A SNP molecular marker associated with conception rate of young cows, a detection product and its application
By identifying the SNP molecular marker chr6:g.103355581C>T related to the conception rate of young cows, specific primers were designed for PCR amplification and sequencing, and parents with high conception rates were screened. This solved the problems of complex breeding management and insufficient genetic research in existing technologies, and improved breeding efficiency and economic benefits.
Patent Information
- Application Number
- CN202510898401.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-07-01
- Publication Date
- 2025-09-09
- Estimated Expiration
- 2045-07-01
AI Technical Summary
In the existing technology, the conception rate of young cows is unstable, traditional breeding management methods are complicated and inefficient, and genetic research is insufficient, resulting in limited breeding efficiency and economic benefits.
By identifying the SNP molecular marker chr6:g.103355581C>T related to the conception rate of young cows, specific primers were designed for PCR amplification and sequencing, and the genotypes were determined to be TT, CT, and CC. Parents with high conception rates were screened to increase the genotype frequency.
Effectively judge and improve the conception rate of young cows, increase the reproduction rate, reduce breeding costs, and enhance the reproductive efficiency and economic benefits of dairy cow groups.
Smart Images
Figure SMS_1 
Figure SMS_2 
Figure SMS_3
Abstract
Description
Technical Field
[0001] The present invention relates to the technical field of dairy cow breeding markers, and in particular to a SNP molecular marker associated with the conception rate of young cows, a detection product and application thereof. Background Art
[0002] As modern animal husbandry develops towards intensification and efficiency, the reproductive efficiency of heifers has become a key factor influencing the economic benefits of ranches and the sustainable development of the industry. Heifer conception rate is not only directly related to herd renewal rate and productivity improvement, but also a core indicator of reproductive management technology. However, existing technologies still face multiple challenges in achieving heifer conception rates: traditional estrus synchronization protocols are complex to operate, and imprecise hormone dosing leads to poor ovulation synchronization; early embryonic mortality after breeding is high (approximately 60%-70% occurs within 16 days of breeding); and the disconnect between nutritional regulation and reproductive health management further exacerbates the instability of conception rates.
[0003] Heifer conception rate is a key indicator of reproductive efficiency and production profitability in dairy herds. Research has shown that a 1% increase in first-service conception rate for heifers can significantly reduce downtime costs by approximately 12% and shorten the calving interval to less than 365 days. However, current heifer reproductive management still faces technical bottlenecks: traditional phenotypic selection methods rely on reproductive record statistics, resulting in long cycles and slow genetic progress.
[0004] In recent years, with the increasing availability of high-density SNP array data, the chances of identifying important mutations have increased. Association mapping to identify causal variants or assign QTLs to one or a few genes may help identify genes controlling heifer conception rate. Heifer conception rate in dairy cows is a complex trait controlled by multiple genes, and further exploration of relevant loci is necessary. Summary of the Invention
[0005] The purpose of the present invention is to provide a SNP molecular marker related to the conception rate of young cows, as well as related detection products and applications, in order to address the problem that there is little research on genes related to the conception rate of young cows in the existing technology and it cannot meet the needs of guiding production practice.
[0006] The technical solution of the present invention is described in detail as follows:
[0007] In a first aspect, the present invention provides a SNP molecular marker associated with the conception rate of young cows, wherein the SNP molecular marker is chr6:g.103355581C>T, the coordinate position of which is based on the bovine reference genome version UMD3.1, the NCBI assembly accession number is GCF_000003055.6, and the chromosome number is AC 000163.1;
[0008] The heifers are cows that are 12 to 24 months old and have never calved.
[0009] Optionally or preferably, the above-mentioned SNP molecular marker is the 173rd nucleotide shown in SEQ ID NO: 1 in the sequence listing, and the polymorphism is C or T.
[0010] In a second aspect, the present invention provides an application of the above-mentioned SNP molecular markers in determining the conception rate of young cows. The genotypes of the SNP molecular markers for the conception rate of young cows from high to low are TT, CT, and CC.
[0011] Optionally or preferably, in the above application, the method for determining the conception rate of young cows comprises the following steps:
[0012] (1) Extracting genomic DNA from young cows;
[0013] (2) Using the genomic DNA obtained in step (1) as a template and the nucleotide sequence shown in SEQ ID NO: 2-3 as a primer, PCR amplification is performed to obtain an amplification product containing a SNP molecular marker, wherein the 173rd position of the amplification product is a SNP molecular marker;
[0014] (3) The amplified products were sequenced, and the SNP molecular marker genotypes of the conception rate from high to low were TT, CT, and CC.
