Obtaining of maize seedling stage waterlogging-resistant major QTL qWT1.1 and development and application of molecular marker primer of maize seedling stage waterlogging-resistant major QTL qWT1.1

Abstract

The invention belongs to the field of molecular biology, and discloses acquisition of a waterlogging-resistant major QTL qWT1.1 in a corn seedling stage and development and application of a molecular marker primer of the waterlogging-resistant major QTL qWT1.1. The invention provides a major QTL qWT1.1 for controlling the waterlogging survival rate in the corn seedling stage, the major QTL qWT1.1 is located at the fifth version physical position of a reference genome in the first staining of the corn, the fifth version physical position of the reference genome is Chr1: 25904794-27039204, the major QTL site is used for controlling waterlogging-resistant phenotypic variation, an excellent haplotype SNP marker closely linked with the major QTL site is located at the 27039148th basic group of a first chromosome of a reference genome of the corn B73, and the excellent haplotype SNP marker is located at the 27039148th basic group of a second chromosome of the reference genome of the corn B73. The explained waterlogging survival rate phenotypic contribution rate is 10.03%, the PARMS marker designed by the SNP is used for detecting a corn inbred line group, the operation is simple and convenient, the typing is clear, the good selection effect on characters such as root length, root number, plant height, branch number and yield under the stress of corn waterlogging is realized, and the application prospect is wide. The molecular marker can be used for molecular marker-assisted selective breeding of the waterlogging resistance character in the corn seedling stage.

Description

Technical Field

[0001] The present invention belongs to the field of molecular biology, and particularly relates to the acquisition of the major QTL qWT1.1 for waterlogging tolerance at the seedling stage of maize, and the development and application of molecular marker primers thereof. Background Art

[0002] Waterlogging is one of the important factors limiting maize production in tropical and subtropical regions. During the growth period of maize, rain and heat occur in the same season and there is more rainfall. Since maize seedlings have poor adaptability to waterlogging, this often causes serious damage to maize seedlings and ultimately leads to a reduction in maize yield. Waterlogging is becoming increasingly common (Kaur et al., 2020). It is predicted that global warming will lead to more unstable weather patterns, which may further exacerbate the area and harm of waterlogging. The development of waterlogging-tolerant varieties is crucial for maintaining crop production in areas with heavy rainfall, poor drainage, and prone to floods and inundation. Developing waterlogging-tolerant varieties with high yield potential is one of the main goals of maize breeding. Understanding the mechanism of waterlogging tolerance is of great significance for breeders to breed new waterlogging-tolerant varieties targeting different waterlogging tolerance traits (Zaidi et al., 2004).

[0003] The degree of waterlogging damage is related to the duration of stress, soil conditions, climate conditions, cultivation techniques, growth stage of the crop, and genotype (Mano et al., 2002). Existing studies have found that waterlogging for 6 days at the seedling stage of maize is more severe than at the jointing stage and tasseling stage (Ren et al., 2023). Especially from the second leaf stage (V2) to the seventh leaf stage (V7), under waterlogging stress, the roots are first affected (Zaidi et al., 2004). After 6 days of waterlogging treatment, most roots tend to rot except for some adventitious roots, and the plants cannot absorb soil nutrients well, resulting in leaching and denitrification due to nitrogen deficiency, and the latter is manifested as leaf chlorosis (Ren et al., 2017). In addition, the diffusion rate of gas in water is reduced by 104 times compared with that in air. Therefore, during waterlogging, the gas exchange between the soil and the air is greatly reduced (Armstrong, 1979; Armstrong and Drew, 2002), O2 is quickly depleted, and the soil may enter a hypoxic or anoxic state within a few hours (Gambrell and Patrick, 1978; Malik et al., 2002). As a result, the growth of the above-ground part of the plant is inhibited, and at the same time, the reduction of the carbon dioxide exchange rate reduces the photosynthetic rate (Irfan et al., 2010), leading to serious energy shortage (Kaur et al., 2020; Tian et al., 2021), and maize cannot withstand the hypoxic conditions in the root zone, resulting in a significant reduction in yield (Dennis et al., 2000).

