Method for producing oligonucleotide

Abstract

The present invention provides: a method for producing an oligonucleotide, said method comprising reacting n polymerized oligonucleotides (n represents an arbitrary integer of 2 or more); and an oligonucleotide in which the content ratio of a branching body in the oligonucleotide is equal to or less than a certain amount. And a step for reacting with water or an aqueous solution having a pH of 1-8 to decompose the branching body.

Description

Technical Field

[0001] This patent application claims priority and benefit under the Paris Convention based on Japanese Patent Application No. 2022-208672 (filed on December 26, 2022), and the entire content described in the above application is incorporated herein by reference.

[0002] The present invention relates to a method for producing an oligonucleotide, which includes selectively decomposing branched products, which are impurities in the synthesized oligonucleotide, under mild conditions. Background Art

[0003] In recent years, there has been a growing interest in the application of nucleic acid molecules in the medical field. For example, nucleic acids that induce RNA interference (RNAi) such as antisense nucleic acids, aptamers, ribozymes, and siRNA can be cited, and these are called nucleic acid drugs.

[0004] Oligonucleotides can be synthesized by the phosphoramidite method (hereinafter referred to as the "amidite method"). For oligonucleotides containing ribose, the target oligonucleotide is produced by deprotecting and removing the protecting group of the 2'-hydroxy group of ribose.

[0005] As a main impurity in the production of synthesized oligonucleotides, branched products are known (see Non-Patent Document 1). A branched product refers to a substance in which an oligonucleotide is bonded via a phosphoramidate linkage to the base portion of a nucleotide. There is a problem that the yield and purity of the desired synthesized oligonucleotide are reduced due to the generation of branched products.

[0006] As a method for decomposing branched products, for example, a method of mixing triethylamine trihydrofluoride with branched products to decompose the branched products is known (see Non-Patent Document 2). In addition, as a method for decomposing the phosphoramidate bond, a method using an 80% aqueous acetic acid solution is also known (see Non-Patent Document 3). However, in these methods, the reaction conditions are harsh and the target oligonucleotide is also decomposed. Therefore, a method for selectively decomposing branched products under milder conditions is required.

[0007] Prior Art Documents

[0008] Non-Patent Documents

[0009] Non-Patent Document 1: Mass Spectrometry, Reviews 2021, 40, 75-109

[0010] Non-Patent Document 2: Oligonucleotides 2006, 16, 181-185

[0011] Non-Patent Document 3: J. Org. Chem., 1970, 35, 3800 - 3803 Summary of the Invention

[0012] Problems to be Solved by the Invention

[0013] An object of the present invention is to provide a method for producing an oligonucleotide with a reduced content of branched bodies, which comprises decomposing branched bodies as by-products by treating the oligonucleotide under mild conditions in the method for producing the oligonucleotide.

[0014] Means for Solving the Problems

[0015] The inventors of the present application repeatedly conducted in-depth studies to achieve the above object, and as a result, found that by reacting an oligonucleotide with water or an aqueous solution having a pH of 1 to 8, the selective decomposition of branched bodies is promoted, and the yield and purity of the obtained oligonucleotide are improved. As a result, the present invention provides a method for producing an oligonucleotide, and an oligonucleotide having a content ratio of branched bodies in the oligonucleotide of a certain amount or less. In the method for producing the oligonucleotide, the method includes a step of decomposing branched bodies by reacting n polymerized oligonucleotides (n represents any integer of 2 or more) with water or an aqueous solution having a pH of 1 to 8.

[0016] The present invention includes the following embodiments, but is not limited thereto.

[0017] [1] A method for producing an oligonucleotide, the method for producing the oligonucleotide including a step of decomposing branched bodies by reacting n polymerized oligonucleotides (n represents any integer of 2 or more) with water or an aqueous solution having a pH of 1 to 8.

[0018] [2] The method for producing an oligonucleotide according to [1], wherein the step of decomposing branched bodies includes a reaction of selectively cleaving the aminophosphonate bond of the branched bodies.

[0019] [3] The method for producing an oligonucleotide according to any one of [1] or [2], wherein the crude oligonucleotide after solid-phase synthesis is used as a starting material.

[0020] [4] The method for producing an oligonucleotide according to any one of [1] to [3], wherein the step of decomposing branched bodies includes a step of mixing and reacting n polymerized oligonucleotides (n represents any integer of 2 or more) with water or an aqueous solution having a pH of 1 to 8 for 10 minutes or more.

[0021] [5] The production method according to any one of [1] to [4], wherein the reaction temperature is 0 to 60 °C.

[0022] [6] The manufacturing method according to any one of [1] to [5], wherein the water or aqueous solution having a pH of 1 to 8 is an aqueous solution containing acetic acid or acetate.

[0023] [7] The manufacturing method according to any one of [1] to [5], wherein the water or aqueous solution having a pH of 1 to 8 is a Tris-HCl buffer solution having a pH of 7 to 8.

[0024] [8] The manufacturing method according to any one of [1] to [5], wherein the water or aqueous solution having a pH of 1 to 8 is water.

[0025] [9] The manufacturing method according to any one of [1] to [8], wherein the n polymeric oligonucleotides are n polymeric oligonucleotides containing nucleotides having 2'-OMe.

[0026]

[10] The manufacturing method according to any one of [1] to [9], wherein the n polymeric oligonucleotides are n polymeric oligonucleotides containing nucleotides having 2'-OH.

[0027]

[11] The manufacturing method according to any one of [1] to

[10] , wherein the pH of the aqueous solution is 1 to 2 and the reaction temperature is 0 to 30 °C.

[0028]

[12] The manufacturing method according to any one of [1] to

[10] , wherein the pH of the aqueous solution is 3 to 4 and the reaction temperature is 0 to 50 °C.

[0029]

[13] The manufacturing method according to any one of [1] to

[10] , wherein the pH of the aqueous solution is 5 to 8 and the reaction temperature is 20 to 60 °C.

[0030]

[14] An oligonucleotide, wherein the content ratio of the branched form is 15% or less relative to the full-length form (FLP).

[0031]

[15] An oligonucleotide, wherein the content ratio of the branched form is 5% or less relative to the FLP.

[0032]

[16] An oligonucleotide having a chain length of 50 or more, wherein the content ratio of the branched form is 5% or less relative to the FLP.

[0033]

[17] An oligonucleotide having a chain length of 100 or more, wherein the content ratio of the branched form is 5% or less relative to the FLP.

[0034]

[18] The manufacturing method according to any one of [1] to

[13] , wherein the oligonucleotide is RNA.

[0035]

[19] The oligonucleotide according to any one of

[14] to

[17] , wherein the oligonucleotide is RNA.

[0036] Advantages of the Invention

[0037] The present invention provides a method for producing an oligonucleotide, characterized in that, by reacting the oligonucleotide with water or an aqueous solution having a pH of 1 to 8, the selective decomposition reaction of the by-product, the branched body, is efficiently promoted. By the production method of the present invention, an increase in the yield and purity of the produced oligonucleotide can be expected. BRIEF DESCRIPTION OF THE DRAWINGS

[0038] Figure 1 Figure 1 Route A is shown as a typical example of producing a nucleic acid oligomer represented by formula (5) from a nucleic acid oligomer represented by formula (1) based on the phosphoramidite method. DETAILED DESCRIPTION OF THE INVENTION

[0039] According to one embodiment of the present invention, the present invention relates to a method for producing an oligonucleotide, and the method for producing the oligonucleotide includes a step of decomposing a branched body by reacting n polymerized oligonucleotides (n represents any integer of 2 or more) with water or an aqueous solution having a pH of 1 to 8.

[0040] According to one embodiment of the present invention, the following shows a representative reaction route of the decomposition reaction of the branched body of the present invention.

[0041] [Chemical formula 1]

[0042]

[0043] In the formula, "Base" is the same or different from each other, and each independently represents a nucleic acid base; Y is the same or different from each other, and each independently represents an oxygen atom or a sulfur atom; R is the same or different from each other, and each independently represents a hydrogen atom, a fluorine atom or an OQ group; Q is the same or different from each other, and each independently represents a hydrogen atom, a methyl group, a 2-methoxyethyl group, a methylene group bonded to the 4'-carbon atom of ribose, an ethylene group bonded to the 4'-carbon atom of ribose or an ethylidene group bonded to the 4'-carbon atom of ribose, and R 1 is the same or different from each other, and each independently represents a hydrogen atom or an alkyl group, but is not limited thereto.

