 856 Kangda V-series meat rabbits; the experimental rabbit group was raised in a closed rabbit house, raised and managed according to the breed standards, and the environmental conditions were consistent.

[0029] Example 1 Screening of SNP sites and analysis of their association with phenotypes

[0030] 1. Experimental Methods

[0031] 1. Test sample collection

[0032] Ear tissue samples of all experimental rabbits were collected and stored in 75% ethanol for use in extracting rabbit genomic DNA (for specific methods, refer to the instructions provided by the blood / cell / tissue genomic DNA kit produced by Beijing Tiangen Biochemical Technology Co., Ltd.).

[0033] 2. Determination of slaughter weight at 70 days of age

[0034] All experimental rabbits were housed in single cages according to unified feeding standards. They were fed without food but with water at 69 days of age. The fasting weight of the rabbits was recorded at 70 days of age. The data were collated and processed to eliminate abnormal values.

[0035] 3. Extraction and detection of rabbit genomic DNA

[0036] Rabbit genomic DNA was extracted from rabbit ear tissue using the TIANamp Genomic DNA Kit produced by Beijing Tiangen Biochemical Technology Co., Ltd.

[0037] 4. Genotype determination and quality control of genotype data

[0038] Genomic DNA samples were extracted from 1512 rabbit ear samples and low-depth resequencing was performed to obtain individual genomic data. The BaseVar+STITCH software was used for genome imputation to obtain complete genomic sequences, and SNP sites were extracted. The PLINK software was used to perform quality control tests on the original genotype data of all individuals, with the SNP genotype detection rate (SNP callrate) > 90%, the minor allele frequency (MAF) > 0.01, and the P value of the Hardy-Weinberg Equilibrium (HWE) test < 10 -6 and the sample detection rate (sample call rate) > 90% as the criteria.

[0039] 5. Data sorting and analysis

[0040] 1) Phenotypic data analysis

[0041] Using the R statistical analysis software, descriptive statistical analysis was performed on the measured values of the slaughter weight at 70 days of age, including calculating the mean, standard deviation, maximum, and minimum values of this trait.

[0042] 2) Genome-wide association analysis

[0043] The GMAT 2.0 software was used to perform GWAS analysis by analyzing data using a mixed model. The mixed model is as follows:

[0044] y = Xβ + Zα + Wμ + e

[0045] where y is the vector of phenotypic traits; X represents the vector of covariates (the PCA principal components obtained from population structure analysis); β represents the vector of corresponding coefficients, including the intercept term; Z represents the vector of marker genotypes; α represents the effect size of the marker; Wμ represents the vector of random polygenic effects, where is the genetic variance, G represents the constructed genomic relationship matrix; e is the vector of random residuals, satisfying e ∼ N(0, Iσ 2 ), where σ 2 is the residual variance.

[0046] 3) Test the significance of the association between SNPs and traits.

[0047] When a certain SNP meets the condition of P < 2.47×10 -6 , it is considered that this SNP reaches genome-wide significance.

[0048] 4) SNP annotation

[0049] In the gene annotation database of the self - constructed Kangda meat rabbit reference genome (NCBI project number PRJNA1020055), a self - written Python script was used to annotate this SNP, that is, to determine the chromosome where the SNP locus is located and its physical position on the chromosome.

[0050] II. Test Results

[0051] The Manhattan plot for SNP screening related to the 70 - day - old slaughter weight of rabbits is as Figure 1 shown. Through Figure 1 it can be seen that this SNP is located on chromosome 3. After annotating the selected SNP locus, it is found that this SNP is located at position 129,803 bp on chromosome 3 of the self - constructed Kangda meat rabbit reference genome (NCBI project number PRJNA1020055), showing T / G polymorphism. The gene fragment containing this SNP locus is as shown in SEQ ID NO.1.

[0052] SEQ ID NO.1:

[0053] 5’ - ACCGGAAACCAAGGGTGCCCCACCCCTGGCCGGCTGGCTGGCCCCTGCCCCCA CACTCTCAGCACCTCAGGCCCCGGGGGGCAGCTGGAGGGGAGGCCTCAGCCCTGCCCCACGGGGAGGCAGCNCCAGTGCTGCCTGGGGCCCAGCCCACAGCGCTCAGCGGCCAGCCAGCCTGCGCTGGGAGCCCGGGCACACACGCATCGAGCTCCTGCCCCACGTGGGTGGAAATTCACTCGGCCACAGGTGCTGCGGACCCCCGTTGCCCTCAGCAGCT - 3’ (The 125th bp of this sequence is the SNP locus, and N represents T or G).

[0054] Table 1 shows the effect of the T / G mutation site at 129,803 bp on chromosome 3 of rabbits on the 70 - day - old slaughter weight in the Kangda V - line meat rabbit population; among them, * indicates significant difference, P < 0.05; ** indicates extremely significant difference, P < 0.01; the trait values in the table are mean ± standard error.

[0055] Table 1 Distribution of genotypes and 70 - day - old slaughter weights in the experimental rabbit population

[0056] Number of samples Genotype Mean ± SEM of body weight at 70-day-old P-value 585 TT 2449.69±13.20 TT - TG 0.098 658 TG 2478.57±11.36 TT - GG <![CDATA[5.79×10 -5 **]]> 269 GG 2544.42±19.25 TG - GG 0.003**

[0057] As can be seen from Table 1, for individuals with the genotype GG, their body weight at 70 days of age at slaughter is significantly higher; for individuals with the genotype TT, their body weight at 70 days of age at slaughter is significantly lower; the body weight at 70 days of age at slaughter of individuals with the genotype GG is significantly higher than that of individuals with the TT genotype and the TG genotype (p<0.01). For the trait of body weight at 70 days of age at slaughter, the additive effect of the G gene is 47.37 g (p<0.01), and the dominant effect of G / T is -18.49 g (p<0.01).