[0004] With the change of the global climate, waterlogging disasters show a spreading trend worldwide and have gradually become the most important adversity stress factor affecting crop production. Although more than 100 waterlogging tolerance-related QTLs have been found in the maize genome, however, due to the high complexity of waterlogging stress traits, the narrow maize germplasm resources and the relatively complex genome, it is challenging to identify the genetic composition of waterlogging tolerance. So far, no gene has been cloned by map-based cloning technology, and we know very little about the genetic basis of maize waterlogging tolerance formation and the locus information selected during the improvement of maize waterlogging resistance. Exploring and effectively using waterlogging tolerance genes, discussing the molecular mechanism of maize waterlogging tolerance, creating new maize germplasms with waterlogging tolerance, and cultivating new varieties with waterlogging tolerance are the most economical and effective ways to reduce maize losses, increase the yield per unit area, and expand the maize planting area (Zaidi et al., 2004, 2010). Survival rate is the most intuitive manifestation of maize waterlogging stress tolerance, but the locus information and regulatory mechanism for this adaptation to waterlogging stress are not very clear in maize. Based on this, in this study, 588 backbone inbred lines including those from the southwestern and Huang-Huai-Hai maize production areas were widely collected, an association population of excellent germplasms with different characteristics was established, whole-genome resequencing with a depth of 20X was completed based on the DNBSEQ-T7 / PE150 sequencing platform, and waterlogging identification and evaluation were carried out at the seedling stage. Further, through association analysis, excellent allelic variations were identified, specific functional markers were developed and used to create breeding intermediate materials, providing excellent allelic gene resources for carrying out maize waterlogging tolerance molecular breeding. Summary of the Invention

[0005] The present invention aims to provide the application of a reagent for detecting the base at position 27,039,148 on chromosome 1 of the maize genome in the screening and breeding of maize waterlogging tolerance traits at the seedling stage.

[0006] Another object of the present invention is to provide the application of a reagent for detecting the base at position 27,039,148 on chromosome 1 of the maize genome in the preparation of a kit for screening maize waterlogging tolerance traits at the seedling stage.

[0007] The last object of the present invention is to provide a method for screening and breeding maize waterlogging tolerance traits at the seedling stage.

[0008] To achieve the above objects, the present invention is realized through the following technical solutions:

[0009] Obtaining the major QTL qWT1.1 that controls the survival rate of maize seedlings under waterlogging:

[0010] 1) Through genome-wide association analysis, the present invention detected a QTL qWT1.1 regulating the survival rate under waterlogging at the seedling stage on maize chromosome 1. This interval contains 38 significant SNP loci with a total length of 1.12 Mb (Chr1: 25904794 - 27039204).

[0011] 2) Through the development of optimal haplotype PARMS markers, the applicant developed functional molecular markers tightly linked to it, with a physical position of (Chr1: 27039148). The PARMS marker primers are: qWT1.1F: CAAACAAACATCAAAATCGGGTC; qWT1.1SR1 (waterlogging-resistant haplotype G): GAAGGTGACCAAGTTCATGCTGGCATTGCTAACCTAACAACCC; and qWT1.1SR2 (waterlogging-sensitive haplotype A): GAAGGTCGGAGTCAACGGATTCGGCATTGCTAACCTAAC AACCT.

[0012] 3) Through the phenotypic data of the survival rate under waterlogging at the seedling stage of 567 maize inbred lines, the applicant verified that the excellent haplotype of qWT1.1 can increase the survival rate under waterlogging by 25% in the natural population and is also strongly selected in breeding practice. This excellent haplotype provides gene resources for the creation of waterlogging-tolerant maize lines.

[0013] The protection scope of the present invention also includes:

[0014] The application of a reagent for detecting the base at position 27039148 on the first chromosome of the maize genome in the screening and breeding of maize with waterlogging tolerance at the seedling stage.

[0015] The application of a reagent for detecting the base at position 27039148 on the first chromosome of the maize genome in the preparation of a kit for screening maize with waterlogging tolerance at the seedling stage.

[0016] For the above-mentioned application, if the base at position 27039148 on the first chromosome of the maize genome is detected as G, then it is determined that the maize is waterlogging-tolerant at the seedling stage.

[0017] For the above-mentioned application, if the base at position 27039148 on the first chromosome of the maize genome is detected as A, then it is determined that the maize is waterlogging-sensitive at the seedling stage.

[0018] For the above-mentioned application, the reagent is preferably a primer.