[0044] ​​As used in this specification, the term "branch body" is a by-product in the production of synthetic oligonucleotides, and refers to a compound in which an oligonucleotide is bonded via an aminophosphate bond to the base portion of a nucleotide as a reactant. In addition, it also includes a compound in which one or more nucleotides are further polymerized on the nucleotide of this compound. The branch body is contained in the crude reaction product containing oligonucleotides produced after the production reaction of synthetic oligonucleotides. The term "crude oligonucleotide" or "crude oligonucleotide oligomer" used in this specification also refers to a mixture containing oligonucleotides and branch bodies after the synthesis reaction.

[0045] As used in this specification, the term "decomposing the branch body" means cleaving the aminophosphate bond of the base portion of the above-mentioned branch body. As used in this specification, the term "selectively decomposing the branch body" means selectively cleaving the aminophosphate bond on the base portion of the above-mentioned branch body without cleaving the phosphodiester bond or phosphorothioate bond in the desired target oligonucleotide.

[0046] As the term "water or aqueous solution with a pH of 1 to 8" used in this specification, specifically, examples include water or an aqueous solution of an acid or its salt with a pH of 1 to 8. As the aqueous solution, examples include an aqueous solution containing an organic acid or its salt, and an aqueous solution containing an inorganic acid or its salt. Specifically, for example, an aqueous solution containing acetic acid or an acetate (such as sodium acetate, ammonium acetate, potassium acetate, calcium acetate), and Tris hydrochloride buffer solution, etc., but not limited to these.

[0047] In addition, as the water, examples include UF water (ultrafiltered water), but not limited to these. As the aqueous solution with a pH of 1 or more and less than 6.8, an aqueous solution of acetic acid or an acetate can be cited. UF water with a pH of 6.8 can be cited. As the aqueous solution with a pH greater than 6.8 and 8 or less, Tris hydrochloride buffer solution can be cited.

[0048] As the reaction conditions in the step of "reacting n aggregated oligonucleotides (n represents any integer of 2 or more) with water or an aqueous solution having a pH of 1 to 8 to decompose the branched body" in the present invention, it is necessary to mix and react n aggregated oligonucleotides (n represents any integer of 2 or more) with water or an aqueous solution having a pH of 1 to 8 for a certain period of time or more. The reaction time may vary depending on the oligonucleotide reactants used, the water or aqueous solution having a pH of 1 to 8, and the reaction temperature, etc., and as long as it is a condition capable of sufficiently achieving the decomposition of the branched body, there is no particular limitation. For example, it is preferably 10 minutes or more. Specifically, it may be several tens of minutes to several weeks, such as 10 minutes, 30 minutes, 1 hour, 2 hours, 3 hours, 6 hours, 12 hours, 24 hours, 48 hours (2 days), 72 hours (3 days), 1 week, several weeks, 1 month, and several months, etc. Considering the stability of the obtained oligonucleotide in water or an aqueous solution having a pH of 1 to 8, the reaction time is preferably shorter. For example, it may be at least 10 minutes or more, 30 minutes or more, or 60 minutes or more. On the other hand, it may be at least 1 week or less, 72 hours or less, 24 hours or less, and 12 hours or less. Specific reaction times may be, for example, 30 minutes to 1 week, 2 hours to 72 hours, and 6 hours to 24 hours, etc. As a more preferred mode, it may be 30 minutes to 24 hours.

[0049] The reaction temperature may vary depending on the oligonucleotide reactants used, the water or aqueous solution having a pH of 1 to 8, and the reaction time, etc., and as long as it is a condition capable of sufficiently achieving the decomposition of the branched body, there is no particular limitation. Considering the stability of the generated oligonucleotide, the reaction temperature is preferably lower. Specifically, it may be 0°C or more, room temperature or more (for example, 25°C or more), 40°C or more, 50°C or more. On the other hand, it may be 60°C or less, 50°C or less, 40°C or less. Specific reaction temperatures may be, for example, 0°C to 60°C, 10 to 60°C, 20 to 60°C, 20 to 50°C, 20 to 40°C, etc.

[0050] As the relationship between the pH and the reaction temperature for the decomposition reaction of the branched body, it may be, but not limited to, for example, the condition that the pH of the aforementioned aqueous solution is 1 to 2 and the reaction temperature is 0 to 30°C, the condition that the pH of the aforementioned aqueous solution is 3 to 4 and the reaction temperature is 0 to 50°C, and the condition that the pH of the aforementioned aqueous solution is 5 to 8 and the reaction temperature is 20 to 60°C.

[0051] As the reaction conditions for the decomposition reaction of the branched body, examples include, but are not limited to, conditions such as the pH of the aforementioned aqueous solution being 1 to 2, the reaction temperature being 0 to 30 °C, and the reaction time being 10 minutes to 12 hours (for example, 30 minutes to 2 hours); the pH of the aforementioned aqueous solution being 3 to 4, the reaction temperature being 0 to 50 °C, and the reaction time being 6 hours to 48 hours (for example, 12 hours to 24 hours); the pH of the aforementioned aqueous solution being 5 to 8, the reaction temperature being 20 to 60 °C, and the reaction time being 48 hours to several weeks (for example, 24 hours to 1 week).

[0052] As the reaction conditions for the decomposition reaction of the branched body, there is generally the following tendency: under conditions where the pH is slightly acidic, the progress of the decomposition reaction is fast, the reaction temperature is low, and the reaction time is short. On the other hand, under conditions where the pH is close to neutral, the progress of the decomposition reaction is slow, the reaction temperature is high, and the reaction time is long.

[0053] In the term "branched body" used in this specification, in the above formula (A), R 1 Examples include a hydrogen atom, an alkyl group (such as a methyl group, an ethyl group), etc., but are not limited to these.

[0054] The term "n polymeric oligonucleotides (n represents any integer of 2 or more)" used in this specification refers to a polymeric oligonucleotide obtained by polymerizing n (n represents any integer of 2 or more) nucleotides, which is polymerized through a phosphodiester bond or a phosphorothioate bond at the 5'-end and 3'-end of ordinary nucleotides.

[0055] Regarding the n polymeric oligonucleotides, its specific structure is not particularly limited. For example, it includes an oligonucleotide containing nucleotides with 2'-OMe and an oligonucleotide containing nucleotides with 2'-OH.

[0056] In this specification, the "oligonucleotide" is sometimes also referred to as "nucleic acid oligomer", and the "nucleotide" is sometimes also referred to as "nucleic acid molecule".

[0057] In this specification, the crude oligonucleotide in the decomposition reaction of the branched body can be a commonly known crude oligonucleotide before purification after liquid phase synthesis. For example, it can be a crude oligonucleotide with nucleic acid bases protected, or a crude oligonucleotide before purification with nucleic acid bases deprotected. Or, it can be a crude oligonucleotide before purification after solid phase synthesis. For example, it can be a crude oligonucleotide with nucleic acid bases protected, or a crude oligonucleotide before purification with nucleic acid bases deprotected. Preferably, it is a crude oligonucleotide after solid phase synthesis.

[0058] In this specification, the nucleosides (ribose and deoxyribose) contained in the nucleic acid molecule as the oligonucleotide can include either synthetic DNA or RNA, and preferably can include RNA.

[0059] The chain length (N) of the oligonucleotide is not particularly limited. For example, the chain length can be exemplified as 2 (mer) or more, 3 or more, 5 or more, 10 or more, 20 or more, 30 or more, 40 or more, 50 or more, 60 or more, 80 or more, 100 or more, 150 or more, 200 or more, 250 or more, 300 or more, 2 or more to 300 or less, 2 or more to 200 or less, 10 or more to 300 or less, 10 or more to 200 or less, 10 or more to 150 or less, 20 or more to 300 or less, 20 or more to 200 or less, 20 or more to 100 or less, 50 or more to 300 or less, 50 or more to 200 or less, 50 or more to 100 or less, 80 or more to 300 or less, 80 or more to 250 or less, 80 or more to 200 or less, 100 or more to 300 or less, 100 or more to 250 or less, 100 or more to 200 or less, but is not limited to these.

[0060] The content ratio of the branch body in the oligonucleotide obtained by the selective decomposition step of the branch body of the present invention is 15% or less, 14% or less, 13% or less, 12% or less, 11% or less, 10% or less, 9% or less, 8% or less, 7% or less, 6% or less, 5% or less, 4% or less, 3% or less, 2% or less, 1% or less, preferably 5.0% or less, less than 5.0%, 4.5% or less, 4.1% or less, 4.0% or less, 3.5% or less, 3.4% or less, 3.0% or less, 2.5% or less, 2.2% or less, 2.0% or less, 1.5% or less, 1.0% or less, but is not limited to these. The content ratio of the branch body can be determined by analyzing a specified amount of a sample of the crude oligonucleotide or crude oligonucleotide oligomer using high performance liquid chromatography (HPLC).