[0058] Example 2 Verification of the Association between SNP Locus Genotype and Rabbit Body Weight at 70 Days of Age at Slaughter

[0059] Using Primer Premier 5.0 software, primers for amplifying the gene fragment containing the SNP locus were designed according to the SNP locus information screened in Example 1 and synthesized by Shanghai Bioengineering Co., Ltd. The sequences of the primer pairs are as follows:

[0060] Forward primer (SEQ ID NO.2): 5’-ACCGGAAACCAAGGGTG-3’;

[0061] Reverse primer (SEQ ID NO.3): 5’-AGCTGCTGAGGGCAACG-3’.

[0062] Using 856 V-line meat rabbits as the verification population to verify the association between SNP locus genotype and rabbit body weight at 70 days of age at slaughter. All verification rabbits were raised individually in cages. According to the unified feeding standard, they were fed without food but with water at 69 days of age, and the fasting body weight of the rabbits was recorded at 70 days of age; and the data were sorted out and abnormal values were excluded. Ear tissue samples of all verification rabbits were collected and stored in 75% ethanol, and rabbit genomic DNA was extracted.

[0063] Using the extracted DNA as a template, PCR amplification was carried out according to the designed primers:

[0064] Take 1 μL of DNA template, 0.5 μL of each of the primers shown in SEQ ID NO.2 and SEQ ID NO.3, and 10 μL of PCR Mix reagent (2×M5 Taq HiFi PCRMix, Mei5bio); set the PCR amplification system: 94℃, 3 min; 28 cycles (94℃, 25 s; 55 - 58℃, 20 s; 72℃, 10 s); 72℃, 5 min; 4℃, ∞.

[0065] After PCR amplification was completed, the amplified products were sequenced, and the genotypes of the SNP loci were judged according to the sequencing results. The genotypes of the SNP loci and the distribution of body weight at 70 days of age at slaughter in the verification rabbit population are shown in Table 2.

[0066] Table 2 Verifying the Distribution of Genotypes and Body Weights at 70 Days of Age in Rabbit Populations

[0067]

[0068]

[0069] As can be seen from Table 2, in the verified rabbit population, the body weights at 70 days of age of individuals with the GG genotype were significantly higher than those of individuals with the TT genotype and the TG genotype (p < 0.01). For the trait of body weight at 70 days of age, the additive effect of the G gene was 87.35 g (p < 0.01), and the dominant effect of G / T was -94.01 g (p < 0.01). This was consistent with the trend of the results in Example 1.

[0070] Thus, in the purebred rabbit population, selecting GG genotype individuals at the 129803bp locus can increase the body weight of rabbits at 70 days of age, thereby improving the overall benefits of rabbit breeding.

[0071] The above-described embodiments are only descriptions of the preferred embodiments of the present invention and do not limit the scope of the present invention. Without departing from the design spirit of the present invention, various deformations and improvements made by those of ordinary skill in the art to the technical solutions of the present invention shall fall within the protection scope determined by the claims of the present invention.

Claims

1. An SNP locus related to the 70-day-old slaughter weight of rabbits, characterized in that, The SNP locus is located at 129,803 bp on chromosome 3 of the Kangda meat rabbit reference genome, and its polymorphism is T / G. The project number of the Kangda meat rabbit reference genome in the NCBI BioProject database is PRJNA1020055.

2. A SNP molecular marker related to the 70-day-old slaughter weight of rabbits, characterized in that, The nucleotide sequence of the SNP molecular marker is shown in SEQ ID NO.1, and there is a T / G base mutation at the 125th position of the nucleotide sequence.

3. A primer set for detecting the SNP molecular marker according to claim 2, characterized in that, It includes an upstream primer with a nucleotide sequence shown in SEQ ID NO.2 and a downstream primer with a nucleotide sequence shown in SEQ ID NO.

3.

4. A detection reagent or detection kit for the SNP molecular marker according to claim 2, characterized in that, It contains the primer set described in claim 3.

5. Use of the primer set described in claim 3 or the detection reagent or detection kit described in claim 4 in identifying individuals with advantages in the 70-day-old market weight of rabbits.

6. A method for identifying individuals with advantages in the body weight at 70-day-old of rabbits, characterized in that, It includes: Using the genomic DNA of the rabbit to be tested as a template, performing PCR amplification on the template using the primer set described in claim 3, sequencing the amplification product, and judging the genotype of the SNP locus according to the sequencing result; Individuals with the genotype GG have a significantly higher 70-day-old market weight than individuals with the genotypes TT and TG.

7. The method according to claim 6, wherein The reaction system for the PCR amplification is: 1 μL of DNA template, 0.5 μL of each of the upstream and downstream primers, and 10 μL of PCR Mix.

8. The method according to claim 6, characterized in that, The reaction program for the PCR amplification is: 94°C for 3 min; 94°C for 25 s, 55 - 58°C for 20 s, 72°C for 10 s, for 28 cycles; 72°C for 5 min; 4°C, ∞.

9. Use of the primer set described in claim 3 or the detection reagent or detection kit described in claim 4 in screening or predicting individuals with advantages in the 70-day-old market weight of rabbits.

10. Use of the primer set described in claim 3 or the detection reagent or detection kit described in claim 4 in molecular marker-assisted breeding of individuals with advantages in the 70-day-old market weight of rabbits.

Images