InDel marker closely linked with sweet-glutinous same-grain character of corn ear and application of InDel marker

By developing InDel markers closely linked to the sweet and glutinous traits of corn ears, primer pairs were designed using the 73 bp insertion sequence position of chromosome 9 of the B73-V4 genome, the early rapid screening of sweet and glutinous corn materials was achieved, and the sweetness and glutinousness problems of existing fresh corn varieties were solved, and breeding efficiency and accuracy were improved.

CN120400418AActive Publication Date: 2025-08-01INST OF SPECIAL ANIMAL & PLANT SCI OF CAAS

Patent Information

Application Number
CN202510900586.5
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-07-01
Publication Date
2025-08-01
Estimated Expiration
2045-07-01

AI Technical Summary

Technical Problem

The existing fresh corn varieties cannot meet the needs of high sweetness and strong glutinousness at the same time, and the separation ratio of sweet and glutinous grains and glutinous grains is unstable, and the harvesting period is short, which leads to economic losses and labor pressure from farmers and enterprises. The core regulatory genes are not cloned, and the development of molecular markers is lagging, which restricts the precise genetic improvement and industrial application of sweet and glutinous grain traits.

Method used

InDel marker closely linked to the sweet and glutinous corn ears, and primer pairs were designed using the 73 bp insertion sequence at chromosome 12126328 bp position of B73-V4 genome, and the germplasm resources of sweet and glutinous corn were quickly screened through PCR amplification and gel electrophoresis analysis.

Benefits of technology

It has achieved early rapid screening of sweet and glutinous corn materials, improved breeding efficiency, reduced production costs, and met the breeding needs of new varieties of sweet and glutinous corn.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120400418A_ABST
    Figure CN120400418A_ABST
Patent Text Reader

Abstract

The invention discloses an InDel marker closely linked with the sweet-glutinous homograin character of corn ears, a corn B73-V4 genome is used as a reference genome, the marker is a <-> / insertion sequence of 73 bp located at the position of 12126328 bp of a No.9 chromosome, and the nucleotide sequence of the insertion sequence is as shown in SEQ ID NO.1. The InDel marker closely linked with the sweet-glutinous homograin character of the corn ears has the advantages that the InDel marker closely linked with the sweet-glutinous homograin character of the corn ears is obtained; the InDel marker provided by the invention can be used for rapidly screening out a corn material containing a sweet-waxy homograin gene in the early growth stage of corn, and can also be used for molecular marker-assisted breeding of fresh corn. By adopting the InDel marker and the screening method provided by the invention, the screening accuracy is high, and by using the marker and the screening method, the production cost is saved, and the breeding efficiency is improved.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This application relates to the field of molecular genetics technology. Specifically, it relates to an InDel marker closely linked to the sweet and waxy same-grain trait of corn ears and its application. Background Art

[0002] Fresh-eating corn refers to corn varieties that are picked during the milk-ripe period for processing or fresh consumption, also known as fruit and vegetable corn. According to the starch composition and flavor characteristics, it is mainly divided into three categories: sweet corn, waxy corn, and sweet plus waxy corn. Sweet corn is famous for its high sugar content. Its soluble sugar content ranges from 12% to 22%, and the proportion of amylopectin is less than 5%, presenting a sweet, crisp and refreshing taste characteristic; waxy corn has a typical high amylopectin structure, with a content of more than 97%, and the sugar content is generally less than 10%, having a unique soft and glutinous texture; sweet plus waxy corn combines the genetic characteristics of sweet corn and waxy corn through hybridization to achieve precise chimerism of sweet grains and waxy grains on the same ear. The two types of grains usually appear in stable ratios such as 1:3 or 7:9, combining the taste advantages of both parental lines.