[0061] Here, in the oligonucleotide, when the content of the full-length body (FLP (Full Length Product)) in the oligonucleotide is set to 100%, the content (%) of the branch body in the oligonucleotide is defined as the "branch body content ratio".

[0062] For the analysis of the branch body based on HPLC, an oligonucleotide HPLC column (for example, DNAPac manufactured by Thermo Fisher) is usually used.TM It is carried out using, for example, a CH3CN solution containing Tris-HCl buffer and urea as mobile phase A and a CH3CN solution containing NaClO4, Tris-HCl buffer and urea as mobile phase B in a gradient manner. The UV detection wavelength is typically 260 nm.

[0063] Next, a method for producing a nucleic acid molecule based on the phosphoramidite method (amidite method) will be described.

[0064] As a precursor having a phosphite triester bond, a nucleic acid compound represented by the formula (4) can be exemplified.

[0065] [Chemical formula 2]

[0066]

[0067] In the formula,

[0068] G 1 represents a protecting group for a hydroxyl group,

[0069] G 2 are the same or different from each other and each independently represents a protecting group for a hydroxyl group,

[0070] B a are the same or different from each other and each independently represents a nucleic acid base that can be protected by a protecting group,

[0071] R are the same or different from each other and each independently represents a protected hydroxyl group, a hydrogen atom, a fluorine atom, a methoxy group, a 2-methoxyethyl group, an OQ' group or an NQ' group,

[0072] Q' are the same or different from each other and each independently represents an alkylene group or a carbonyl group bonded to the 4'-position carbon atom of ribose.

[0073] In the formula (4), when R represents an OQ' group or an NQ' group and Q' represents an alkylene group or a carbonyl group bonded to the 4'-position carbon atom of ribose, as this structure, specifically, LNA-1 to LNA-7 of the following formula (10) can be exemplified.

[0074] Formula (10):

[0075] [Chemical formula 3]

[0076]

[0077] (In the formula,

[0078] B a represents a nucleic acid base that can be protected,

[0079] R' represents a hydrogen atom or a methyl group.)

[0080] As the nucleotide units contained in the nucleic acid molecules used in the present invention, DNA, RNA, 2'-O-Me, 2'-F, 2'-O-MOE (2'-O-methoxyethyl), UNA, morpholino nucleic acid, and the aforementioned LNA can be exemplified, but are not limited to these.

[0081] As the group Z formed by a solid support and a linker that connects the oxygen atom of the hydroxyl group at the 2'-position or 3'-position of the ribose at the 3'-end of the nucleic acid oligomer (also referred to as "oligonucleotide"), more specifically, the structure shown in the following formula (11) can be exemplified. More specifically, the structure shown in the following formula (11) can be exemplified.

[0082] [Chemical formula 4]

[0083]

[0084] In formula (11), Sp represents a spacer.

[0085] As the spacer (Sp), for example, a group having the structural formula shown in the following formula (12) can be exemplified.

[0086] [Chemical formula 5]

[0087]

[0088] The linker can be, for example, the structure shown in the following formula (13), or can also be a structure in which the hexamethyleneamino moiety is not present in the structure of formula (13), that is, a structure in which aminopropyl is bonded to Si. Alternatively, the linker can be the structure shown in the following formula (14).

[0089] [Chemical formula 6]

[0090]

[0091] (In the formula,

[0092] A can be any one of a hydroxyl group, an alkoxy group, or an alkyl group. As the alkoxy group, for example, methoxy and ethoxy can be exemplified. As the alkyl group, for example, methyl, ethyl, isopropyl, and n-propyl can be exemplified. represents the oxygen bond between Si and the hydroxyl group on the surface of the support.)

[0093] As the solid support, an inorganic porous support, an organic resin support, etc. can be exemplified. Among the inorganic porous supports, for example, controlled pore glass (CPG) and zeolite can be exemplified. Among the organic resin supports, for example, a support formed of polystyrene can be exemplified.

[0094] The various steps in the method for synthesizing nucleic acid molecules based on solid-phase synthesis can be carried out in an atmospheric atmosphere, preferably in an atmosphere of an inert gas (e.g., nitrogen, argon).

[0095] The method for synthesizing nucleic acid molecules based on solid-phase synthesis typically includes the following steps.

[0096] (1) A step of deprotecting the hydroxyl group at the 5'-position of a hydroxyl-protected nucleoside bonded to a solid-phase support via a linker;

[0097] (2) A step of coupling the hydroxyl group at the 5'-position generated in the previous step with an amide to obtain a phosphite triester compound;

[0098] (3) A step of oxidizing the phosphite triester generated in the previous step to convert it into a phosphate triester to produce an extended nucleic acid molecule;

[0099] (4) A step of repeating the cycle of a series of reactions consisting of the aforementioned steps (1) to (3), i.e., the deprotection step of the hydroxyl group at the 5'-position of the generated nucleic acid molecule, the coupling step of the hydroxyl group at the 5'-position with an amide compound, and the oxidation step of the generated phosphite triester any number of times, to synthesize a nucleic acid molecule on the solid-phase support;

[0100] (5) A step of subjecting the nucleic acid molecule on the solid-phase support generated in step (4) to a cleavage and deprotection step to liberate it from the solid-phase support to produce a nucleic acid molecule with the protecting groups removed; and,

[0101] (6) A step of deprotecting the protecting group of the hydroxyl group at the 2'-position or the 3'-position of the ribose constituting the nucleic acid molecule.

[0102] Among them, in the method for synthesizing the nucleic acid molecule, after step (2) or (3), a step of capping the hydroxyl group at the 5'-position that has not undergone the coupling reaction with the amide may be included, or a capping step may be added between any steps in the cycle of the series of reactions constituting step (4).

[0103] For the aforementioned step (5), more specifically, the nucleic acid molecule on the solid-phase support generated in step (4) is subjected to the reaction sequences of the following steps (5-1) and (5-2). Here, the implementation of the reaction in step (5-1) may also be arbitrary, and the implementation of the reaction in step (5-2) may also use the method described in Japanese Patent Publication No. 4705716. As a result, a nucleic acid molecule with the protecting groups removed or a nucleic acid molecule with the hydroxyl group at the 5'-end protected can be produced from the nucleic acid molecule liberated from the solid-phase support.

[0104] (5-1) A reaction of deprotecting the protecting group of the hydroxyl group at the 5'-end of the nucleic acid molecule;

[0105] (5-2) Reaction for cleaving a nucleic acid molecule from a solid support and releasing it, and reaction for deprotecting a protecting group of a nucleic acid base.

[0106] More specifically, the aforementioned step (6) is carried out by subjecting the nucleic acid molecule released from the solid support and having the protecting group removed in step (5) to the deprotection reaction of the following step (6).

[0107] (6) Reaction for deprotecting a protecting group of the hydroxyl group at the 2'-position or 3'-end of the ribose constituting the nucleic acid molecule.

[0108] The routes of the aforementioned steps (1) to (6) are shown in Figure 1 Route A. For the synthesis of a nucleic acid compound by the amide method based on the aforementioned steps (1) to (5), a nucleic acid extension reaction can be carried out by repeating each step such as a deprotection step and a condensation step according to a generally known method (for example, the methods described in the aforementioned Japanese Patent No. 5157168 or Japanese Patent No. 5554881).

[0109] Hereinafter, each step will be described. Among the substituents in the chemical formula of Route A, the definitions of G 1 , G 2 , B a and R are as defined above. In addition, the definitions of G 3 , G 4 , G 5 , B c and R' are as described later. In addition, in the chemical formula of Route A, Y are the same or different from each other and each independently represents an oxygen atom or a sulfur atom,

[0110] X represents an R group or an OZ group, where Z is as defined above,

[0111] when X represents an R group, W represents an OZ group, where Z is as defined above, or when X represents an OZ group, W represents an OV group, where V represents a protecting group of a hydroxyl group,

[0112] W may also include a group derived from the W group (for example, a residue cleaved from a solid support, a deprotected group, etc.),

[0113] X may also include a group derived from the X group (for example, a residue cleaved from a solid support, a deprotected group, etc.),

[0114] n represents any integer from 1 to 300, and

[0115] m represents any integer from 1 to 300.

[0116] As G 1 , as long as it can function as a protecting group, it can be used without particular limitation, and known protecting groups used in amide compounds can be widely used.

[0117] G 1 is preferably the following group.

[0118] [Chemical formula 7]

[0119]

[0120] (In the formula, R 1 , R 2 and R 3 are the same or different from each other and each independently represents hydrogen or an alkoxy group.)

[0121] R 1 , R 2 and R 3 are preferably: one is hydrogen, and the remaining two are the same or different (preferably the same) alkoxy groups. As the alkoxy group, methoxy group is particularly preferred.