[0019] The primers described above are preferably PARMS detection primers, and more preferably the primers provided by the present invention: qWT1.1F: CAA ACAAACATCAAAATCGGGTC; qWT1.1SR1 (waterlogging-resistant haplotype G): GAAGGTGACCAAGTTCATG CTGGCATTGCTAACCTAACAACCC; and qWT1.1SR2 (waterlogging-sensitive haplotype A): GAAGGTCGGAGTCA ACGGATTCGGCATTGCTAACCTAACAACCT.

[0020] A method for screening and breeding maize with waterlogging tolerance at the seedling stage includes detecting the base at position 27,039,148 on the first chromosome of the maize genome using conventional methods in the art. The conventional methods include, but are not limited to: sequencing, TaqMan probe method, AS-PCR method, molecular beacon method, high-resolution melting curve method, CAPS method, SNaPshot method, KASP method, PARMS method, gene chip method, and mass spectrometry.

[0021] The reference genome of maize used in the present invention is Zm-B73-REFERENCE-NAM-5.0.

[0022] Compared with the prior art, the present invention has the following advantages:

[0023] For the first time, the present invention finely mapped a new major QTL controlling the waterlogging survival rate at the maize seedling stage based on genome-wide association analysis, and located this major QTL on chromosome 1. This interval contains 38 tightly linked SNP loci with a total length of 1.12 Mb (Chr1: 25,904,794 - 27,039,204). These loci are all major QTL loci controlling the variation of waterlogging tolerance phenotype, and the phenotypic contribution rate explained is 10.03%. The PARMS markers developed based on its best allele genotype can be used for molecular marker-assisted selection breeding. Description of the Drawings

[0024] Figure 1 Partial on-site pictures of the identification of waterlogging tolerance at the seedling stage of 567 inbred line materials;

[0025] Among them, there are 3 replicates in the control group and 3 replicates in the waterlogging treatment group.

[0026] Figure 2 Distribution of the two-week waterlogging survival rate of the inbred line population.

[0027] Figure 3 Schematic diagram of the association analysis at the qWT1.1 locus;

[0028] Association analysis of 13.2 million polymorphic variant sites with a minor allele frequency greater than 0.05 at the qWT1.1 locus and the waterlogging survival rate phenotype in 567 different inbred lines. Each dot represents a polymorphic site.

[0029] Figure 4 Schematic diagram for the analysis of the effect of superior haplotypes;

[0030] Comparative analysis of the waterlogging survival rates of 61 Hap1 inbred lines and 503 Hap2 inbred lines. Each box represents the median and interquartile range and extends to the maximum and minimum values. The significance of the difference was estimated by one-way ANOVA.

[0031] Figure 5 、 6 And 7 are schematic diagrams for the evaluation of the genetic effects of qWT1.1 in other traits;

[0032] Scatter points represent the distribution of family survival rates. Each box represents the median and interquartile range and extends to the maximum and minimum values. Error bars represent the SD. The significance of the difference was estimated by one-way ANOVA.

[0033] Figure 8 Schematic diagram for the development and utilization of the best haplotype functional markers of qWT1.1;

[0034] In the figure: Left: Families of the qWT1.1 SR2 type have poor waterlogging resistance. Right: Families of the qWT1.1 SR1 type have strong waterlogging resistance. Detailed implementation manners

[0035] For the technical solutions described in the present invention, unless otherwise specified, they are all conventional solutions in the art; for the reagents or materials, unless otherwise specified, they are all publicly available.

[0036] The reference genome of the maize in the present invention is Zm-B73-REFERENCE-NAM-5.0 (MaizeGDB Genome Center) Example 1:

[0037] Obtaining the major QTL qWT1.1 for waterlogging tolerance at the seedling stage of maize:

[0038] 1. Materials and methods

[0039] 1.1 Materials

[0040] A total of 567 backbone inbred lines from the southwestern and Huang-Huai-Hai maize production areas were widely collected, and an association population of excellent germplasms with different characteristics was established. Based on the DNBSEQ-T7 / PE150 sequencing platform, whole-genome resequencing with a depth of 20X was completed, and 13.2 million high-quality SNP markers were obtained.