[0003] The existing three mainstream types of fresh-eating corn have the following deficiencies: First, sweet corn and waxy corn cannot simultaneously meet consumers' demands for two flavors, and there is an urgent need for excellent corn germplasm resources with high sweetness and strong glutinousness; second, the existing sweet plus waxy corn has both sweet grains and waxy grains on the same ear, and there is a certain segregation ratio between sweet grains and waxy grains, with the disadvantages that sweet grains are not glutinous and waxy grains are not sweet. Third, the harvesting periods of the existing three types of fresh-eating corn varieties are generally relatively short (only 3 - 5 days). When extreme weather prevents harvesting in the field, it will cause greater economic losses to farmers and fresh-eating corn planting enterprises, and at the same time bring greater short-term concentrated labor pressure to processing enterprises.

[0004] To solve the above practical problems in the development of the fresh-eating corn industry, the Fresh-Eating Corn Genetic Breeding Research Group of the Institute of Special Wild Economic Animal and Plant Sciences, Chinese Academy of Agricultural Sciences, through a large amount of collection, identification, and evaluation of fresh-eating corn germplasm resources, discovered a breakthrough germplasm resource with sweet and waxy same-grain characteristics that is different from the existing three major types of fresh-eating corn (sweet corn, waxy corn, sweet plus waxy corn) (i.e., the sweet and waxy same-grain corn parent B2595T used in this application). All the grains of this new germplasm have relatively high sweetness (above 15 degrees) and relatively high glutinousness (the amylopectin content can reach 89%), achieving a breakthrough in sweet and waxy same-grain for the first time. In particular, the fresh ear harvesting period of the new germplasm can reach more than 15 days, which is a revolutionary new germplasm of fresh-eating corn.

[0005] The breakthrough germplasm resources with sweet and waxy kernels in the same ear have significant innovation and extremely high commercial development value. However, its core regulatory genes have not been cloned, and the development of molecular markers lags behind, seriously restricting the precise genetic improvement and industrial application of this trait. Therefore, in order to further accelerate the breeding process of a series of new varieties of fresh-eating corn with sweet and waxy kernels in the same ear, it is necessary to carry out QTL mapping of the genes for sweet and waxy kernels in the same ear in maize and develop molecular markers highly linked to the genes for sweet and waxy kernels in the same ear, so as to better utilize the breakthrough germplasm resources with sweet and waxy kernels in the same ear and boost the breeding and development process of new varieties of fresh-eating corn with sweet and waxy kernels in the same ear. Summary of the Invention

[0006] The present invention provides an InDel marker tightly linked to the trait of sweet and waxy kernels in the same ear of maize. Using the maize B73-V4 genome as the reference genome, the marker is a 73-bp - / insertion sequence located at the position of 12126328 bp on chromosome 9, and the nucleotide sequence of the insertion sequence is as shown in SEQ ID NO.1.

[0007] The present invention also provides a primer pair for amplifying the aforementioned InDel marker, and the primer pair includes the primers shown in SEQ ID NO.2-3.

[0008] The present invention also provides an application of the aforementioned InDel marker or primer pair, and the application includes at least one of the following 1)-3): 1) Rapidly screening germplasm resources of sweet and waxy kernels in the same ear of maize; 2) Molecular marker-assisted breeding of maize; 3) Preparing a detection product for rapidly screening germplasm resources of sweet and waxy kernels in the same ear of maize.

[0009] The present invention also provides a method for rapidly screening germplasm resources of sweet and waxy kernels in the same ear of maize, including the following steps: (1) Extracting genomic DNA of the maize germplasm resources to be tested; (2) Performing PCR amplification on the genomic DNA of the maize germplasm resources to be tested using the aforementioned primer pair; (3) If the amplification product has only one sequence fragment and its length is a 421-bp fragment or includes the insertion sequence shown in SEQ ID NO.1, then the maize germplasm resources to be tested are materials of sweet and waxy kernels in the same ear of maize.

[0010] Specifically, in the step (1), collecting the leaves of the maize germplasm resources to be tested at the seedling stage to extract the genomic DNA of the maize germplasm resources to be tested.