[0122] As G 2 , as long as it can function as a protecting group, it can be used without particular limitation, and known protecting groups used in amide compounds can be widely used. As G 2 , for example, alkyl, alkenyl, alkynyl, cycloalkyl, haloalkyl, aryl, heteroaryl, arylalkyl, cycloalkenyl, cycloalkylalkyl, cyclylalkylgroup, hydroxyalkyl, aminoalkyl, alkoxyalkyl, heterocyclic alkenyl, heterocyclic alkyl, heteroarylalkyl, silyl, silyloxyalkyl, monoalkylsilyl, dialkylsilyl or trialkylsilyl, monoalkylsilyloxyalkyl, dialkylsilyloxyalkyl or trialkylsilyloxyalkyl, etc. can be mentioned, and these groups can be substituted by one or more electron-withdrawing groups.

[0123] G 2 is preferably an alkyl group substituted by an electron-withdrawing group. As the electron-withdrawing group, for example, cyano group, nitro group, alkylsulfonyl group, halogen atom, arylsulfonyl group, trihalomethyl group, trialkylamino group, etc. can be mentioned, and cyano group is preferred.

[0124] As G 2 , particularly preferred is 2-cyanoethyl (the group represented by the following formula).

[0125] [Chemical formula 8]

[0126]

[0127] For G 3In terms of this, it can be 2 G 3 Bond with each other to form a cyclic structure. As G 3 , preferably both are isopropyl groups.

[0128] The aforementioned R 1 , R 2 , R 3 , G 2 and G 3 In the definitions of and, the alkyl group can be either linear or branched, preferably an alkyl group having 1 to 12 carbon atoms, more preferably an alkyl group having 1 to 6 carbon atoms. As examples of specific alkyl groups, for example, methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, tert-butyl, n-pentyl, isopentyl, and n-hexyl can be cited. The alkyl part of the alkoxy group constituting the aforementioned substituent has the same definition as the alkyl group defined herein.

[0129] In this specification, a nucleobase refers to a group having a natural or non-natural nucleobase skeleton. The aforementioned nucleobase also includes a modified product obtained by modifying a natural or non-natural nucleobase skeleton.

[0130] B a The nucleobase that can be protected by a protecting group shown is not particularly limited. As such a nucleobase, adenine, cytosine, guanine, uracil, thymine, 5-methylcytosine, pseudouracil, 1-methylpseudouracil, etc. can be cited. In addition, the nucleobase can also be substituted with a substituent. As such a substituent, for example, halogen atoms such as fluorine, chlorine, bromine, and iodine, acyl groups such as acetyl, alkyl groups such as methyl and ethyl, arylalkyl groups such as benzyl, alkoxy groups such as methoxy, alkoxyalkyl groups such as methoxyethyl, cyanoalkyl groups such as cyanoethyl, hydroxyl, hydroxyalkyl, acyloxymethyl, amino, monoalkylamino, dialkylamino, carboxyl, cyano, nitro, etc., and combinations of two or more of them can be cited.

[0131] When the nucleobase has an amino group outside the ring, as the protecting group for this amino group, there is no particular limitation, and a protecting group used in known nucleic acid chemistry can be used. As such a protecting group, for example, benzoyl, 4-methoxybenzoyl, acetyl, propionyl, butyryl, isobutyryl, phenylacetyl, phenoxyacetyl, 4-tert-butylphenoxyacetyl, 4-isopropylphenoxyacetyl, and (dimethylamino)methylene, etc., and combinations of two or more of them can be cited.

[0132] As the nucleobase represented by B a , more specifically, the following structures can be exemplified.

[0133] A group represented by any one of the following formulas.

[0134] [Chemical Formula 9]

[0135]

[0136] (In the above formula,

[0137] R 4 represents a hydrogen atom, methyl group, phenoxyacetyl group, 4-tert-butylphenoxyacetyl group, 4-isopropylphenoxyacetyl group, phenylacetyl group, acetyl group or benzoyl group,

[0138] R 5 represents a hydrogen atom, acetyl group, isobutyryl group or benzoyl group,

[0139] R 6 represents a hydrogen atom, phenoxyacetyl group, 4-tert-butylphenoxyacetyl group, 4-isopropylphenoxyacetyl group, phenylacetyl group, acetyl group or isobutyryl group,

[0140] R 7 represents 2-cyanoethyl,

[0141] R 8 represents a hydrogen atom, methyl group, benzoyl group, 4-methoxybenzoyl group or 4-methylbenzoyl group, and,

[0142] R 9 represents dimethylaminomethylene.).

[0143] In addition, in the method of the present invention, the amide can be used in a free state or in a salt state. As salts of the amide, base addition salts or acid addition salts can be mentioned, and there is no particular limitation. As base addition salts, specifically, salts formed with inorganic bases such as sodium salt, magnesium salt, potassium salt, calcium salt, aluminum salt, etc.; salts formed with organic bases such as methylamine, ethylamine, ethanolamine, etc.; salts formed with basic amino acids such as lysine, ornithine, arginine, etc.; and ammonium salts. As acid addition salts, specifically, salts formed with inorganic acids such as hydrochloric acid, hydrobromic acid, hydroiodic acid, sulfuric acid, nitric acid, phosphoric acid, etc.; organic acids such as formic acid, acetic acid, propionic acid, oxalic acid, malonic acid, malic acid, tartaric acid, fumaric acid, succinic acid, lactic acid, maleic acid, citric acid, methanesulfonic acid, trifluoromethanesulfonic acid, ethanesulfonic acid, etc.; and acid addition salts formed with acidic amino acids such as aspartic acid, glutamic acid, etc. The amide compound also includes forms such as salts, hydrates, solvates, polymorphs, etc.

[0144] When R represents a protected hydroxyl group, the protecting group may be any group that can be used in the amide method. For example, 2'-tert-butyldimethylsilyl (TBDMS group), 2'-bis(2-acetoxyethoxy)methyl (ACE group), 2'-(triisopropylsilyloxy)methyl (TOM group), 2'-(2-cyanoethoxy)ethyl (CEE group), 2'-(2-cyanoethoxy)methyl (CEM group), 2'-p-toluenesulfonylethoxymethyl (TEM group), 2'-EMM group (International Publication No. 2006 / 022323) can be used. In addition, the groups described in International Publication No. 2013 / 027843 and International Publication No. 2019 / 208571 can also be used. Among these 2'-protecting groups of ribonucleosides (RNA), the protecting group shown in formula (15) can be exemplified as a preferred protecting group. More preferably, the protecting group shown in formula (16) having a cyano group as the electron-withdrawing group E W shown can be exemplified.

[0145] [Chemical Formula 10]

[0146]

[0147] [Chemical Formula 11]

[0148]

[0149] (In the formula,

[0150] Q represents an integer from 1 to 5,

[0151] R a and R b are the same as or different from each other, and each represents a methyl group, an ethyl group or a hydrogen atom,

[0152] the bond marked with ** is bonded to the oxygen of the protected hydroxyl group, and

[0153] E W represents an electron-withdrawing group.)

[0154] The protecting group shown in formula (16) can be synthesized, for example, according to the descriptions in International Publication No. 2013 / 027843 and International Publication No. 2019 / 208571, and the amide having this protecting group can be used in the manufacture of nucleic acid molecules.

[0155] In the nucleic acid extension reaction, the amide of formula (3) described in Route A Figure 1 is used.

[0156] (Nucleic acid extension reaction)

[0157] In this specification, the "nucleic acid extension reaction" refers to a reaction in which nucleotides are sequentially bonded via phosphodiester bonds or phosphorothioate bonds to extend a nucleic acid molecule. The nucleic acid extension reaction can be carried out in the order of the usual amidite method (phosphoramidite method). The nucleic acid extension reaction can be carried out using an automatic nucleic acid synthesizer employing the amidite method or the like.

[0158] The chain length of the nucleic acid oligomer can be, for example, 2 to 300 mer, 10 to 200 mer, or 15 to 150 mer.

[0159] The 5'-deprotection step in step (1) is a step of deprotecting the protecting group of the 5'-hydroxyl group at the end of the RNA chain supported on the solid-phase carrier. As common protecting groups, 4,4'-dimethoxytrityl (DMTr group), 4-monomethoxytrityl, and 4,4',4''-trimethoxytrityl can be used. The deprotection can be carried out using an acid. As the acid for deprotection, for example, trifluoroacetic acid, dichloroacetic acid, trifluoromethanesulfonic acid, trichloroacetic acid, methanesulfonic acid, hydrochloric acid, acetic acid, p-toluenesulfonic acid, etc. can be cited.

