A SNP molecular marker combination related to the plant height trait of maize, a gene chip and application thereof

By providing 21 SNP molecular marker combinations and gene chips, the problem of multi-gene synergistic regulation of maize plant height trait has been solved, enabling precise identification and improvement of maize plant height trait and providing an efficient breeding tool.

CN120400416BActive Publication Date: 2025-11-11HAINAN XINYU TECH CO LTD
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202510897159.6
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-07-01
Publication Date
2025-11-11
Estimated Expiration
2045-07-01

AI Technical Summary

Technical Problem

Existing technologies are insufficient to systematically analyze the multi-gene synergistic regulation of maize plant height at the whole genome level, making it difficult for traditional breeding methods to effectively improve plant height.

Method used

A combination of 21 SNP molecular markers, based on the physical location determined by the B73 whole genome sequence V4.0, combined with gene chips and kits, is provided for genome-wide association analysis and identification of maize plant height traits.

Benefits of technology

It enables precise identification and improvement of maize plant height traits, provides a more efficient molecular marker-assisted selection breeding tool, and can directly determine maize plant height phenotype and develop related locus chips.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120400416B_ABST
    Figure CN120400416B_ABST
Patent Text Reader

Abstract

This invention provides a combination of SNP molecular markers related to maize plant height, a gene chip, and their applications, relating to the field of plant molecular breeding technology. It includes 21 SNP molecular markers, as shown in SNP1 to SNP21. This invention reveals the genetic variation characteristics of maize plant height at the haplotype level. The developed SNP molecular marker combination can be used for precise identification of plant height genotypes in maize germplasm resources and provides a novel tool for marker-assisted selection breeding. Using molecular markers to identify the genotypes of maize dwarf-related loci to determine the maize plant height phenotype is more efficient and direct. Furthermore, the haplotype markers for the plant height phenotype screened by this invention can be used for further development of maize plant height-related locus chips.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of plant molecular breeding technology, and in particular to a combination of SNP molecular markers, a gene chip, and their applications related to maize plant height. Background Technology

[0002] Maize plant height, as an important agronomic trait, is closely related to photosynthetic efficiency and lodging resistance; appropriately reducing plant height can increase planting density. Maize plant height mainly depends on the number and length of internodes on the stalk. Previous researchers have conducted extensive basic research on maize plant height, and some genes involved in plant hormone synthesis and signal transduction, cell wall metabolism, and transcriptional regulation have been cloned. For example, in the area related to plant hormones... Dwarf8 The gene is one of the earliest cloned maize plant height genes, encoding the DELLA protein in the gibberellin signaling pathway. Dwarf8 Loss-of-function mutations in genes lead to stunted growth, while overexpression results in increased plant height; regarding cell wall metabolism, Brachytic2 The gene encodes a P-glycoprotein involved in the deposition of cellulose in the cell wall; in terms of transcriptional regulation, ZmNAC128 The gene encodes an NAC family transcription factor that affects plant height by regulating the expression of genes related to cell elongation.

[0003] However, maize plant height, as a typical quantitative trait controlled by multiple genes, exhibits a small-scale cumulative effect of multiple genes and gene-environment interactions in its genetic regulation. Current research on plant height still faces challenges such as difficulties in phenotypic identification due to environmental disturbances, insufficient analysis of the genetic regulatory network, and the lack of elucidation of the mechanisms of multiple gene interactions. These limitations make it difficult to achieve effective improvement in plant height using traditional breeding methods based on single or a few loci. Therefore, systematically elucidating the synergistic regulatory mechanisms of multiple genes at the whole-genome level and applying them to the creation of dwarf materials has become a crucial scientific problem urgently needing to be solved in the field of maize genetics and breeding.

[0004] In view of this, the present invention is hereby proposed. Summary of the Invention

[0005] One of the objectives of this invention is to provide a combination of SNP molecular markers associated with maize plant height, in order to solve the technical problem in the prior art of lacking molecular marker combinations that can systematically analyze the synergistic regulation of maize plant height by multiple genes at the whole genome level.

[0006] The second objective of this invention is to provide a gene chip related to maize plant height.

[0007] The third objective of this invention is to provide a reagent kit.

[0008] The fourth objective of this invention is to provide the application of any one of the above-mentioned SNP molecular marker combinations, the above-mentioned gene chips, and the above-mentioned kits in genome-wide association analysis of maize plant height.