[0041] 1.2 Experimental methods

[0042] 1.2.1 Phenotypic identification

[0043] For the association population, 20 seeds from each family were taken and planted in a rectangular plastic box divided into 10 grids with a length of 60 cm, a depth of 25 cm, and a width of 35 cm. Each box contained 30 kg of quartz sand. Each experiment was repeated 3 times, and no replication was set for each square box. At the two-leaf and one-heart stage, 10 seedlings with consistent growth were retained in each replication for waterlogging treatment, and the water surface was maintained at 5 - 7 cm above the quartz sand. At the same time, a parallel control experiment under normal growth conditions was also carried out. After 8 days of waterlogging stress, 10 traits of the seedlings under control (CK) and waterlogging (WT / R) conditions were measured, including seedling height (cm), root length (cm), seedling fresh weight (g), root fresh weight (g), seedling dry weight (g), root dry weight (g), adventitious root number, primary root number, and total root number (adventitious root number + primary root number). The leaf yellowing index and survival rate were only scored under waterlogging conditions. If the seedlings did not show leaf chlorosis, the leaf yellowing index was 0. If 50% of the first leaf was chlorotic, the leaf yellowing index was 0.5, and so on. The survival rate was the ratio of the number of surviving seedlings to the total number of seedlings, and the waterlogging tolerance coefficient was the ratio of the trait value under waterlogging conditions to the trait value under control conditions.

[0044] 1.2.1 Genome-wide association analysis of waterlogging survival rate loci at the seedling stage

[0045] For the raw sequencing data after sequencing, data quality control was performed to obtain high-quality clean data. Then, the clean data was aligned to the reference genome for variant detection. The reference genome used was AGPv5, downloaded from http: / / plants.ensembl.org / Zea_mays / Info / Index. The PE reads were aligned to the B73 reference genome sequence using the BWA software to obtain the alignment result in AM format. The SAM format file was converted to BAM format using the software samtools. Then, the reads in the BAM file were sorted using SortSam in the Picard tool to remove PCR duplicates, and the final BAM file that could be used for variant calling was obtained. Finally, the HaplotypeCaller module of GATK was used for variant detection, including SNPs and InDels. Among them, Q and K were calculated by the software STRUCTURE and TESSEL5.0 respectively. After the P value was corrected, we used P = 1.0×10 -5 as the significance threshold for GWAS results. 1.2.2 Development of molecular markers for the best excellent haplotypes

[0046] According to the B73 genome and combined with the differential site information provided by qWT1.1 sequencing, specific primers were designed. The PARMS detection technology was adopted. This technology is a PCR detection technology developed based on the specific resolution of SNP single-base variant sites. PARMS SNP uses 5 primers for PCR reaction, and 2 of them are fluorescent universal primers included in the PARMS2X Master Mix. The remaining 3 are labeled specific primers, which need to be custom-designed and synthesized according to the experimental purpose. Among these 3 primers, one is the specific primer for the labeled site (Locus specific primer), and the other 2 are SNP allele-specific primers (Allele specific primer). Specific universal adapter sequences of 21 bases are added to the 5' ends of these 2 primers respectively for matching amplification with the fluorescent universal primers. The adapter sequence matching with FAM fluorescence is GAAGGTGACCAAGTTCATGCT, and the adapter sequence matching with HEX fluorescence is GAAGGTCGGAGTCAACGGATTC.

[0047] 1.2.3 Genotype analysis

[0048] The CTAB (Cetyltrimethyl Ammonium Bromide) method was used for small-scale maize DNA extraction (Saghai-Maroof et al 1984).

[0049] PARMS SNP detection principle: The Allele 1 and Allele 2 specific amplification primers with 2 different universal adapter primer sequences bind to the corresponding SNP DNA template after DNA renaturation. The PARMS PCR enzyme and Buffer system can ensure strict allele-specific amplification. Together with the Locus specific amplification primer, after the first 2 rounds of PCR, PCR amplification products with universal adapter sequences are formed. At this time, the universal probe with a reporter fluorescence and a fluorescence quenching group (without fluorescence signal due to the FRET effect during non-amplification) can use the PCR amplification product with the universal adapter sequence as a template for PCR amplification. Once the amplification is successful, the fluorescence quenching group and the reporter group on the fluorescence probe dissociate, and the FRET effect disappears. At this time, fluorescence scanning is performed, and the corresponding fluorescence signal can be detected, so it can be known whether the corresponding allele exists.