[0160] The condensation step in step (2) is a reaction in which the nucleoside amide represented by the following formula (3) described in Route A of Figure 1 is bonded to the 5'-hydroxyl group at the end of the oligonucleotide chain deprotected by the aforementioned deprotection step. It should be noted that, as the amide used in nucleic acid extension, the amide compound represented by formula (3) is used. In addition, as other usable amides, 2'-OMe, 2'-F, 2'-O-tert-butyldimethylsilyl, 2'-O-methoxyethyl, 2'-H,2'-fluoro-2'-deoxy-β-D-arabinofuranosyl, etc. can be cited. As the aforementioned nucleoside amide, a nucleoside amide in which the 5'-hydroxyl group is protected by a protecting group (e.g., DMTr group) is used. The condensation step can be carried out using an activator that activates the aforementioned nucleoside amide. As the activator, for example, 5-benzylthio-1H-tetrazole (BTT), 1H-tetrazole, 4,5-dicyanoimidazole (DCI), 5-ethylthio-1H-tetrazole (ETT), N-methylbenzimidazolium trifluoromethanesulfonate (N-MeBIT), benzimidazolium trifluoromethanesulfonate (BIT), N-phenylimidazolium trifluoromethanesulfonate (N-PhIMT), imidazolium trifluoromethanesulfonate (IMT), 5-nitrobenzimidazolium trifluoromethanesulfonate (NBT), 1-hydroxybenzotriazole (HOBT), or 5-(bis-3,5-trifluoromethylphenyl)-1H-tetrazole, etc. can be cited.

[0161] Figure 1 The nucleoside amide represented by formula (3) described in Route A of

[0162] The compound represented by formula (3):

[0163] [Chemical Formula 12]

[0164]

[0165] (In the formula, G 1 , G 2 , G 3 , B a and R are as described above.).

[0166] After the condensation step, it is also possible to appropriately cap the unreacted 5'-hydroxy group. Capping can be carried out using known capping solutions such as acetic anhydride-tetrahydrofuran solution, phenoxyacetic anhydride / N-methylimidazole solution, etc.

[0167] The oxidation step in step (3) is a step of converting the phosphite group formed by the aforementioned condensation step into a phosphate group or a phosphorothioate group. This step is a reaction of converting trivalent phosphorus into pentavalent phosphorus using an oxidizing agent, and can be carried out by allowing the oxidizing agent to act on the oligonucleic acid derivative supported on the solid phase carrier.

[0168] In the case of converting the phosphite group into a phosphate group, as the "oxidizing agent", for example, iodine can be used. This oxidizing agent can be prepared and used at a concentration of 0.005 to 2 M. As the oxygen source for oxidation, water can be used, and as the base for promoting the reaction, pyridine, N-methylimidazole (NMI), N-methylmorpholine, or triethylamine can be used. In addition, as the solvent, as long as it does not participate in the reaction, there is no particular limitation, and acetonitrile, tetrahydrofuran (THF), or a mixture of them in any ratio can be used. For example, iodine / water / pyridine / acetonitrile, or iodine / water / pyridine, or iodine / water / pyridine / NMI, or iodine / water / pyridine / THF can be used. The reaction temperature is preferably 5°C to 50°C. The reaction time is usually appropriately 1 minute to 30 minutes. With respect to 1 mol of the compound supported on the solid phase carrier, the amount of the reagent used is preferably 1 to 100 mol, more preferably 1 to 10 mol.

[0169] In the case of converting a phosphite group into a phosphorothioate group, as the oxidizing agent, for example, sulfur, 3H-1,2-benzodithiol-3-one 1,1-dioxide (Beaucage reagent), 3-amino-1,2,4-dithiazole-5-thione (ADTT), 5-phenyl-3H-1,2,4-dithiazol-3-one (POS), [(N,N-dimethylaminomethylene)amino]-3H-1,2,4-dithiazoline-3-thione (DDTT), and phenylacetyl disulfide (PADS) can be used. The oxidizing agent can be diluted with an appropriate solvent so as to have a concentration of 0.001 to 2 M and used. As the solvent used in the reaction, as long as it does not participate in the reaction, there is no particular limitation, and for example, dichloromethane, acetonitrile, pyridine, or a mixed solvent of any ratio thereof can be mentioned. The oxidation step can be carried out after the above-mentioned capping operation, or conversely, the capping operation can be carried out after this oxidation step, and the order is not limited.

[0170] In step (5), regarding the step of deprotecting the phosphate protecting group, after the synthesis of the nucleic acid having the desired sequence is completed, an amine compound is allowed to act to deprotect the protecting group of the phosphate moiety. As the amine compound, for example, diethylamine and the like described in Japanese Patent No. 4705716 can be mentioned.

[0171] For the protecting group of the 5'-hydroxy group of the nucleoside introduced at the end of the extension, it can be used for column purification with the 5'-protecting group as a label after cleavage from the solid-phase carrier and deprotection of the protecting group described below, or the protecting group of the 5'-hydroxy group can be deprotected after column purification.

[0172] Regarding the cleavage of the nucleic acid oligomer having the desired chain length extended on the solid-phase carrier from the solid-phase carrier in step (5), it is usually carried out using concentrated ammonia water as the cleavage agent.

[0173] Further, ammonia or an amine compound or the like is used, for example, to cleave the oligonucleotide chain from the solid-phase carrier and recover it. As the amine compound, for example, methylamine, ethylamine, isopropylamine, ethylenediamine, diethylamine, and the like can be mentioned.

[0174] In step (6), the protecting group of the 2'- or 3'-hydroxy group of the ribose of the nucleic acid compound (6) cleaved from the solid-phase carrier can be removed according to the methods described in International Publication No. 2006 / 022323, International Publication No. 2013 / 027843, or International Publication No. 2019 / 208571, whereby a deprotected nucleic acid oligomer (7) can be obtained.

[0175] Nucleotides and amides in which the R group in formula (4) is a substituent other than a hydroxyl group can also be produced from nucleosides synthesized by known methods described in, for example, Japanese Patent No. 3745226, International Publication No. 2001 / 053528, or Japanese Unexamined Patent Application Publication No. 2014-221817 and the known methods cited therein. In addition, substances that can be purchased as commercial products can be used and produced according to the methods described in the following examples or methods obtained by appropriately modifying these methods.

[0176] Examples of nucleic acid molecules that can be produced using the production method of the present invention include nucleic acid molecules in which the nucleosides contained in the nucleic acid molecule are RNA, DNA, RNA having 2'-O-MOE, 2'-O-Me, 2'-F, and LNA, but are not limited thereto. For example, examples of various nucleosides described in Xiulong, Shen et al., Nucleic Acids Research, 2018, Vol. 46, No. 46, 1584-1600, and Daniel O’Reilly et al., Nucleic Acids Research, 2019, Vol. 47, No. 2, 546-558 can be cited. Preferably, the nucleic acid molecule produced by the method of the present invention is RNA.

[0177] By adopting the production method of the present invention, as one mode, it is possible to produce an oligonucleotide with a reduced content of branched forms in the oligonucleotide.

[0178] As specific oligonucleotides, specifically, the following substances can be exemplified, but are not limited thereto.

[0179] An oligonucleotide in which the content ratio of the branched form in the oligonucleotide is 15% or less relative to the full-length form (FLP).

[0180] An oligonucleotide in which the content ratio of the branched form in the oligonucleotide is 5.0% or less relative to the full-length form (FLP).

[0181] An oligonucleotide in which the content ratio of the branched form in the oligonucleotide is 4.5% or less relative to the full-length form (FLP).

[0182] An oligonucleotide in which the content ratio of the branched form in the oligonucleotide is 4.1% or less relative to the full-length form (FLP).

[0183] An oligonucleotide in which the content ratio of the branched form in the oligonucleotide is 3.4% or less relative to the full-length form (FLP).

[0184] An oligonucleotide, wherein the content ratio of the branched form in the oligonucleotide is 3.0% or less relative to the full-length form (FLP).

[0185] An oligonucleotide, wherein the content ratio of the branched form in the oligonucleotide is 2.5% or less relative to the full-length form (FLP).

[0186] An oligonucleotide, wherein the content ratio of the branched form in the oligonucleotide is 2.2% or less relative to the full-length form (FLP).

[0187] An oligonucleotide, wherein the content ratio of the branched form in the oligonucleotide is 2.0% or less relative to the full-length form (FLP).

[0188] An oligonucleotide, wherein the content ratio of the branched form in the oligonucleotide is 1.5% or less relative to the full-length form (FLP).

[0189] An oligonucleotide, wherein the content ratio of the branched form in the oligonucleotide is 1.0% or less relative to the full-length form (FLP).

[0190] An oligonucleotide, wherein the chain length of the oligonucleotide is 100 mer or more, and the content ratio of the branched form in the oligonucleotide is 15% or less relative to the full-length form (FLP).