[0009] The fifth objective of this invention is to provide the application of any one of the above-mentioned SNP molecular marker combinations, the above-mentioned gene chip, and the above-mentioned kit in identifying maize plant height traits.

[0010] The sixth objective of this invention is to provide a method for identifying or assisting in determining the trait of maize plant height.

[0011] The seventh objective of this invention is to provide the application of the above-mentioned method in maize breeding.

[0012] In order to achieve the above-mentioned objectives of the present invention, the following technical solution is adopted:

[0013] In a first aspect, the present invention provides a combination of SNP molecular markers related to maize plant height, the combination of SNP molecular markers comprising 21 SNP molecular markers, as shown in SNP1~SNP21; the physical location information of SNP1~SNP21 is as follows:

[0014] The genomic location of SNP1 is Chr4:7358662 bp;

[0015] The genomic location of SNP2 is Chr4:7359443 bp;

[0016] The genomic location of SNP3 is Chr4:7359479 bp;

[0017] The genomic location of SNP4 is Chr4:7379846 bp;

[0018] The genomic location of SNP5 is Chr4:7391269 bp;

[0019] The genomic location of SNP6 is Chr4:7391449 bp;

[0020] The genomic location of SNP7 is Chr4:7395733 bp;

[0021] The genomic location of SNP8 is Chr4:7396421 bp;

[0022] The genomic location of SNP9 is Chr4:7396573 bp;

[0023] The genomic location of SNP10 is Chr4:7396586 bp;

[0024] The genomic location of SNP11 is Chr4:7396606 bp;

[0025] The genomic location of SNP12 is Chr4:7396637 bp;

[0026] The genomic location of SNP13 is Chr4:7396642 bp;

[0027] The genomic location of SNP14 is Chr4:7396685 bp;

[0028] The genomic location of SNP15 is Chr4:7396819 bp;

[0029] The genomic location of SNP16 is Chr4:7397835 bp;

[0030] The genomic location of SNP17 is Chr4:7398294 bp;

[0031] The genomic location of SNP18 is Chr4:7400197 bp;

[0032] The genomic location of SNP19 is Chr4:7400437 bp;

[0033] The genomic location of SNP20 is Chr4:7400597 bp;

[0034] The genomic location of SNP21 is Chr4:7401574 bp;

[0035] The physical location information of the 21 SNP molecular markers was determined based on the whole genome sequence V4.0 of B73.

[0036] Secondly, the present invention provides a gene chip related to maize plant height, including probes and / or primers for detecting the above-mentioned SNP molecular marker combinations.

[0037] Furthermore, the gene chip is a solid-phase chip.

[0038] Thirdly, the present invention provides a kit comprising probes and / or primers for detecting the above-described SNP molecular marker combinations.

[0039] Fourthly, the present invention provides the application of any one of the above-mentioned SNP molecular marker combinations, the above-mentioned gene chip, and the above-mentioned kit in genome-wide association analysis of maize plant height.

[0040] Fifthly, the present invention provides the application of any one of the above-mentioned SNP molecular marker combinations, the above-mentioned gene chip, and the above-mentioned kit in identifying the maize plant height trait.

[0041] In a sixth aspect, the present invention provides a method for identifying or assisting in the determination of maize plant height trait, comprising detecting the genotype of the above-mentioned SNP molecular marker combination in a maize sample to be tested, and identifying or assisting in the determination of maize plant height trait based on the genotype of the maize sample to be tested.

[0042] When the haplotype sequence formed by SNP1~SNP21 in sequence is such as SEQ ID NO.1 or SEQ ID NO.2, the maize plant height trait is characterized by short stalks.

[0043] Furthermore, the corn in question is a maize inbred line.

[0044] In a seventh aspect, the present invention provides the application of the above-described method in maize breeding.

[0045] Furthermore, the maize breeding includes the selection of maize plant height traits.

[0046] This invention provides a combination of SNP molecular markers associated with maize plant height. This invention reveals the genetic variation characteristics of maize plant height at the haplotype level. The developed SNP molecular marker combination can be used for precise identification of plant height genotypes in maize germplasm resources and provides a novel tool for marker-assisted selection breeding. Using molecular markers to identify the genotypes of maize dwarf-related loci to determine the maize plant height phenotype is more efficient and direct. Furthermore, the haplotype markers for the plant height phenotype screened by this invention can be used for further development of microarrays for maize plant height-related functional loci. Attached Figure Description

[0047] To more clearly illustrate the specific embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the specific embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are some embodiments of the present invention. For those skilled in the art, other drawings can be obtained from these drawings without creative effort.