[0050] 2. Results and analysis

[0051] 2.1 Identification and evaluation of waterlogging tolerance of 567 inbred line populations

[0052] At the two-leaf and one-heart stage, waterlogging treatment was carried out for two weeks, and the control group grew normally. Among them, the waterlogging tolerance coefficient of root length at the population level was the smallest, which was 0.48, and the variation range was 0.17 - 0.99. There was a highly significant difference in root length between the control group and the waterlogging treatment group. The waterlogging tolerance coefficient of root fresh weight was 0.63, and the variation range was 0.12 - 0.98. The waterlogging tolerance coefficient of root dry weight was 0.76, and the variation range was 0.20 - 1.03. This indicates that the genetic variation among populations is relatively rich, and root length is the most sensitive to waterlogging stress. The waterlogging tolerance coefficients of adventitious root number and total root number were 1.06 and 1.04 respectively, indicating that waterlogging stress has a relatively small impact on the root number (Table 1).

[0053] The populations were divided into 5 grades according to the survival rate after 2 weeks of waterlogging. The survival rate showed an obvious skewed distribution. Among them, there were 236 inbred lines with a survival rate greater than 80%, 150 inbred lines with a survival rate less than 40%, and 202 inbred lines with a survival rate between 40% - 80%( Figure 2 ).

[0054] Table 1 Identification and evaluation of waterlogging tolerance of inbred line populations

[0055]

[0056] CK represents the normal growth group, WT represents the waterlogging treatment group, and two-factor equal-variance analysis of T-test is used for significance testing.

[0057] 2.2 Identification and genetic effect analysis of waterlogging survival rate gene locus qWT1.1

[0058] Based on genome-wide association analysis, this application identified a new major QTL controlling the waterlogging survival rate at the seedling stage of maize. This major QTL was located on chromosome 1. This interval contained 38 tightly linked SNP loci, with a total length of 1.12 Mb (Chr1: 25904794 - 27039204), and was named qWT1.1 (Table 2, Figure 3 ).

[0059] The lead SNP at the qWT1.1 locus 27039148(A / G) was significantly associated at P = 2.62E - 08 and was located at the 27039148th base on the first chromosome of the maize genome (maize B73 reference genome Zm - B73 - REFERENCE - NAM - 5.0, simply referred to as maize B73V5 reference genome in this invention)

[0060] PARMS primers were designed for the above SNP locus as follows:

[0061] (1) For the peak SNP marker leadSNP tightly linked to qWT1.1 27039148(A / G), extract the sequences of 150 bp upstream and downstream of the base at position 27039148 on the first chromosome of the maize B73 V5 reference genome. According to the primer design principle, the primer sequences for PARMS marker detection are as follows:

[0062] qWT1.1F: CAAACAAACATCAAAATCGGGTC;

[0063] qWT1.1SR1: GAAGGTGACCAAGTTCATGCT GGCATTGCTAACCTAACAACCC;

[0064] qWT1.1SR2: GAAGGTCGGAGTCAACGGATTC GGCATTGCTAACCTAACAACCT;

[0065] The underlined part of the reverse primer is the adapter sequence.

[0066] (2) Using the genomic DNA of the maize inbred line population as a template, perform fluorescence quantitative PCR amplification with the above primers, scan the FAM and HEX signals using Tecan F200 and output the results, and finally convert them into genotypes.

[0067] The sequence amplified with the above primers in the waterlogging-tolerant material HZ32 (the male parent of Huayu 3) is: CAAACAAACATC AAAATCGGGTC CAGTATGATGTTCGCCGCGTCGCCAACCACTGAGAACAGAAAA G GGTTGTTAGGTTAGCAATGCC;

[0068] The sequence amplified in the waterlogging-intolerant material ZNC442 (the male parent of Chuandan 99) is: CAAACAAACATCAAAATCGG GTC CAGTATGATGTTCGCCGCGTCGCCAACCACTGAGAACAGAAAA A GGTTGTTAGGTTAG CAATGCC.

[0069] Amplification system:

[0070]

[0071] Amplification parameters:

[0072]

[0073] According to SNP 27039148(A / G) It is divided into two haplotypes, named Hap1 and Hap2 respectively, and two groups are formed to compare the differences in survival rate after two weeks of waterlogging between the two haplotypes. Among them, 61 inbred line materials are SNP 27039148(A / A)Or known as the Hap1 allele genotype, 503 materials are SNPs 27039148(G / G) Or known as the Hap2 allele genotype. Compared with the Hap1 haplotype, the average waterlogging survival rate of the Hap2 haplotype inbred line materials increased by 25% (p = 3.4E-09, Figure 4 ), so Hap2 is the excellent haplotype of qWT1.1. The Hap2 haplotype accounted for 89%, indicating that breeders indirectly selected the excellent haplotype Hap2 of qWT1.1 during the breeding process. On the other hand, it also reflects the value of qWT1.1 in the breeding process.