[0191] An oligonucleotide, wherein the chain length of the oligonucleotide is 100 mer or more, and the content ratio of the branched form in the oligonucleotide is 5.0% or less relative to the full-length form (FLP).

[0192] An oligonucleotide, wherein the chain length of the oligonucleotide is 100 mer or more, and the content ratio of the branched form in the oligonucleotide is 4.5% or less relative to the full-length form (FLP).

[0193] An oligonucleotide, wherein the chain length of the oligonucleotide is 100 mer or more, and the content ratio of the branched form in the oligonucleotide is 4.1% or less relative to the full-length form (FLP).

[0194] An oligonucleotide, wherein the chain length of the oligonucleotide is 100 mer or more, and the content ratio of the branched form in the oligonucleotide is 3.4% or less relative to the full-length form (FLP).

[0195] An oligonucleotide, wherein the chain length of the oligonucleotide is 100 mer or more, and the content ratio of the branched form in the oligonucleotide is 3.0% or less relative to the full-length form (FLP).

[0196] An oligonucleotide, wherein the chain length of the oligonucleotide is 100 mer or more, and the content ratio of the branched form in the oligonucleotide is 2.5% or less relative to the full-length form (FLP).

[0197] An oligonucleotide, wherein the oligonucleotide has a chain length of 100 mer or more, and the content ratio of branched bodies in the oligonucleotide is 2.2% or less relative to the full-length body (FLP).

[0198] An oligonucleotide, wherein the oligonucleotide has a chain length of 50 mer or more, and the content ratio of branched bodies in the oligonucleotide is 15% or less relative to the full-length body (FLP).

[0199] An oligonucleotide, wherein the oligonucleotide has a chain length of 50 mer or more, and the content ratio of branched bodies in the oligonucleotide is 5.0% or less relative to the full-length body (FLP).

[0200] An oligonucleotide, wherein the oligonucleotide has a chain length of 50 mer or more, and the content ratio of branched bodies in the oligonucleotide is 4.5% or less relative to the full-length body (FLP).

[0201] An oligonucleotide, wherein the oligonucleotide has a chain length of 50 mer or more, and the content ratio of branched bodies in the oligonucleotide is 4.1% or less relative to the full-length body (FLP).

[0202] An oligonucleotide, wherein the oligonucleotide has a chain length of 50 mer or more, and the content ratio of branched bodies in the oligonucleotide is 3.4% or less relative to the full-length body (FLP).

[0203] An oligonucleotide, wherein the oligonucleotide has a chain length of 50 mer or more, and the content ratio of branched bodies in the oligonucleotide is 3.0% or less relative to the full-length body (FLP).

[0204] An oligonucleotide, wherein the oligonucleotide has a chain length of 50 mer or more, and the content ratio of branched bodies in the oligonucleotide is 2.5% or less relative to the full-length body (FLP).

[0205] An oligonucleotide, wherein the oligonucleotide has a chain length of 50 mer or more, and the content ratio of branched bodies in the oligonucleotide is 2.2% or less relative to the full-length body (FLP).

[0206] An oligonucleotide, wherein the oligonucleotide has a chain length of 50 mer or more and 200 mer or less, and the content ratio of branched bodies in the oligonucleotide is 15% or less relative to the full-length body (FLP).

[0207] An oligonucleotide, wherein the oligonucleotide has a chain length of 50 mer or more and 200 mer or less, and the content ratio of branched bodies in the oligonucleotide is 5.0% or less relative to the full-length body (FLP).

[0208] Oligonucleotide, wherein the oligonucleotide has a chain length of 50 mer or more and 200 mer or less, and the content ratio of the branched form in the oligonucleotide is 4.5% or less relative to the full-length form (FLP).

[0209] Oligonucleotide, wherein the oligonucleotide has a chain length of 50 mer or more and 200 mer or less, and the content ratio of the branched form in the oligonucleotide is 4.1% or less relative to the full-length form (FLP).

[0210] Oligonucleotide, wherein the oligonucleotide has a chain length of 50 mer or more and 200 mer or less, and the content ratio of the branched form in the oligonucleotide is 3.4% or less relative to the full-length form (FLP).

[0211] Oligonucleotide, wherein the oligonucleotide has a chain length of 50 mer or more and 200 mer or less, and the content ratio of the branched form in the oligonucleotide is 3.0% or less relative to the full-length form (FLP).

[0212] Oligonucleotide, wherein the oligonucleotide has a chain length of 50 mer or more and 200 mer or less, and the content ratio of the branched form in the oligonucleotide is 2.5% or less relative to the full-length form (FLP).

[0213] Oligonucleotide, wherein the oligonucleotide has a chain length of 50 mer or more and 200 mer or less, and the content ratio of the branched form in the oligonucleotide is 2.2% or less relative to the full-length form (FLP).

[0214] Oligonucleotide, wherein the oligonucleotide has a chain length of 50 mer or more and 300 mer or less, and the content ratio of the branched form in the oligonucleotide is 15% or less relative to the full-length form (FLP).

[0215] Oligonucleotide, wherein the oligonucleotide has a chain length of 50 mer or more and 300 mer or less, and the content ratio of the branched form in the oligonucleotide is 5.0% or less relative to the full-length form (FLP).

[0216] Oligonucleotide, wherein the oligonucleotide has a chain length of 50 mer or more and 300 mer or less, and the content ratio of the branched form in the oligonucleotide is 4.5% or less relative to the full-length form (FLP).

[0217] Oligonucleotide, wherein the oligonucleotide has a chain length of 50 mer or more and 300 mer or less, and the content ratio of the branched form in the oligonucleotide is 4.1% or less relative to the full-length form (FLP).

[0218] Oligonucleotide, wherein the oligonucleotide has a chain length of 50 mer or more and 300 mer or less, and the content ratio of the branched form in the oligonucleotide is 3.4% or less relative to the full-length form (FLP).

[0219] An oligonucleotide, wherein the oligonucleotide has a chain length of 50 mer or more and 300 mer or less, and the content ratio of the branched form in the oligonucleotide is 3.0% or less relative to the full-length form (FLP).

[0220] An oligonucleotide, wherein the oligonucleotide has a chain length of 50 mer or more and 300 mer or less, and the content ratio of the branched form in the oligonucleotide is 2.5% or less relative to the full-length form (FLP).

[0221] An oligonucleotide, wherein the oligonucleotide has a chain length of 50 mer or more and 300 mer or less, and the content ratio of the branched form in the oligonucleotide is 2.2% or less relative to the full-length form (FLP).

[0222] An oligonucleotide, wherein the oligonucleotide has a chain length of 100 mer or more and 300 mer or less, and the content ratio of the branched form in the oligonucleotide is 15% or less relative to the full-length form (FLP).

[0223] An oligonucleotide, wherein the oligonucleotide has a chain length of 100 mer or more and 300 mer or less, and the content ratio of the branched form in the oligonucleotide is 5.0% or less relative to the full-length form (FLP).

[0224] An oligonucleotide, wherein the oligonucleotide has a chain length of 100 mer or more and 300 mer or less, and the content ratio of the branched form in the oligonucleotide is 4.5% or less relative to the full-length form (FLP).

[0225] An oligonucleotide, wherein the oligonucleotide has a chain length of 100 mer or more and 300 mer or less, and the content ratio of the branched form in the oligonucleotide is 4.1% or less relative to the full-length form (FLP).

[0226] An oligonucleotide, wherein the oligonucleotide has a chain length of 100 mer or more and 300 mer or less, and the content ratio of the branched form in the oligonucleotide is 3.4% or less relative to the full-length form (FLP).

[0227] An oligonucleotide, wherein the oligonucleotide has a chain length of 100 mer or more and 300 mer or less, and the content ratio of the branched form in the oligonucleotide is 3.0% or less relative to the full-length form (FLP).

[0228] An oligonucleotide, wherein the oligonucleotide has a chain length of 100 mer or more and 300 mer or less, and the content ratio of the branched form in the oligonucleotide is 2.5% or less relative to the full-length form (FLP).

[0229] Oligonucleotides, wherein the oligonucleotide has a chain length of 100 mer or more and 300 mer or less, and the content ratio of the branched form in the oligonucleotide is 2.2% or less relative to the full-length form (FLP).

[0230] Regarding typical examples of nucleic acid molecules that can be used in the production method of the present invention, in addition to the examples described in the examples, the following examples are shown, but are not limited to these.

[0231] Hereinafter, in the description of sequences, U represents uridine (ST.25 form), C represents cytidine, A represents adenosine, and G represents guanosine.

[0232] Examples of nucleic acid molecules having the following sequences (A) and (B) described in International Publication No. 2019 / 060442 can be cited.