[0011] The conditions for PCR amplification in the step (2) are: pre-denaturation at 95°C for 3 min; denaturation at 94°C for 25 sec, annealing at 55°C for 25 sec, extension at 72°C for 15 sec, for 35 cycles; extension at 72°C for 5 min.

[0012] In step (3), the PCR amplification product is analyzed by gel electrophoresis to determine the fragment size of the amplification product; if only one band is amplified and its length is 421 bp, the maize germplasm resource to be tested is a sweet-waxy same-grain maize material.

[0013] More specifically, the nucleotide sequence of the amplification product in step (3) is as shown in SEQ ID NO.5.

[0014] The present invention also provides a detection kit for rapidly identifying sweet-waxy same-grain maize germplasm resources, characterized in that the kit comprises the aforementioned primer pair.

[0015] The beneficial effects of the present invention include: the present invention provides an InDel marker chr9_12126328 that is closely linked to the sweet-waxy same-grain trait of maize ears. The InDel marker provided by the present invention can rapidly screen out maize materials containing sweet-waxy same-grain genes at the early growth stage of maize, and can also be used for molecular marker-assisted breeding of fresh-eating maize. The InDel marker and screening method provided by the present invention have the characteristics of high screening accuracy. The use of this marker and screening method not only saves production costs but also improves breeding efficiency. Description of the Drawings

[0016] Figure 1 is the SNP-Index fitting mapping result; Figure 2 is the agarose gel electrophoresis pattern of the PCR amplification product of the F2 generation sweet-waxy same-grain maize material in Example 1, where; the markers from bottom to top are: 100 bp, 200 bp, 300 bp, 400 bp, 500 bp, 600 bp and 700 bp; Figure 3 is the agarose gel electrophoresis pattern of the PCR amplification product of the F2 generation waxy maize material in Example 1, where the markers from bottom to top are: 100 bp, 200 bp, 300 bp, 400 bp, 500 bp, 600 bp and 700 bp; Figure 4 is the agarose gel electrophoresis pattern of the PCR amplification product of the maize material in Example 3, where the markers from bottom to top are: 100 bp, 200 bp, 300 bp, 400 bp, 500 bp, 600 bp and 700 bp. Detailed Embodiments

[0017] The present invention will be further described and illustrated below in conjunction with embodiments. However, the described embodiments are only a part of the embodiments of the present invention, rather than all of them. Based on the present invention and the embodiments, all other inventions and embodiments obtained by those of ordinary skill in the art without creative efforts shall fall within the scope of protection of the present invention.

[0018] Unless otherwise specified, the experimental methods used in the following embodiments are all conventional methods.

[0019] Unless otherwise specified, the materials, reagents, etc. used in the following embodiments can all be obtained from commercial channels. Example 1. Screening of InDel Markers

[0020] Based on BSA-seq, this example determines candidate QTLs and linked InDel markers, and specifically includes the following procedures: (1) Phenotype definition: The determination standard for sweet-waxy co-grained corn is that the percentage of amylopectin content in the total mass ≥ 85%, the percentage of soluble sugar content in the total mass ≥ 14%, the endosperm of mature grains has obvious dentate depressions and opaque waxy lusters after drying, and the fresh ears are suitable for harvesting for more than 15 days; the determination standard for waxy corn is that the percentage of amylopectin content in the total mass ≥ 97%, the percentage of soluble sugar content in the total mass ≤ 10%, the endosperm of the grains is dense and plump after drying and has an opaque waxy luster, and the fresh ears are suitable for harvesting for less than 10 days.

