High-mobility group protein B group gene and application thereof

Abstract

The invention belongs to the technical field of biology, and particularly relates to a high-mobility group protein B group gene and application thereof. It is innovatively found that the high-mobility group protein B group gene can be used as a biomarker to be applied to preparation of products for identifying high-temperature-resistant red clover varieties. According to the application, the transcriptome data of the red clover under high temperature stress is utilized to perform SNP analysis, and a large number of available SNP molecular markers are found, so that a molecular basis is provided for further molecular marker-assisted high-temperature-resistant red clover variety breeding, and a reference is also provided for similar research of other plants.

Description

Technical Field

[0001] This application relates to the field of biotechnology, and specifically to high mobility group protein B genes and their applications. Background Art

[0002] With the rapid development of molecular biology, molecular marker technology has become one of the efficient technical means for germplasm resource identification and genetic relationship research due to its advantages such as simplicity, high polymorphism, and being unaffected by the growth environment. Single Nucleotide Polymorphism (SNP) refers to DNA sequence polymorphism caused by variations at the genomic nucleotide level, including single-base transitions, transversions, insertions, or deletions, etc. SNP is the third-generation molecular genetic marker technology that emerged in recent years following Restriction Fragment Length Polymorphism (RFLP) and satellite DNA. SNP markers can find markers related to traits through association analysis of populations and have become the mainstream marker technology. SNP is a very useful genetic marker and will play an important role especially in constructing genetic maps, genetic breeding, quantitative trait locus (QTL), etc.

[0003] Red clover (Trifolium pratense L.) is a perennial leguminous plant with a wide planting range, strong cold and moisture resistance, and rich nutrition. It is also a widely planted leguminous forage. However, due to its intolerance to high temperatures, the quality and utilization and promotion of red clover are severely affected. In addition, at present, the acquisition of large-scale SNP locus information mainly relies on genome sequencing and is generated along with sequence splicing and alignment, but this method is costly. Summary of the Invention

[0004] In view of the above-mentioned disadvantages of the prior art, the present invention provides a biomarker, high mobility group protein B gene, and its application.

[0005] To achieve the above object, the solution of this application is as follows: In the first aspect, the present invention provides the application of high mobility group protein B (HMGB) gene as a biomarker in the preparation of products for identifying heat-tolerant red clover varieties.

[0006] Optionally, the product includes reagents and / or kits.

[0007] Optionally, the reagents and / or kits are used to determine the base types of SNP loci of high mobility group protein B genes in biological samples of red clover.

[0008] It should be noted that in this application, the SNP locus of the high-mobility group protein B gene in the biological sample is located in the exon region, with the genomic sequence number NC_060059.1, specifically the base at position 606049.

[0009] Optionally, the biological sample is selected from leaves.

[0010] Optionally, if the base at position 606049 is guanine, the red clover is a high-temperature tolerant variety; if the base at position 606049 is adenine, the red clover is a high-temperature sensitive variety.

[0011] In a second aspect, the present invention also provides a reagent or kit for identifying high-temperature tolerant red clover varieties, and the reagent or kit includes a primer set for determining the base type of the SNP locus of the high-mobility group protein B gene in the biological sample of red clover.

[0012] Optionally, the SNP locus is the base at position 606049 in the exon region of the high-mobility group protein B gene NC_060059.1.

[0013] Optionally, the primer set includes an upstream amplification primer and a downstream amplification primer, and the nucleotide sequences of the upstream amplification primer and the downstream amplification primer are shown as SEQ ID NO: 1 and SEQ ID NO: 2 respectively.

[0014] In a third aspect, the present invention also provides a method for identifying high-temperature tolerant red clover varieties, including the following steps: S1. Extract the RNA of the red clover leaves to be identified, reverse transcribe the RNA to obtain cDNA; S2. Perform polymerase chain reaction amplification using the cDNA as a template; S3. Sequence the polymerase chain reaction amplification product to obtain a sequencing result; S4. Compare the sequencing result with the red clover reference gene, and determine the high-temperature tolerant red clover variety according to the comparison result.

[0015] Optionally, during the polymerase chain reaction amplification in step S2, the molar ratio of the upstream amplification primer and the downstream amplification primer used is 1-2:1-2.