[0048] Figure 1 This is a correlation analysis diagram between the mixed linear model analysis markers and maize plant height provided in Embodiment 1 of the present invention;

[0049] Figure 2 This is a candidate gene expression map provided in Example 2 of the present invention;

[0050] Figure 3 The haplotype typing results of 21 SNP sites provided in Embodiment 3 of the present invention. Detailed Implementation

[0051] Unless otherwise defined herein, the scientific and technical terms used in conjunction with this invention shall have the meanings commonly understood by one of ordinary skill in the art. The meaning and scope of terms shall be clear; however, in any case of potential ambiguity, the definitions provided herein shall prevail over any dictionary or foreign definitions. In this application, unless otherwise stated, the use of "or" means "and / or". Furthermore, the use of the term "comprising" and other forms is non-limiting.

[0052] Generally, the nomenclature and techniques used in cell and tissue culture, molecular biology, immunology, microbiology, genetics, and protein and nucleic acid chemistry and hybridization, together with those described herein, are those well-known and commonly used in the art. Unless otherwise stated, the methods and techniques of the present invention are generally carried out according to conventional methods well-known in the art and described in various general and more specific references, which are cited and discussed throughout this specification. Enzymatic reactions and purification techniques are carried out according to the manufacturer's instructions, as commonly practiced in the art, or as described herein. The nomenclature, laboratory procedures, and techniques used in analytical chemistry, synthetic organic chemistry, and medical and medicinal chemistry, together with those described herein, are those well-known and commonly used in the art.

[0053] The technical solution of the present invention will be clearly and completely described below with reference to the embodiments. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0054] Based on the information of 35,985 SNP sites and plant height phenotype data in 484 important maize parental lines, this invention conducted genome-wide association analysis to obtain SNP markers that are significantly associated with plant height. Combined with transcriptome data, functional genes were predicted. Subsequently, through linkage disequilibrium analysis, a group of haplotype markers closely linked to maize plant height-related sites were screened out. This group of haplotype molecular markers can be used for maize plant height identification and improvement.

[0055] Based on this, the present invention provides a combination of SNP molecular markers related to maize plant height, the combination of SNP molecular markers including 21 SNP molecular markers, as shown in SNP1~SNP21; the physical location information of SNP1~SNP21 is as follows:

[0056] The genomic location of SNP1 is Chr4:7358662 bp;

[0057] The genomic location of SNP2 is Chr4:7359443 bp;

[0058] The genomic location of SNP3 is Chr4:7359479 bp;

[0059] The genomic location of SNP4 is Chr4:7379846 bp;

[0060] The genomic location of SNP5 is Chr4:7391269 bp;

[0061] The genomic location of SNP6 is Chr4:7391449 bp;

[0062] The genomic location of SNP7 is Chr4:7395733 bp;

[0063] The genomic location of SNP8 is Chr4:7396421 bp;

[0064] The genomic location of SNP9 is Chr4:7396573 bp;

[0065] The genomic location of SNP10 is Chr4:7396586 bp;

[0066] The genomic location of SNP11 is Chr4:7396606 bp;

[0067] The genomic location of SNP12 is Chr4:7396637 bp;

[0068] The genomic location of SNP13 is Chr4:7396642 bp;

[0069] The genomic location of SNP14 is Chr4:7396685 bp;

[0070] The genomic location of SNP15 is Chr4:7396819 bp;

[0071] The genomic location of SNP16 is Chr4:7397835 bp;

[0072] The genomic location of SNP17 is Chr4:7398294 bp;

[0073] The genomic location of SNP18 is Chr4:7400197 bp;

[0074] The genomic location of SNP19 is Chr4:7400437 bp;

[0075] The genomic location of SNP20 is Chr4:7400597 bp;

[0076] The genomic location of SNP21 is Chr4:7401574 bp;

[0077] The physical location information of the 21 SNP molecular markers was determined based on the whole genome sequence V4.0 of B73.

[0078] This invention reveals the genetic variation characteristics of maize plant height at the haplotype level. The developed SNP molecular marker combination can be used for the precise identification of plant height genotypes in maize germplasm resources and provides a novel tool for molecular marker-assisted selection breeding.

[0079] Genotypes of the research population obtained by maize solid-phase microarray were used to conduct genome-wide association analysis of maize plant height and predict candidate genes. This not only extended the application of solid-phase microarrays but also uncovered new candidate genes, laying a foundation for the analysis of the genetic basis of maize plant height.