[0021] (2) Collect 30 leaves each of the waxy corn parent B2595W (preserved in the Institute of Special Wild Economic Animal and Plant Sciences, Chinese Academy of Agricultural Sciences) and the sweet-waxy co-grained corn parent B2595T (preserved in the Institute of Special Wild Economic Animal and Plant Sciences, Chinese Academy of Agricultural Sciences), as well as F2-generation waxy corn materials and sweet-waxy co-grained corn materials in the field (each material is planted in the field after phenotype identification, and the leaves at the seedling stage are taken). Use the magnetic bead method to extract DNA. After qubit quantification, 30 F2-generation waxy corn materials are equally mixed into F2-B2595W, and 30 F2-generation sweet-waxy co-grained corn materials are equally mixed into F2-B2595T; (3) Construct whole-genome resequencing libraries for 4 DNA samples of the parents B2595W and B2595T and the offspring mixed pools F2-B2595W and F2-B2595T. Select fragments in the range of 320 - 460 bp, enrich and amplify. After stable qbit quantification and determining that the library inspection is qualified, use the BGI DNBSEQ-T7 for sequencing.

[0022] (4) Using the clean data obtained by sequencing in step (3) and taking the maize B73-V4 genome (https: / / maizegdb.org / ) as the reference genome, align the clean data to the genome using bwa, perform variant detection with GATK, and obtain high-quality SNP sites. Parameters: "-filter QD < 2.0 --filter-name QD2 -filter QUAL < 30.0 --filter-name QUAL30 -filter SOR > 3.0 --filter-name SOR3 -filter FS > 60.0 --filter-name FS60 -filter MQ < 40.0 --filter-name MQ40 -filter MQRankSum < -12.5 --filter-name MQRankSum-12.5 -filter ReadPosRankSum < -8.0 --filter-nameReadPosRankSum-8" (Li et al., 2020).

[0023] (5) Among the SNP sites screened in step (4), screen for homozygous and different SNP markers of parents F2-B2595W and F2-B2595T, and use the SNP-index algorithm of the R package PNGseqR to perform QTL mapping on the offspring mixed pools F2-B2595W and F2-B2595T (Fu et al., 2022). The results are as Figure 1 shown in the SNP-Index fitting mapping result. It can be seen from the figure that the candidate interval of Qsw-chr9-1 (the first QTL for sweet and waxy grains on chromosome 9) is chr9: 218037-23337779.

[0024] (6) Design primers for all InDel markers within the QTL interval determined in step (5). According to the principle of uniform distribution, design 7 primers (the loci are chr9: 218990, chr9: 338353, chr9: 3915869, chr9: 7253676, chr9: 12126328, chr9: 16426918, chr9: 18793689) and perform electrophoresis analysis on 121 waxy corn materials and 75 sweet-waxy corn materials of the same grain in the F2 generation (planted in the field after phenotypic identification, and DNA is extracted from the leaves at the seedling stage). PCR amplification reaction system: 20 - 100 ng of DNA template, 10 μl of 2× M5 HiPer plus Taq HiFi PCR mix (with blue dye, purchased from Beijing Polymer Beauty Biotechnology Co., Ltd., product number Mf002-plus-100), 0.5 μl each of forward primer F (10 μM) and reverse primer R (10 μM), and make up to 20 μl with ddH2O. Amplification conditions: pre-denaturation at 95°C for 3 min; denaturation at 94°C for 25 sec, annealing at 55°C for 25 sec, extension at 72°C for 15 sec, 35 cycles; extension at 72°C for 5 min.

[0025] (7) Associate the InDel markers amplified by PCR in step (6) with the phenotypes. Finally, it is determined that the InDel molecular marker located at chr9_12126328 in the maize genome has the highest linkage degree with the phenotype, and the allele is an insertion / deletion of 73 bp. The 73-bp sequence is as shown in SEQ ID NO.1. Its primer information is forward primer F sequence: CAACACCCTGAACCGCT (SEQ ID NO.2), reverse primer R sequence: CCGTGAATCTCGCTGCT (SEQ ID NO.3).