[0016] Optionally, in step S2, the polymerase chain reaction amplification reaction conditions are as follows: first, treat at a temperature of 92 - 97°C for 2 - 5 min, then treat at a temperature of 92 - 97°C for 10 - 20 s, subsequently treat at a temperature of 58 - 62°C for 10 - 20 s, then treat at a temperature of 70 - 75°C for 10 - 20 s, and then treat at a temperature of 70 - 75°C for 3 - 6 min, and cycle 30 - 40 times.

[0017] Advantages of the present invention: This application utilizes the transcriptome data of Trifolium pratense under high-temperature stress for SNP analysis, discovers a large number of available SNP molecular markers, provides a molecular basis for further molecular marker-assisted breeding of heat-tolerant Trifolium pratense varieties, and also provides a reference for similar studies of other plants.

[0018] This application utilizes transcriptome information, combines core differential gene analysis and SNP analysis, screens a SNP locus of HMGB, and can use this gene as a screening basis to cultivate heat-tolerant Trifolium pratense varieties.

[0019] The comparative transcriptomics method of this application has the characteristics of low cost and fast speed. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] In order to more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required for use in the description of the embodiments or the prior art. Obviously, the following drawings are only some embodiments of the present invention. For those of ordinary skill in the art, without creative efforts, other drawings can be obtained based on the structures shown in these drawings.

[0021] Figure 1 It is a Venn diagram of core differential genes; Figure 2 It is a result diagram of SNP functional analysis. Number of Variants represents the number of mutations, and Variants type represents the type of mutation. The same applies hereinafter; Figure 3 It is a statistical chart of SNP positions. Number of Variants represents the number of mutations, and Variants Location represents the mutation position. intronic represents intron, exonic represents exon, intergenic represents intergenic region, downstream represents downstream, upstream represents upstream, and splicing represents intergenic region; Figure 4 It is a statistical chart of SNP mutant types. transversion represents transversion, and transition represents transition; Figure 5It is the result diagram of gel electrophoresis; Figure 6 It is the result diagram of comparison, and identity represents identification. Specific implementation manners

[0022] Next, the technical solutions in the embodiments of the present invention will be clearly and completely described in conjunction with the accompanying drawings in the embodiments of the present invention. Obviously, the described embodiments are only a part of the embodiments of the present invention, rather than all the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative efforts shall fall within the protection scope of the present invention.

[0023] In the following description, a large number of details are explored to provide a more thorough explanation of the embodiments of the present invention. However, it is obvious to those skilled in the art that the embodiments of the present invention can be implemented without these specific details.

[0024] (I) Transcriptome sequencing The red clover germplasms are screened by means of high-temperature stress treatment. The specific steps are as follows: Cultivate Honglong and Tp615 red clover at a day-night temperature of 25 / 22 °C for 40 days, and then carry out high-temperature stress treatment at a day-night temperature of 38 / 35 °C. Collect the leaf tissues at 0 h, 6 h, and 12 h after the high-temperature treatment, and screen out two red clover germplasms with different tolerances to high temperature. The high-temperature tolerant one is Honglong (HL), and the high-temperature sensitive one is the wild germplasm resource TP615.

[0025] Cultivate the seeds of the two red clover germplasm resources in a petri dish containing two layers of filter paper and 25 mL of deionized water in a plant growth chamber at a day-night temperature of 25 / 22 °C for 8 days to germinate; Then transplant the seedlings into flower pots (diameter 13.3 cm, height 5.6 cm) filled with a mixed nutrient soil (nutrient soil: vermiculite: perlite = 8:1:1, mass ratio). There are 15 seedlings in each flower pot, and all the flower pots are placed in a plant growth chamber (Jiangnan Instrument Factory, Ningbo, China; GHP-500) and cultivated at a day-night temperature of 25 / 22 °C for 40 days; Then set the day-night temperature of the plant growth chamber to 38 / 35 °C for high-temperature stress treatment. Collect the leaf tissues at 0 h, 6 h, and 12 h after the high-temperature treatment, wrap them with tin foil and immediately put them into liquid nitrogen for freezing preservation, and then extract RNA using a commercially available kit (Magen Biotechnology RNA lsolation Kit,) and send it to a biological company for transcriptome sequencing. Each treatment is repeated three times; The raw reads data after sequencing was quality controlled using fastp to filter out low-quality data, obtaining clean reads. The HISAT2 software was used to conduct alignment analysis based on the reference genome (the nucleotide sequence information of the HMGB gene found on NCBI). Core differential genes were screened using the criteria of standard |log2(fold change)| > 1 and adjusted P value < 0.05. The GATK4 software was used for SNP variant detection and finally data statistics were performed. The results are as Figures 1 to 4 shown.