[0015] In a third aspect, the present invention provides an application of the above molecular markers in assisted breeding of dairy cows, wherein the SNP molecular marker genotypes of the heifer conception rate of dairy cows from high to low are TT, CT, and CC.
[0016] In a fourth aspect, the present invention provides a product for detecting the above-mentioned SNP molecular marker, which is a primer pair, and the nucleotide sequence is shown in SEQ ID NO: 2-3.
[0017] In a fifth aspect, the present invention provides another product for detecting the above-mentioned SNP molecular markers, which is a detection kit including a primer pair, the nucleotide sequence of the primer pair being shown in SEQ ID NO: 2-3.
[0018] In a sixth aspect, the present invention provides an application of the above-mentioned detection product in determining the conception rate of young cows. The SNP molecular marker genotypes of the conception rate of young cows from high to low are TT, CT, and CC.
[0019] In a seventh aspect, the present invention provides an application of the above-mentioned detection product in assisted breeding of dairy cows, wherein the SNP molecular marker genotypes of the conception rate of young and middle-aged dairy cows are TT, CT, and CC, from high to low.
[0020] Compared with the prior art, the present invention has the following beneficial effects:
[0021] The present invention used the Bovine SNP50 chip to identify genotypes in a dairy cow population and discovered the presence of a single SNP (chr6:g.103355581C>T). Association analysis between the genotypes of the dairy cow population and the genomic estimated breeding value for the heifer conception rate trait confirmed that this SNP molecular marker is significantly associated with the heifer conception rate trait in dairy cows. By detecting the genotype of this SNP locus, conception rate can be effectively determined, allowing for screening of parents with higher heifer conception rates. This allows for early selection of individuals with genotypes that exhibit high heifer conception rates, increasing the frequency of genotypes with high heifer conception rates within the dairy cow population. This, in turn, improves the reproductive rate of the dairy cow population, increases the useful life of cows, reduces treatment costs, lowers breeding costs, and increases ranch returns, laying the foundation for developing new, superior dairy cow lines with high heifer conception rates. Furthermore, detection products related to this SNP molecular marker can be developed into products related to Holstein dairy cattle breeding in China. DETAILED DESCRIPTION
[0022] In order to enable those skilled in the art to better understand the present application, the present application will be clearly and completely described below in conjunction with the embodiments. Obviously, the embodiments described are only embodiments of a part of the present application, rather than all embodiments. Based on the embodiments in this application, all other embodiments obtained by those of ordinary skill in the art without making creative work should fall within the scope of protection of this application. The instruments and reagents used in the embodiments are all derived from commercial channels unless otherwise specified.
[0023] Example 1 SNP site screening and dominant genotype identification
[0024] 1. Screening of SNP sites
[0025] (1) Blood or hair follicle samples were collected from a total of 2506 Chinese Holstein heifers at four large-scale farms across China. The location of the farms and the number of samples collected at each farm are shown in Table 1.
[0026] Table 1. Location of farms where samples were collected and number of samples collected
[0027]
[0028] (2) Genomic DNA was extracted from the samples, and the genotype of the collected genomic DNA was determined using the Illumina BovineSNP50 chip. Genotyping was performed by Newgene Biotech (Shanghai) Co., Ltd., and the genotypes of a total of 47,843 SNP marker sites were obtained.
[0029] (3) The genomic breeding value (GEBV) of each individual heifer conception rate was estimated based on the genotype. The genomic breeding value estimation was performed by Newgene Biotech (Shanghai) Co., Ltd.
[0030] (4) A genome-wide association analysis was conducted using GEMMA software based on genotype data for genomic breeding values associated with conception rate in young cows. A mixed linear model was used as the analysis model, with pasture location and cow age as covariates. The FDR method was used for multiple testing correction. The results of the association analysis showed that the most significant SNP locus was located on chromosome 6 at position 103355581, with a significance P value of 0.005869.