[0233] Sequence (A): 5'-AUGGAAUmACUCUUGGUUmACdTdT-3' (based on ST.25 form) (5'-ATGGAATmACTCTTGGTTmACdTdT-3' (based on ST.26 form)) (antisense) (SEQ ID NO: 1) 21 mer

[0234] Sequence (B): 5'-GUmAACmCmAAGAGUmAUmUmCmCmAUmdTdT-3' (based on ST.25 form) (5'-GTmAACmCmAAGAGTmATmTmCmCmATmdTdT-3' (based on ST.26 form)) (sense) (SEQ ID NO: 2) 21 mer

[0235] In sequences (A) and (B), Um represents 2'-O-methyluridine (ST.25 form), Tm represents 2'-O-methyluridine (ST.26 form), Cm represents 2'-O-methylcytidine, and dT represents thymidine. In this specification, unless otherwise specified, the abbreviations in the sequences apply to both the ST.25 form and the ST.26 form.

[0236] Examples of nucleic acid molecules described by Daniel O’Reilly et al., Nucleic Acids Research, 2019, Vol. 47, No. 2, 546 - 558 (see page 553) can be cited. As a typical example, a nucleic acid molecule having the following sequence (C) can be cited.

[0237] Sequence (C): 5’-AGAGCCAGCCUUCUUAUUGUUUUAGAGCUAUGCUGU-3’ (based on ST.25 form) (5’-AGAGCCAGCCTTCTTATTGTTTTAGAGCTATGCTGT-3’ (based on ST.26 form)) (SEQ ID NO: 3) 36mer

[0238] A nucleic acid molecule having the following sequence (D) described in Nucleic Acids Research, 2019, Vol.47, No.2:547 can be cited.

[0239] Sequence (D): 5’-ACAGCAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCU-3’ (based on ST.25 form) (5’-ACAGCATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCT-3’ (based on ST.26 form)) (SEQ ID NO: 4) 67mer

[0240] A nucleic acid molecule having the following sequence (E) described in Japanese Patent Application Laid-Open No. 2015-523856, page 173 can be cited.

[0241] Sequence (E): 5’-GUUUUCCCUUUUCAAAGAAAUCUCCUGGGCACCUAUCUUCUUAGGUGCCCUCCCUUGUUUAAACCUGACCAGUUAACCGGCUGGUUAGGUUUUU-3’ (based on ST.25 form) (5’-GTTTTCCCTTTTCAAAGAAATCTCCTGGGCACCTATCTTCTTAGGTGCCCTCCCTTGTTTAAACCTGACCAGTTAACCGGCTGGTTAGGTTTT-3’ (based on ST.26 form)) (SEQ ID NO: 5) 94mer

[0242] A nucleic acid molecule described in Japanese Patent Application Laid-Open No. 2017-537626 can be cited. As a typical example, nucleic acid molecules having the following sequences (F), (G), (H) and (I) can be cited.

[0243] Sequence (F): 5’-AGUCCUCAUCUCCCUCAAGCGUUUUAGAGCUAGUAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU-3’ (based on ST.25 form) (5’-AGTCCTCATCTCCCTCAAGCGTTTTAGAGCTAGTAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTT-3’ (based on ST.26 form)) (SEQ ID NO: 6) 100mer

[0244] Sequence (G): 5’-GCAGAUGUAGUGUUUCCACAGUUUAAGAGCUAUGCUGGAAACAGCAUAGCAAGUUUAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUUUU-3’ (based on ST.25 form) (5’-GCAGATGTAGTGTTTCCACAGTTTAAGAGCTATGCTGGAAACAGCATAGCAAGTTTAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTT-3’ (based on ST.26 form)) (SEQ ID NO: 7) 113mer

[0245] Sequence (H): 5’-dAdGdTdCdCdTdCdAdTdCdTdCdCdCdTdCdAdAdGdCGUUUAAGAGCUAUGCUGGUAACAGCAUAGCAAGUUUAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUUUU-3’ (based on ST.25 form) (5’-dAdGdTdCdCdTdCdAdTdCdTdCdCdCdTdCdAdAdGdCGTTTAAGAGCTATGCTGGTAACAGCATAGCAAGTTTAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTT-3’ (based on ST.26 form)) (SEQ ID NO: 8) 113mer

[0246] In Sequence (H), dT represents thymidine, dC represents 2’-deoxycytidine, dA represents 2’-deoxyadenosine, and dG represents 2’-deoxyguanosine.

[0247] Sequence (I): 5'-AmsGmsUmsCCUCAUCUCCCUCAAGCGUUUAAGAGCUAUGCUGGUAACAGCAUAGCAAGUUUAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUmsUmsUmsU-3' (based on ST.25 form) (5'-AmsGmsTmsCCTCATCTCCCTCAAGCGTTTAAGAGCTATGCTGGTAACAGCATAGCAAGTTTAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTmsTmsTmsT-3' (based on ST.26 form)) (SEQ ID NO: 9), 113mer

[0248] In Sequence (I), Um represents 2'-O-methyluridine (ST.25 form), Tm represents 2'-O-methyluridine (ST.26 form), Am represents 2'-O-methyladenosine, Gm represents 2'-O-methylguanosine, and s represents phosphorothioate modification.

[0249] Examples

[0250] Hereinafter, the present invention will be further described in detail using examples, but the present invention is not limited to these examples.

[0251] In this specification, Me represents methyl. UF water refers to ultrafiltered water.

[0252] Measurement methods

[0253] First, various measurement methods used in the following experiments are shown below.

[0254] (Measurement method 1: Measurement of the FLP ratio and branched body ratio in oligonucleotides)

[0255] The FLP ratio and branched body ratio in oligonucleotides are measured using HPLC. FLP refers to Full Length Product.

[0256] The HPLC measurement conditions are shown in Table 1 below.

[0257] [Table 1]

[0258] Table 1

[0259]

[0260] Solid-phase synthesis of oligonucleotides

[0261] Sequence (J): 5’-AmsUmsAmsACUCAAUUUGUAAAAAAGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUmsUmsUmsU-3’ (based on ST.25 form) (5’-AmsCmsTmsCAATTTGTAAAAAAGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTmsTmsTmsT-3’ (based on ST.26 form)) (SEQ ID NO: 10) 100mer

[0262] In sequence (J), "A" is represented by the partial structure delimited by a wavy line in the following formula (A1). "C" is represented by the partial structure delimited by a wavy line in the following formula (A2). "G" is represented by the partial structure delimited by a wavy line in the following formula (A3). U is represented by the partial structure delimited by a wavy line in the following formula (A4). "Ums" is represented by the partial structure delimited by a wavy line in the following formula (A5). "Ams" is represented by the partial structure delimited by a wavy line in the following formula (A6). It should be noted that the "Ams" at the 5’ end is represented by the upper partial structure delimited by a wavy line in the following formula (A7). Additionally, the "U" at the 3’ end is represented by the lower partial structure delimited by a wavy line in the following formula (A8). Among them, the phosphate group in the structural formula can be a salt.

[0263] [Chemical Formula 13]

[0264]

[0265] [Chemical Formula 14]

[0266]

[0267] [Chemical Formula 15]

[0268]

[0269] [Chemical Formula 16]

[0270]

[0271] [Chemical Formula 17]

[0272]

[0273] [Chemical Formula 18]

[0274]

[0275] [Chemical Formula 19]

[0276]

[0277] [Chemical Formula 20]

[0278]

[0279] As the solid-phase carrier, Controlled Pore Glass (CPG) was used. As the nucleic acid synthesizer, AKTA oligopilot plus 100 (manufactured by GE Healthcare) was used. Using the phosphoramidite solid-phase synthesis method, the oligonucleotide composed of the above sequence (J) was synthesized from the 3'-side to the 5'-side. The synthesis was carried out on a scale of 9.79 μmol. In addition, during the synthesis, adenosine PMM amide (compound (A9)), cytidine PMM amide (compound (A10)), guanosine PMM amide (compound (A11)), and uridine PMM amide (compound (A12)), as well as adenosine 2'-OMe amide (compound (A13)) and uridine 2'-OMe amide (compound (A14)) described in International Publication No. 2019 / 208571 were used. As the deprotection solution, a toluene solution of dichloroacetic acid was used. As the condensing agent, 5-benzylmercapto-1H-tetrazole was used. As the oxidizing agent, an iodine solution was used. As the capping solution, a solution of phenoxyacetic anhydride and a solution of N-methylimidazole were used. After the nucleic acid extension was completed, a diethylamine solution was allowed to act on the nucleic acid on the carrier, thereby selectively deprotecting the cyanoethyl protecting group of the phosphate moiety. Here, PMM is an abbreviation for (((1-cyanopropan-2-yl)oxy)methoxy)methyl).