[0026] As Figure 1 shown, a total of 3,104 core differential genes were detected through differential gene analysis.

[0027] As Figure 2 shown, statistical analysis through SNP function found that the main types were nonsynonymous SNV and synonymous SNV, with 279,731 and 244,362 respectively. It also included frameshift insertion, nonframeshift insertion, frameshift deletion, nonframeshift deletion, stopgain, and stoploss.

[0028] As Figure 3 shown, statistical analysis of SNP positions found that they mainly included exonic and intronic regions, as well as 5'UTR (UTR5), 3'UTR (UTR3), intergenic regions, upstream of genes, downstream of genes, and splicing sites.

[0029] As Figure 4 shown, statistical analysis of SNP mutation types found that the mutation types were divided into transversion and transition. Transversion refers to the substitution between purines and pyrimidines in base substitution (G<->T, C<->A, A<->T, C<->G), and transition is the substitution of one purine by another purine or one pyrimidine by another pyrimidine (T<->C, A<->G). Among them, the proportion of transition was 59.92%, and in addition, the proportions of G->T and G->A were 16.30% and 16.27% respectively.

[0030] Analysis was carried out by combining core differential genes and SNPs. Since exon mutations can cause changes in the base composition or arrangement order in the coding region, which will change the gene structure and further affect biological phenotypes and functions, while intron mutations only affect the mature processing of mRNA, the main screening range is the exon region of the gene. In the exon region, synonymous mutations and non-synonymous mutations are included. Synonymous mutations refer to the fact that due to the degeneracy of the genetic code, the substitution of a single base does not cause a change in amino acids. Non-synonymous mutations refer to the substitution of a single base that leads to a change in the corresponding encoded amino acid, thereby affecting the structure and function of the protein. Therefore, non-synonymous mutations in exons were selected for further analysis. The high mobility group protein B (HMGB) gene was screened out. Through analysis, it was found that the HMGB gene is located at genomic sequence number NC_060059.1. Specifically, the base at position 606049 was mutated from G to A. Compared with the reference genome sequence, the thermosensitive red clover had a mutation at this site, while the thermotolerant red clover did not have a mutation at this site.

[0031] (2) Verification of SNP sites of the HMGB gene (1) The nucleotide sequence information of the HMGB gene was found on NCBI, and primers were designed based on it (mainly around the SNP site, which included the SNP site). A fragment with a size of 1072 bp was designed. The designed upstream amplification primer and downstream amplification primer are shown in SEQ ID NO.1 and SEQ ID NO.2 respectively: Upstream amplification primer (F): TGCTCACCCAAAGCCAAACA; Downstream amplification primer (R): ATCACTTCCGCCCGAACTGC; (2) Specificity detection of SNP mutation screening primers Using red clover genomic DNA as a template for PCR amplification and 1% agarose gel electrophoresis detection, the specific steps are as follows: In the PCR process, the high-fidelity enzyme P520 (Novoprotein) was used for PCR fragment amplification. The PCR program was: pre-denaturation, 98 °C, 30 s; denaturation, 98 °C, 10 s; annealing, 65 °C, 5 s; extension, 72 °C, 10 s (denaturation, annealing, and extension for a total of 32 cycles); extension, 72 °C, 1 min; storage, 4 °C, 30 min. After the PCR reaction was completed, the product was detected by 1% agarose gel electrophoresis (electrophoresis conditions: 1×TAE electrophoresis buffer; 120 V, 30 min), and the results are as Figure 5 shown.