[0080] In addition, the research materials of this invention are parental inbred lines of major domestic varieties, and the genes / locus studied can be directly applied to variety screening and improvement.

[0081] Using molecular markers to identify the genotypes of maize dwarf-related loci to determine the phenotype of maize plant height is more efficient and direct. Furthermore, the haplotype markers for the plant height phenotype screened in this invention can be used for further development of microarrays for maize plant height-related functional loci.

[0082] According to another aspect of the present invention, a gene chip related to maize plant height trait is also provided, including probes and / or primers for detecting the above-mentioned SNP molecular marker combinations.

[0083] In some specific implementations, the gene chip is a solid-phase chip.

[0084] According to another aspect of the present invention, a kit is also provided, comprising probes and / or primers for detecting the above-described SNP molecular marker combinations.

[0085] According to another aspect of the present invention, the application of any one of the above-described SNP molecular marker combinations, the above-described gene chip, and the above-described kit in genome-wide association analysis of maize plant height is also provided.

[0086] According to another aspect of the present invention, the application of any one of the above-described SNP molecular marker combination, the above-described gene chip, and the above-described kit in identifying the maize plant height trait is also provided.

[0087] According to another aspect of the present invention, a method for identifying or assisting in the determination of maize plant height trait is also provided, comprising detecting the genotype of the above-mentioned SNP molecular marker combination in a maize sample to be tested, and identifying or assisting in the determination of maize plant height trait based on the genotype of the maize sample to be tested;

[0088] When the haplotype sequence formed by SNP1~SNP21 in sequence is such as SEQ ID NO.1 or SEQ ID NO.2, the maize plant height trait is characterized by short stalks.

[0089] In some specific implementations, the corn is a maize inbred line.

[0090] According to another aspect of the present invention, the application of the above-described method in maize breeding is also provided.

[0091] In some specific implementations, the maize breeding includes the selection of maize plant height traits.

[0092] The present invention will be further illustrated by the following examples. Unless otherwise specified, the materials in the examples are prepared according to existing methods or purchased directly from the market.

[0093] Example 1: Genome-wide association analysis of maize plant height and validation at the chr4_7359479 locus.

[0094] 1. Phenotypic Acquisition

[0095] In 2024, 484 core inbred lines from various maize-producing regions across China were planted in Xinxiang, Henan Province, during the peak season in the Huang-Huai-Hai maize-producing region. The planting density was 4,500 plants per mu (approximately 0.067 hectares), with each inbred line planted in one row (3.5 meters long) with 15 plants per row. Three biological replicates were set up using a completely randomized block design. After the plants had completely shed pollen and reached a fixed height, the plant height and ear height of the 1,452 rows of maize inbred lines were investigated. Eight uniform plants were surveyed per row, and the parental MY73 variety T1932 was planted every 10 rows to correct for differences between plots.

[0096] 2. Genotyping

[0097] Leaves from 484 maize inbred lines were sampled, and DNA was extracted using the alkaline lysis method. The genotypes of the 484 inbred lines were identified using the high-density gene chip Maize 50K (50K SNP) following the standard procedure of Illumina Infinium gene chip detection. A total of 35,985 SNP markers covering the entire genome were obtained.

[0098] 3. Correlation Analysis

[0099] Using TASSEL 5.0 software, a minimum allele frequency of 0.05 was set for quality control. Principal component analysis (PCA) and the construction of a phylogenetic matrix were used to obtain covariate data for genome-wide association analysis (GWAS). First, the PCA results were used as covariates for population structure in a general linear model analysis. The quantile-quantile plot showed that points starting from 0 were consistently above the diagonal, indicating false positives and suggesting that the GLM model was not suitable. Subsequently, a mixed linear model (population structure + phylogenetic relationships) was attempted to analyze the association between the markers and maize plant height.

[0100] y = Xβ + Qυ + Zμ + ε;

[0101] Where y is the phenotypic observation, X is the SNP genotype, β is the SNP effect, Q is the population structure matrix, υ is the population structure effect, Z is the kinship matrix, μ is the random effect, and ε is the residual, such as Figure 1 As shown, the Manhattan plot (left) and the QQ plot (right) are plotted. The left plot represents a scatter plot showing the association between plant height (PH, Plant Height) and SNP loci in the GWAS output of the FarmCPU mixed linear progression model for plant height (PH, Plant Height). (The horizontal axis represents the physical location of the SNP loci on chromosomes 1-10, and the vertical axis represents the statistical significance, specifically -log). 10 (p-value), the larger the value, the smaller the p-value, indicating that the SNP site is more likely to be associated with plant height. The right figure is a QQ plot. Starting from 0, the points are basically located on the diagonal. After the value is greater than 3, the points begin to deviate from the straight line and curve upward, indicating that the false positives and false negatives are well controlled, indicating that the FarmCPU model is suitable.