[0026] Use the above primers to perform PCR amplification on the DNA of 121 waxy corn materials and 75 sweet-waxy corn materials of the same grain in the F2 generation and perform electrophoresis (3% agarose gel electrophoresis) analysis on the amplification products. The results are as Figures 2 - 3 shown: The amplification product of the homozygous genotype RR of sweet-waxy corn of the same grain is only a fragment with a length of 421 bp (its nucleotide sequence is as shown in SEQ ID NO.5), and the amplification product of the homozygous genotype GG of waxy corn is only a fragment with a length of 348 bp (its nucleotide sequence is as shown in SEQ ID NO.6). Sweet-waxy corn of the same grain can be quickly screened out by agarose gel electrophoresis.

[0027] Table 1. Statistical results of genotypes and phenotypes of sweet-waxy corn of the same grain and waxy corn materials in the F2 generation Number Phenotype Genotype Number Phenotype Genotype N1 Glutinous GG T1 Sweet and glutinous in the same grain RR N2 Glutinous GG T2 Sweet and glutinous in the same grain RR N3 Glutinous GG T3 Sweet and glutinous in the same grain RR N4 Glutinous GG T4 Sweet and glutinous in the same grain RR N5 Glutinous GR T5 Sweet and glutinous in the same grain RR N6 Glutinous NN T6 Sweet and glutinous in the same grain RR N7 Glutinous GG T7 Sweet and glutinous in the same grain RR N8 Glutinous GG T8 Sweet and glutinous in the same grain RR N9 Glutinous GG T9 Sweet and glutinous in the same grain RR N10 Glutinous GG T10 Sweet and glutinous in the same grain RR N11 Glutinous GG T11 Sweet and glutinous in the same grain RR N12 Glutinous GG T12 Sweet and glutinous in the same grain RR N13 Glutinous GG T13 Sweet and glutinous in the same grain RR N14 Glutinous GG T14 Sweet and glutinous in the same grain RR N15 Glutinous GG T15 Sweet and glutinous in the same grain RR N16 Glutinous GG T16 Sweet and glutinous in the same grain RR N17 Glutinous GG T17 Sweet and glutinous in the same grain RR N18 Glutinous GG T18 Sweet and glutinous in the same grain RR N19 Glutinous NN T19 Sweet and glutinous in the same grain RR N20 Glutinous GG T20 Sweet and glutinous in the same grain RR N21 Glutinous ​ T21 ​ ​ N22 ​ ​ T22 ​ ​ N23 ​ ​ T23 ​ ​ N24 ​ ​ T24 ​ ​ N25 ​ ​ T25 ​ ​ N26 ​ ​ T26 ​ ​ N27 ​ ​ T27 ​ ​ N28 ​ ​ T28 ​ ​ N29 ​ ​ T29 ​ ​ N30 ​ ​ T30 ​ ​ N31 ​ ​ T31 ​ ​ N32 ​ ​ T32 ​ ​ N33 ​ ​ T33 ​ ​ N34 ​ ​ T34 ​ ​ N35 ​ ​ T35 ​ ​ N36 ​ ​ T36 ​ ​ N37 ​ ​ T37 ​ ​ N38 ​ ​ T38 ​ ​ N39 ​ ​ T39 ​ ​ N40 ​ ​ T40 ​ ​ N41 ​ ​ T41 ​ ​ N42 ​ ​ T42 ​ ​ N43 ​ ​ T43 ​ ​ N44 ​ ​ T44 ​ ​ N45 ​ ​ T45 ​ ​ N46 ​ ​ T46 ​ ​ N47 ​ ​ T47 ​ ​ N48 ​ ​ T48 ​ ​ N49 ​ ​ T49 ​ ​ N50 ​ ​ T50 ​ ​ N51 ​ ​ T51 ​ ​ N52 ​ ​ T52 ​ ​ N53 ​ ​ T53 ​ ​ N54 ​ ​ T54 ​ ​ N55 ​ ​ T55 ​ ​ N56 ​ ​ T56 ​ ​ N57 ​ ​ T57 ​ ​ N58 ​ ​ T58 ​ ​ N59 ​ ​ T59 ​ ​ N60 ​ ​ T60 ​ ​ N61 ​ ​ T61 ​ ​ N62 ​ ​ T62 ​ ​ N63 ​ ​ T63 ​ ​ N64 ​ ​ T64 ​ ​ N65 ​ ​ T65 ​ ​ N66 ​ ​ T66 ​ ​ N67 ​ ​ T67 ​ ​ N68 ​ ​ T68 ​ ​ N69 ​ ​ T69 ​ ​ N70 ​ ​ T70 ​ ​ N71 ​ ​ T71 ​ ​ N72 ​ ​ T72 ​ ​ N73 ​ ​ T73 ​ ​ N74 ​ ​ T74 ​ ​ N75 ​ ​ T75 ​ ​ N76 ​ ​ N77 ​ ​ N78 ​ ​ N79 ​ ​ N80 ​ ​ N81 ​ ​ N82 ​ ​ N83 ​ ​ N84 ​ ​ N85 ​ ​ N86 ​ ​ N87 ​ ​ N88 ​ ​ N89 ​ ​ N90 ​ ​ N91 ​ ​ N92 ​ ​ N93 ​ ​ N94 ​ ​ N95 ​ ​ N96 ​ ​ N97 ​ ​ N98 ​ ​ N99 ​ ​ N100 ​ ​ N101 ​ ​ N102 ​ ​ N103 ​ ​ N104 ​ ​ N105 ​ ​ N106 ​ ​ N107 ​ ​ N108 ​ ​ N109 ​ ​ N110 ​ ​ N111 ​ ​ N112 ​ ​ N113 ​ ​ N114 ​ ​ N115 ​ ​ N116 ​ ​ N117 ​ ​ N118 ​ ​ N119 ​ ​ N120 ​ ​ N121 ​ ​ Note: "NN" in the table represents missing genotype data; "R" is the abbreviation of "GATTTCCTCTTCTCTCTCACGGTTTCTGTTCATCGCAGAATGTAGGGGCTTTGACGGGGTTTTATAGCCTTGTT (SEQ ID NO.4)".