[0032] (3) Using the leaves of the high-temperature tolerant red dragon germplasm resource (HL) selected in (1) and the high-temperature sensitive wild germplasm resource TP615 as biological materials, RNA in the leaves was extracted using a commercially available kit (Magen Biotechnology RNA Isolation Kit, performed according to the manufacturer's instructions), and reverse transcription was carried out using a commercially available kit (Revert Aid First Stand cDNA Synthesis Kit (All-in-One First-Strand Synthesis MasterMix (with dsDNase), iscience, China)) to obtain cDNA; Using the cDNA as a template for polymerase chain reaction amplification, the amplification reaction system was: 2×Rapid Taq MasterMix 25 μL, upstream amplification primer F 1 μL, downstream amplification primer R 1 μL, cDNA 2 μL, and water 21 μL. The amplification reaction conditions were: first treated at 95°C for 3 min, then treated at 95°C for 15 s, followed by treatment at 60°C for 15 s, then treated at 72°C for 15 s, and then treated at 72°C for 5 min, with 35 cycles; The amplified PCR products were electrophoresed using 1% agarose gel electrophoresis, and the target band at the position of 372 bp was recovered. The recovered PCR products were sent to a biological company for Sanger sequencing, and the sequencing results were compared with the red clover reference genome (the nucleotide sequence information of the HMGB gene was found on NCBI, and primers were designed based on it (mainly around the SNP site, including the SNP site, and a fragment of 1071 bp in size was designed)), and the results were as Figure 6 shown.

[0033] As Figure 6 shown, the obtained mutated sites were consistent with the transcriptome sequencing results in (1). This result indicates that the SNP sites of the HMGB gene screened in this application can be used as molecular markers for the high-temperature adaptability of red clover, and can provide a certain theoretical basis for the breeding of high-temperature tolerant red clover varieties.

[0034] The above embodiments only exemplarily illustrate the principles and effects of the present invention, rather than limiting the present invention. Any person familiar with this technology can modify or change the above embodiments without departing from the spirit and scope of the present invention. Therefore, all equivalent modifications or changes completed by those with ordinary knowledge in the technical field without departing from the spirit and technical idea disclosed by the present invention should still be covered by the claims of the present invention.

Claims

1. Use of high-mobility group protein B family genes as biomarkers in the preparation of products for identifying heat-tolerant red clover varieties.

2. The application according to claim 1, characterized in that, The products include reagents and / or kits.

3. The application according to claim 2, characterized in that, The reagents and / or kits are used to determine the base types of SNP sites of high-mobility group protein B family genes in biological samples of red clover.

4. The application according to claim 3, characterized in that The biological samples are selected from leaves; and / or, the SNP site is located at the 606049th base in the exon region of high-mobility group protein B family gene NC_060059.

1.

5. The application according to claim 4, characterized in that If the 606049th base is guanine, the red clover is a heat-tolerant variety; if the 606049th base is adenine, the red clover is a heat-sensitive variety.

6. A reagent or kit for identifying heat-tolerant red clover varieties, characterized in that, The reagent or kit includes a primer set for determining the base types of SNP sites of high-mobility group protein B family genes in biological samples of red clover.

7. The reagent or kit for identifying heat-tolerant red clover varieties according to claim 6, wherein The primer set includes an upstream amplification primer and a downstream amplification primer, and the nucleotide sequences of the upstream amplification primer and the downstream amplification primer are shown in SEQ ID NO: 1 and SEQ ID NO: 2 respectively.

8. A method for identifying heat-tolerant red clover varieties, characterized in that, Comprising the following steps: S1. Extract the RNA of the red clover leaves to be identified, reverse transcribe the RNA to obtain cDNA; S2. Perform polymerase chain reaction amplification using the cDNA as a template; S3. Sequence the polymerase chain reaction amplification product to obtain a sequencing result; S4. Compare the sequencing result with the red clover reference gene, and determine the heat-tolerant red clover variety according to the comparison result.

9. The method according to claim 8, wherein During the polymerase chain reaction amplification process in step S2, the molar ratio of the upstream amplification primer and the downstream amplification primer used is 1-2:1-2.

10. The method according to claim 8, wherein In step S2, the polymerase chain reaction amplification reaction conditions are: first treat at 92-97 °C for 2-5 min, then treat at 92-97 °C for 10-20 s, then treat at 58-62 °C for 10-20 s, then treat at 70-75 °C for 10-20 s, and then treat at 70-75 °C for 3-6 min, and cycle 30-40 times.

Images