[0031] 2. Identification of dominant genotypes at SNP sites
[0032] Among the 2,506 Chinese Holstein cattle collected, 751 individuals were identified with the CC homozygous genotype at the aforementioned SNP, with a mean estimated genomic value for heifer conception rate of 0.1796; 1,136 individuals were identified with the CT heterozygous genotype, with a mean estimated genomic value for heifer conception rate of 0.2956; and 619 individuals were identified with the TT homozygous genotype, with a mean estimated genomic value for heifer conception rate of 0.4340. In genomic genetic evaluation, a higher estimated genomic value for heifer conception rate is considered preferred, thus the TT genotype at this SNP is considered the dominant genotype.
[0033] Example 2 Analysis of the association between SNP genotype and conception rate of young cows
[0034] 1. Amplification of the sequence where the SNP site is located, detection and analysis of the SNP genotype and allele frequency distribution
[0035] In order to determine whether the genotype of the SNP site screened in this application is associated with the conception rate of heifers, 1042 Chinese Holstein heifers were selected for association analysis between genotype and genomic estimated breeding value of heifer conception rate.
[0036] (1) Blood collection from the cattle tail vein
[0037] A total of 1042 cows with genomic estimated breeding values for conception rate of young cows were selected from three pastures as experimental materials, and tail vein blood was collected from the cows.
[0038] (2) Genomic DNA extraction
[0039] Take 500 μL of whole blood and add 500 μL of STE lysis buffer. Then, add 50 μL of 10% SDS and 5 μL of proteinase K (20 mg / mL). Lyse at 56°C for approximately 3 h until the lysate is clear. Add the same volume of saturated phenol (250 μL) and chloroform / isoamyl alcohol (24:1) (250 μL). Gently shake for 20 min and centrifuge at 12,000 rpm for 10 min. Remove the supernatant and repeat the above steps until no protein layer remains between the aqueous and organic phases. Remove the supernatant and add the same volume of chloroform / isoamyl alcohol. Gently shake for 20 min and centrifuge at 12,000 rpm for 10 min. Remove the supernatant and add 1 / 10 volume of 3M NaAc (pH 5.2) and 2 volumes of cold anhydrous ethanol. Shake well, incubate at -20°C for 20 min, and centrifuge at 12,500 rpm for 20 min. Precipitate the nucleic acids at the bottom of the tube. Discard the supernatant and wash the pellet with 70% ethanol. Collect the precipitate and air-dry until all ethanol has evaporated. Add 20 μL of TE (containing RNase A) to dissolve the DNA. Incubate at 37°C for approximately 30 minutes and then store at 4°C. Analyze the DNA sample by electrophoresis on a 1% agarose gel and determine its concentration and purity using a UV spectrophotometer.
[0040] (3) Primer design
[0041] Based on the gene sequence of the cattle where the SNP site screened in Example 1 is located, a pair of specific primers are designed.
[0042] The forward primer was 5F (SEQ ID NO: 2): 5′-GACTTGTGCGGTCATTTGGG-3′;
[0043] The reverse primer was 3R (SEQ ID NO: 3): 5'-GGAGGCAGAAGGCAACAAAC-3'.
[0044] (4) Multiple enzyme chain reaction
[0045] The genomic DNA extracted in step (2) was used as a template and the primers designed in step (3) were used for PCR amplification. The reaction system was as follows: 10× Buffer 1 μL, 2.5 mM dNTP 0.8 μL, 2.5 mM MgCl2, 0.6 μL, forward primer (10 μM) 0.1 μL, reverse primer (10 μM) 0.5 μL, Taq enzyme (5 U / μL) 0.1 μL, template 0.5 μL, LCGreen saturated fluorescent dye 0.7 μL, and H2O was added to make up to 10 μL.
[0046] The amplification reaction was completed on an Applied Biosystem PCR system. The PCR reaction conditions were as follows: 95°C for 5 min; 35 cycles of 95°C for 30 s, 59°C for 30 s, and 72°C for 1 min; and 72°C for 5 min.
[0047] The genotype of the PCR amplification product was detected by Sanger sequencing, and the sequence is as follows:
[0048] GACTTGTGCGGTCATTTGGGCTTACTCTTGTTTCATTTATTTTTATCTAGAGTCAAAGTTGATTTGTCCACATTAATACAGAATGACATCTACTGCTTTATTTCATACTGCAGTATAAATTTAACCCCCAATTTTAGATTCAGTAGATTTGGATAGATTCGTAAGAAAGGT C AGGAAGAGAAGACAAACATCACTTTCTCCTTCAGTATTCAACTTTTAGTATTGAGGTTGTTTGGGTTTTTCCATAAGATCATAGGGGAAAACCCAAAAGAACTTCTTGGCCAACCCATTATCTGCCACTTAGGTAGAGTTTGTTGCCTTCTGCCTCC (SEQ ID NO: 1). The SNP site is located at position 173, and the polymorphism is C or T, which is indicated by bold and underline in the sequence.