[0028] As shown in Table 1, there are 72 materials with the homozygous genotype RR in the F2 generation of sweet-waxy same-grain corn (accounting for 100% in the sweet-waxy same-grain corn materials); there are 108 materials with the homozygous GG genotype in the F2 generation of waxy corn (accounting for 93.9% in the waxy corn materials), and 7 materials with the heterozygous genotype GR.

[0029] The above results indicate that the chr9_12126328 marker is closely linked to the sweet-waxy same-grain phenotype and is suitable for rapid screening of sweet-waxy same-grain corn materials. Example 2. Method for Rapidly Screening Sweet-Waxy Same-Grain Corn Materials Using InDel Markers

[0030] The specific method for rapidly screening sweet-waxy same-grain corn materials using the InDel markers obtained in Example 1 includes the following steps: (1) Collect the leaf blades of the maize germplasm resources to be tested at the seedling stage and extract genomic DNA. (2) Perform PCR amplification on the genomic DNA of the maize germplasm resources to be tested using the primer pair (forward primer F and reverse primer R, the primers shown in SEQ ID NO.2-3) obtained in Example 1. PCR amplification reaction system: 20 - 100 ng of DNA template, 10 ul of 2×M5 HiPer plus Taq HiFiPCR mix (with blue dye, purchased from Beijing Polymer Beauty Biotechnology Co., Ltd., product number Mf002-plus-100), 0.5 ul each of forward primer F (10 uM) and reverse primer R (10 uM), and make up to 20 µl with ddH2O.

[0031] Amplification conditions: Pre-denaturation at 95℃ for 3 min; denaturation at 94℃ for 25 sec, annealing at 55℃ for 25 sec, extension at 72℃ for 15 sec, 35 cycles; extension at 72℃ for 5 min.