[0102] 4. Functional gene prediction

[0103] According to the results of the mixed linear model, the SNP at position 7359479 on chromosome 4 was significantly associated with the plant height phenotype (p-value = 2.02 × 10⁻⁶). -7 Based on the reference genome sequence of inbred line B73, seven genes potentially related to plant height were identified within a 100kb range upstream and downstream of this SNP: Zm00001d048896, Zm00001d048898, Zm00001d048899, Zm00001d048901, Zm00001d048902, Zm00001d048903, and Zm00001d048904. According to published RNA-seq data, five of these genes are not expressed in the stems, leaving Zm00001d048899 and Zm00001d048902 as candidate genes. The expression profiles of these candidate genes are shown below. Figure 2 As shown, Zm00001d048899 is functionally labeled as encoding a HAV22-like protein, which has been reported to be related to plant stress resistance. Zm00001d048902 is functionally labeled as encoding a KMS1-like vacuolar membrane protein, which may be related to substance transport.

[0104] 4. Site verification

[0105] Based on the genotyping results of the SNP at position 7359479 on chromosome 4, 484 inbred lines were divided into two groups and t-tests were performed. As shown in Table 1, the difference in plant height between the two groups of inbred lines was extremely significant (p-value = 1.14 × 10-4), indicating that this locus is associated with plant height. Genotyping at this locus can, to a certain extent, determine and improve the plant height of inbred lines.

[0106] Table 1. Results of SNP_7359479 genotyping t-test

[0107]

[0108] Example 2: Development of haplotype markers for plant height-related loci from Example 1

[0109] (1) Download the SNP genotype information of 200 kb upstream and downstream of the chr4_7359479 locus in 540 maize inbred lines of the maize-related population from the Maizego website (http: / / www.maizego.org / ), totaling 3742 SNP variant sites.

[0110] (2) After saving the 3742 SNP gene information from 540 inbred lines as a hapmap format file, linkage disequilibrium analysis was performed using the software TASSEL5. Linked SNP sites with a correlation coefficient r2 (value between 0 and 1, indicating the degree of linkage between two SNPs, and equal to 1 indicates that the two SNPs are completely linked) greater than 0.64 were calculated, as shown in Table 2. A total of 20 SNP sites closely linked to this site were obtained.

[0111] Table 2

[0112]

[0113] (3) Genotypes of the above 21 SNP loci were extracted from 540 inbred lines, and haplotype analysis was performed using Haploview software to obtain three haplotype groups Hap1~3 (e.g. Figure 3 As shown in the figure, Hap2 and Hap3 are closely linked to the maize plant height-associated locus (chr4_7359479) dwarf genotype (C). The SNP locus information is as follows:

[0114] The genomic location of SNP1 is Chr4:7358662 bp;

[0115] The genomic location of SNP2 is Chr4:7359443 bp;

[0116] The genomic location of SNP3 is Chr4:7359479 bp;

[0117] The genomic location of SNP4 is Chr4:7379846 bp;

[0118] The genomic location of SNP5 is Chr4:7391269 bp;

[0119] The genomic location of SNP6 is Chr4:7391449 bp;

[0120] The genomic location of SNP7 is Chr4:7395733 bp;

[0121] The genomic location of SNP8 is Chr4:7396421 bp;

[0122] The genomic location of SNP9 is Chr4:7396573 bp;

[0123] The genomic location of SNP10 is Chr4:7396586 bp;

[0124] The genomic location of SNP11 is Chr4:7396606 bp;

[0125] The genomic location of SNP12 is Chr4:7396637 bp;

[0126] The genomic location of SNP13 is Chr4:7396642 bp;

[0127] The genomic location of SNP14 is Chr4:7396685 bp;

[0128] The genomic location of SNP15 is Chr4:7396819 bp;

[0129] The genomic location of SNP16 is Chr4:7397835 bp;

[0130] The genomic location of SNP17 is Chr4:7398294 bp;

[0131] The genomic location of SNP18 is Chr4:7400197 bp;

[0132] The genomic location of SNP19 is Chr4:7400437 bp;

[0133] The genomic location of SNP20 is Chr4:7400597 bp;

[0134] The genomic location of SNP21 is Chr4:7401574 bp;

[0135] When the above SNP markers, arranged in ascending order of position, form the haplotype TTCGAATATATTATCTCAACT (SEQ ID NO.1) or TTCAGCCCCCCGGCACTGGTG (SEQ ID NO.2), then the dwarf functional genotype is present. The physical location of the SNP locus is determined based on the B73 whole genome sequence version 4.0.