[0049] (5) Distribution frequency of different genotypes at SNP sites
[0050] The results of the SNP allele frequency distribution analysis are shown in Table 2.
[0051] Table 2 Distribution of different genotypes of SNP loci in Chinese Holstein cattle population
[0052]
[0053] The results showed that in all the tested populations, the CC gene frequency was 32.25%, the CT genotype frequency was 47.02%, and the TT genotype frequency was 20.73%, with the CT genotype being the dominant genotype.
[0054] (6) Association between different genotypes of SNP sites and genomic estimated breeding values of conception rate
[0055] Association analysis of SNP genotypes with genomic estimated breeding values for conception rate in heifers in 1042 Chinese Holstein cattle.
[0056] Table 3 Results of association analysis between SNP genotypes and genomic estimated breeding values for conception rate in young cows
[0057]
[0058] The results showed that the average genomic estimated breeding value (EBR) for individuals with the CC genotype was 0.1978, the average EBR for individuals with the CT genotype was 0.2567, and the average EBR for individuals with the TT genotype was 0.4436. PLINK v1.90 software was used to analyze the correlation between different genotypes and the conception rate trait in dairy heifers. The results showed a significant correlation between genotype and EBR (P value 1.34e-04). The SNP genotype with the highest EBR for conception rate in heifers was TT.
[0059] This document uses specific examples to illustrate the inventive concept in detail. The above embodiments are only intended to help understand the core concept of the present invention. It should be noted that any obvious modifications, equivalent substitutions, or other improvements made by a person skilled in the art without departing from the inventive concept should be included within the scope of protection of the present invention.
Claims
1. The application of SNP molecular markers in judging the conception rate of young cows is characterized by: The SNP molecular marker is chr6:g.103355581C>T, the coordinate position is based on the cattle reference genome version UMD3.1, the NCBI Assembly accession number is GCF_000003055.6, and the chromosome number is AC 000163.1; The young cows are cows that are 12 to 24 months old and have not calved; The SNP molecular marker genotypes of conception rate in young cows are TT, CT, and CC from high to low.
2. The use according to claim 1, characterized in that The SNP molecular marker is the 173rd nucleotide shown in SEQ ID NO: 1 in the sequence list, and the polymorphism is C or T.
3. The use according to claim 1, characterized in that The method for determining the conception rate of heifers includes the following steps: (1) Extracting genomic DNA from young cows; (2) Using the genomic DNA obtained in step (1) as a template and the nucleotide sequence shown in SEQ ID NO: 2-3 as a primer, PCR amplification is performed to obtain an amplification product containing a SNP molecular marker, wherein the 173rd position of the amplification product is a SNP molecular marker; (3) The amplified products were sequenced, and the SNP molecular marker genotypes of the conception rate from high to low were TT, CT, and CC.
4. The application of a product for detecting SNP molecular markers in determining the conception rate of young cows is characterized by: The product includes a primer pair, the nucleotide sequence of the primer pair is shown in SEQ ID NO: 2-3; The SNP molecular marker is chr6:g.103355581C>T, the coordinate position is based on the cattle reference genome version UMD3.1, the NCBI assembly accession number is GCF_000003055.6, and the chromosome number is AC 000163.1; The young cows are cows that are 12 to 24 months old and have not calved; The SNP molecular marker genotypes of conception rate in young cows are TT, CT, and CC from high to low.
5. Application of a product for detecting SNP molecular markers in determining the conception rate of young cows, characterized in that: The product is a detection kit, comprising a primer pair, the nucleotide sequence of the primer pair being shown in SEQ ID NO: 2-3; The SNP molecular marker is chr6:g.103355581C>T, the coordinate position is based on the cattle reference genome version UMD3.1, the NCBI assembly accession number is GCF_000003055.6, and the chromosome number is AC 000163.1; The young cows are cows that are 12 to 24 months old and have not calved; The SNP molecular marker genotypes of conception rate in young cows are TT, CT, and CC from high to low.