[0032] (3) Perform gel electrophoresis analysis on the PCR amplification products. If the amplification product is only one band and its length is about 421 bp, then the maize germplasm resources to be tested are sweet-waxy same-grain corn materials. Example 3. Application Verification of the Method for Rapidly Screening Sweet-Waxy Same-Grain Corn Materials Using InDel Markers

[0033] Using the method of step (1) in Example 1, phenotypic identification was carried out on 69 corn materials (including sweet corn, waxy corn, and sweet-waxy same-grain corn) (Table 2), and then rapid molecular identification was carried out using the screening method provided in Example 2. The identification results are shown in ​ and Table 2. It can be seen from ​ that 10 sweet-waxy same-grain corn materials were quickly screened out through InDel markers, and this result is completely consistent with the phenotypic identification results of corn ears, indicating that this molecular marker can be effectively applied to the early rapid screening of corn materials containing sweet-waxy same-grain genes.

[0034] Table 2 Statistical results of genotypes and phenotypes of corn materials in this example

Claims

1. An InDel marker tightly linked to the sweet and waxy kernels trait of corn ear, characterized in that, Using the maize B73-V4 genome as the reference genome, the marker is a 73-bp - / insertion sequence located at position 12126328 bp on chromosome 9, and the nucleotide sequence of the insertion sequence is as shown in SEQ ID NO.

1.

2. A primer pair for amplifying the InDel marker according to claim 1, characterized in that, The primer pair includes the primers shown in SEQ ID NO.2-3.

3. Use of the InDel marker according to claim 1 or the primer pair according to claim 2, characterized in that The application includes at least one of the following 1)-3): 1) Rapidly screening sweet-waxy co-grained maize germplasm resources; 2) Maize molecular marker-assisted breeding; 3) Preparing a detection product for rapidly screening sweet-waxy co-grained maize germplasm resources.

4. A method for rapidly screening sweet and waxy corn germplasm resources with grains of both types, characterized in that, It includes the following steps: (1) Extracting genomic DNA of the maize germplasm resources to be tested; (2) Performing PCR amplification on the genomic DNA of the maize germplasm resources to be tested using the primer pair described in claim 2; (3) If there is only one sequence fragment in the amplification product, and its length is a 421-bp fragment or includes the insertion sequence shown in SEQ ID NO.1, then the maize germplasm resources to be tested are sweet-waxy co-grained maize materials.

5. The method according to claim 4, wherein In step (1), the leaves of the maize germplasm resources to be tested at the seedling stage are collected to extract the genomic DNA of the maize germplasm resources to be tested.

6. The method according to claim 4, wherein The conditions for PCR amplification in step (2) are: pre-denaturation at 95°C for 3 min; denaturation at 94°C for 25 sec, annealing at 55°C for 25 sec, extension at 72°C for 15 sec, for 35 cycles; extension at 72°C for 5 min.

7. The method according to claim 4, wherein In step (3), the PCR amplification product is subjected to gel electrophoresis analysis to determine the fragment size of the amplification product; if only one band is amplified and its length is 421 bp, then the maize germplasm resources to be tested are sweet-waxy co-grained maize materials.

8. The method according to claim 4, characterized in that The nucleotide sequence of the amplification product in step (3) is as shown in SEQ ID NO.

5.

9. A detection kit for quickly identifying sweet and waxy single-grain corn germplasm resources, characterized in that, The kit includes the primer pair described in claim 2.

Citation Information

Patent Citations

  • Molecular marker for detecting Wx1, and method of applying marker to waxy maize breeding

    CN111518940A

  • Method for breeding fresh-eating waxy corn variety with sweet taste

    US20230337614A1

Cited By

  • InDel molecular marker primer for screening sweet corn type with increased waxiness and application of InDel molecular marker primer

    CN120924705A

  • Method for preparing sweet-waxy corn and application of sweet-waxy corn

    CN122326563A