[0074] At the same time, qWT1.1 is a pleiotropic gene locus. Under waterlogging stress, its excellent haplotype HAP2 can significantly increase the number of adventitious roots, root dry weight and root length. Compared with the Hap1 haplotype, the average number of adventitious roots of the Hap2 haplotype inbred line materials increased by 1.31 (p = 7.2E-09), the average root length increased by 1.96 cm (p = 0.00012), and the average root dry weight increased by 0.02 g (p = 0.0018)( Figure 5 ). In terms of plant type-related traits, under waterlogging stress, compared with the Hap1 haplotype, the average plant height of the Hap2 haplotype inbred line materials decreased by 7.77 cm (p = 0.01), the ear position decreased by 8.37 cm on average (p = 2E-05), the number of male spike branches decreased by 2.42 on average (p = 2.1E-05), and the male spike length decreased by 1.53 cm on average (p = 0.0052)( Figure 6 ). In terms of yield-related traits, under waterlogging stress, compared with the Hap1 haplotype, the average grain weight per ear of the Hap2 haplotype inbred line materials increased by 8.48 g (p = 1.3E-05), and the ear weight increased by 7.46 g on average (p = 0.00064)( Figure 7 ).

[0075] Table 2 SNP loci significantly associated with waterlogging survival rate in the qWT1.1 interval

[0076]

[0077]

[0078] a Physical location of the qWT1.1 locus (V5), b Single nucleotide variation, c Minor allele, d Minor allele frequency.

[0079] Example 2:

[0080] Application of molecular marker primers for the excellent haplotype of the major QTL qWT1.1 for waterlogging tolerance at the seedling stage of maize:

[0081] Among 214 inbred lines and 1200 landrace germplasm populations, after waterlogging for one week, 24 families with a survival rate less than 30% and 28 families with a survival rate close to 100% were randomly selected. For each family, 8 plants were sampled and mixed, and DNA was extracted. Genotyping was performed using the KASP markers developed based on the best allele genotypes at the qWT1.1 locus. The results showed that among the 24 families with a survival rate less than 30%, all contained the unfavorable allele genotype Hap1, while the families with a survival rate close to 100% all belonged to the Hap2 allele genotype (Table 3). These results confirmed that the developed functional markers can be used for marker-assisted selection in the genetic improvement of waterlogging-tolerant lines, providing selection targets for creating new waterlogging-tolerant maize germplasms and breeding new waterlogging-tolerant varieties( Figure 8 ).

[0082] Table 3 The PARMS marker qWT1.1SR can be used for the identification and evaluation of waterlogging tolerance

[0083]

[0084]

[0085]

Claims

1. Use of a reagent for detecting the base at position 27,039,148 on chromosome 1 of the maize genome in the screening breeding of maize seedlings for waterlogging tolerance traits.

2. Use of a reagent for detecting the base at position 27,039,148 on chromosome 1 of the maize genome in the preparation of a kit for screening maize seedlings for waterlogging tolerance traits.

3. The application according to claim 1 or 2, characterized in that: If the base at position 27,039,148 on chromosome 1 of the maize genome is detected as G, then the maize is determined to be waterlogging-tolerant maize at the seedling stage.

4. The application according to claim 1 or 2, characterized in that: If the base at position 27,039,148 on chromosome 1 of the maize genome is detected as A, then the maize is determined to be waterlogging-sensitive maize at the seedling stage.

5. The application according to claim 1 or 2, characterized in that: The reagent described is a primer.

6. The application according to claim 5, wherein the primer is as follows: qWT1.1F : CAAACAAACATCAAAATCGGGTC, qWT1.1SR1 : GAAGGTGACCAAGTTCATGCTGGCATTGCTAACCTAACAACCC and qWT1.1SR2 : GAAGGTCGGAGTCAACGGATTCGGCATTGCTAACCTAACAACCT.

7. A method for screening breeding of maize seedlings for waterlogging tolerance traits, including detecting the base at position 27,039,148 on chromosome 1 of the maize genome using conventional methods in the art, and the conventional methods include but are not limited to: sequencing method, TaqMan probe method, AS-PCR method, molecular beacon method, high-resolution melting curve method, CAPS method, SNaPshot method, KASP method, PARMS method, gene chip method, mass spectrometry method.

Images