[0136] Example 3 verifies the haplotype marker of Example 2.

[0137] 1. In 2024, 484 of the same inbred lines were planted in Fengcheng, Liaoning Province, during the peak maize production season in Northeast China. Three biological replicates were set up and a completely randomized block design was adopted. After the plants had completely shed pollen and the plant height was fixed, data on plant height and ear height of maize inbred lines were collected from 1,452 rows. Eight uniform plants were surveyed in each row, and the parent of the Xianyu 335 variety PH6WC was planted every 10 rows to correct for differences between plots.

[0138] 2. Based on the haplotype markers of Example 2, the 484 inbred lines were divided into two groups, as shown in Table 3. The differences between the two groups of inbred lines were extremely significant (p-value = 2.92 × 10⁻⁶). -5 This indicates that the haplotype marker is associated with plant height, and the genotype identification of this haplotype marker can, to a certain extent, determine and improve the plant height of inbred lines.

[0139] Table 3 Results of haplotype t-test

[0140]

[0141] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some or all of the technical features; and these modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention.

Claims

1. The application of a reagent for detecting SNP molecular marker combinations associated with maize plant height in the identification or auxiliary identification of maize plant height traits, characterized in that, The SNP molecular marker combination consists of 21 SNP molecular markers, as shown in SNP1 to SNP21; the physical location information of SNP1 to SNP21 is as follows: The genomic location of SNP1 is Chr4:7358662 bp; The genomic location of SNP2 is Chr4:7359443 bp; The genomic location of SNP3 is Chr4:7359479 bp; The genomic location of SNP4 is Chr4:7379846 bp; The genomic location of SNP5 is Chr4:7391269 bp; The genomic location of SNP6 is Chr4:7391449 bp; The genomic location of SNP7 is Chr4:7395733 bp; The genomic location of SNP8 is Chr4:7396421 bp; The genomic location of SNP9 is Chr4:7396573 bp; The genomic location of SNP10 is Chr4:7396586 bp; The genomic location of SNP11 is Chr4:7396606 bp; The genomic location of SNP12 is Chr4:7396637 bp; The genomic location of SNP13 is Chr4:7396642 bp; The genomic location of SNP14 is Chr4:7396685 bp; The genomic location of SNP15 is Chr4:7396819 bp; The genomic location of SNP16 is Chr4:7397835 bp; The genomic location of SNP17 is Chr4:7398294 bp; The genomic location of SNP18 is Chr4:7400197 bp; The genomic location of SNP19 is Chr4:7400437 bp; The genomic location of SNP20 is Chr4:7400597 bp; The genomic location of SNP21 is Chr4:7401574 bp; The physical location information of the 21 SNP molecular markers is determined based on the whole genome sequence V4.0 of B73. When the haplotype sequence formed by the SNP1 to SNP21 is as shown in SEQ ID NO.1 or SEQ ID NO.2, the maize plant height trait is short.

2. A method for identifying or assisting in the identification of maize plant height, characterized in that, This includes detecting the genotype of the SNP molecular marker combination as described in claim 1 in a maize sample to be tested, and identifying or assisting in the identification of maize plant height traits based on the genotype of the maize sample to be tested; When the haplotype sequence formed by SNP1~SNP21 in sequence is as shown in SEQ ID NO.1 or SEQ ID NO.2, the maize plant height trait is characterized by short stalks.

3. The method according to claim 2, characterized in that, The maize in question is a maize inbred line.

4. The application of the method according to claim 2 or 3 in maize breeding, characterized in that, The maize breeding mentioned refers to the selection of maize plant height traits.

Citation Information

Patent Citations

  • SNP (Single Nucleotide Polymorphism) significantly associated with corn plant height under different moisture conditions and application thereof

    CN116083633A

  • Compositions and methods of plant breeding using high density marker information

    WO2008021413A1