[0280] [Chemical Formula 21]

[0281]

[0282] [Chemical Formula 22]

[0283]

[0284] [Chemical Formula 23]

[0285]

[0286] [Chemical Formula 24]

[0287]

[0288] [Chemical Formula 25]

[0289]

[0290] [Chemical formula 26]

[0291]

[0292] Next, a specific production example of an oligonucleotide (nucleic acid oligomer) produced by the production method of the present invention is shown. Here, the oligonucleotide produced by the production method of the present invention in the following examples is an oligonucleotide having the sequence (J) shown in the aforementioned Sequence No. 10.

[0293] In addition, the uridine derivatives described in the following examples and comparative examples refer to the compounds represented by the following structural formula. The circle shown in the following structural formula schematically shows CPG.

[0294] [Chemical formula 27]

[0295]

[0296] Reference Example 1

[0297] Using CPG loaded with 9.79 μmol of uridine derivative and the amides represented by formula (A9), formula (A10), formula (A11), formula (A12), formula (A13) or formula (A14), solid-phase synthesis of sequence (J) was carried out using AKTA oligopilot plus100. Then, the CPG carrier loaded with 5.01 μmol of oligonucleotide was collected, 2.85 mL of 28% ammonia water and 0.95 mL of ethanol were flowed in, and the mixture was incubated at 40 °C for 6 hours to liberate the oligonucleotide from the solid-phase carrier. Next, the solvent was removed by concentration, and the free oligonucleotide was dissolved in 3.78 mL of dimethyl sulfoxide. Then, 1.06 mL of acetonitrile, 67 μL of nitromethane and a stir bar were added, and then, under stirring by a stirrer, a dimethyl sulfoxide solution of 1 M tetrabutylammonium fluoride (TBAF) dehydrated with molecular sieve 4A was added dropwise at room temperature over 1 hour. The mixture was incubated at 33 °C for 4 hours to remove the PMM protecting group at the 2'-position. Then, a crude product of the oligonucleotide oligomer was obtained by a precipitation operation.

[0298] Example 1

[0299] 3 mg of the crude product obtained in Reference Example 1 was added to a 2 mL glass vial (manufactured by Agilent) and dissolved in 1 mL of 50% acetic acid aqueous solution. The vial containing the mixed solution was placed in a thermostatic incubator (manufactured by Kenis) adjusted to 25 °C and left standing for 30 minutes. After standing, the vial was taken out of the thermostatic incubator, and the ratio of the branched form to FLP was calculated by the method described in the aforementioned Measurement Method 1. The results are shown in Table 2.

[0300] Example 2

[0301] 3 mg of the crude product obtained in Reference Example 1 was added to a 2-mL glass test tube (manufactured by Agilent) and dissolved in 1 mL of a 10% aqueous acetic acid solution. The test tube containing the mixed solution was placed in a thermostatic incubator (manufactured by Kenis) adjusted to 25°C and allowed to stand for 2 hours. After standing, the test tube was taken out of the thermostatic incubator, and the ratio of the branched form to FLP was calculated by the method described in Measurement Method 1 above. The results are shown in Table 2.

[0302] Example 3

[0303] 3 mg of the crude product obtained in Reference Example 1 was added to a 2-mL glass test tube (manufactured by Agilent) and dissolved in 1 mL of a 0.5% aqueous acetic acid solution. The test tube containing the mixed solution was placed in a thermostatic incubator (manufactured by Kenis) adjusted to 25°C and allowed to stand for 24 hours. After standing, the test tube was taken out of the thermostatic incubator, and the ratio of the branched form to FLP was calculated by the method described in Measurement Method 1 above. The results are shown in Table 2.

[0304] Example 4

[0305] 3 mg of the crude product obtained in Reference Example 1 was added to a 2-mL glass test tube (manufactured by Agilent) and dissolved in 1 mL of 0.1 M sodium acetate buffer (pH = 5.2). The test tube containing the mixed solution was placed in a thermostatic incubator (manufactured by Kenis) adjusted to 25°C and allowed to stand for 48 hours. After standing, the test tube was taken out of the thermostatic incubator, and the ratio of the branched form to FLP was calculated by the method described in Measurement Method 1 above. The results are shown in Table 2.

[0306] Example 5

[0307] 3 mg of the crude product obtained in Reference Example 1 was added to a 2-mL glass test tube (manufactured by Agilent) and dissolved in 1 mL of UF water. The test tube containing the mixed solution was placed in a thermostatic incubator (manufactured by Kenis) adjusted to 25°C and allowed to stand for 1 week. After standing, the test tube was taken out of the thermostatic incubator, and the ratio of the branched form to FLP was calculated by the method described in Measurement Method 1 above. The results are shown in Table 2.

[0308] Example 6

[0309] 3 mg of the crude product obtained in Reference Example 1 was added to a 2-mL glass test tube (manufactured by Agilent) and dissolved in 1 mL of UF water. The test tube containing the mixed solution was placed in a thermostatic incubator (manufactured by Kenis) adjusted to 40 °C and allowed to stand for 72 hours. After standing, the test tube taken out from the thermostatic incubator was cooled to room temperature, and the ratio of the branched form to FLP was calculated by the method described in the aforementioned Measuring Method 1. The results are shown in Table 2.

[0310] Example 7

[0311] 3 mg of the crude product obtained in Reference Example 1 was added to a 2-mL glass test tube (manufactured by Agilent) and dissolved in 1 mL of UF water. The test tube containing the mixed solution was placed in a thermostatic incubator (manufactured by Kenis) adjusted to 50 °C and allowed to stand for 24 hours. After standing, the test tube taken out from the thermostatic incubator was cooled to room temperature, and the ratio of the branched form to FLP was calculated by the method described in the aforementioned Measuring Method 1. The results are shown in Table 2.

[0312] Example 8

[0313] 3 mg of the crude product obtained in Reference Example 1 was placed in a 2-mL glass test tube (manufactured by Agilent) and dissolved in 1 mL of UF water. The test tube containing the mixed solution was placed in a thermostatic incubator (manufactured by Kenis) adjusted to 60 °C and allowed to stand for 6 hours. After standing, the test tube taken out from the thermostatic incubator was cooled to room temperature, and the ratio of the branched form to FLP was calculated by the method described in the aforementioned Measuring Method 1. The results are shown in Table 2.

[0314] Example 9

[0315] 3 mg of the crude product obtained in Reference Example 1 was placed in a 2-mL glass test tube (manufactured by Agilent) and dissolved in 1 mL of 0.1 M Tris-HCl buffer (pH = 7.5). The test tube containing the mixed solution was placed in a thermostatic incubator (manufactured by Kenis) adjusted to 60 °C and allowed to stand for 24 hours. After standing, the test tube taken out from the thermostatic incubator was cooled to room temperature, and the ratio of the branched form to FLP was calculated by the method described in the aforementioned Measuring Method 1. The results are shown in Table 2.

[0316] Comparative Example 1

[0317] 3 mg of the crude product obtained in Reference Example 1 was placed in a 2-mL glass test tube (manufactured by Agilent) and dissolved in 1 mL of 0.1 M Tris-HCl buffer (pH = 9.0). The test tube containing the mixed solution was placed in a constant temperature incubator (manufactured by Kenis) preheated to 60 °C and allowed to stand for 6 hours. After standing, the test tube taken out from the constant temperature incubator was cooled to room temperature, and the ratio of the branched form to FLP was calculated by the method described in the aforementioned Measurement Method 1. The results are shown in Table 2.

[0318] Comparative Example 2 (Initial value: before reaction)

[0319] 3 mg of the crude product obtained in Reference Example 1 was dissolved in 1 mL of UF water, and the ratio of the branched form to FLP was calculated by the method described in the aforementioned Measurement Method 1. The results are shown in Table 2.

[0320] Comparative Example 3 (Reaction conditions described in Non-Patent Document 2)

[0321] According to the method described in Non-Patent Document 2 (Oligonucleotides 2006, 16, 181-185), the synthesized crude oligonucleotide was treated with triethylamine trihydrofluoride. Specifically, 3 mg of the crude product obtained in Reference Example 1 was placed in a 2-mL glass test tube (manufactured by Agilent), and triethylamine trihydrofluoride was added. The test tube containing the mixture was placed in a constant temperature incubator (manufactured by Kenis) preheated to 65 °C and allowed to stand for 1.5 hours. After standing, the test tube taken out from the constant temperature incubator was cooled to room temperature, and the ratio of the branched form to FLP was calculated by the method described in the aforementioned Measurement Method 1. The results are shown in Table 2.

[0322] Comparative Example 4 (Reaction conditions described in Non-Patent Document 3)

[0323] According to the method described in Non-Patent Document 3 (J. Org. Chem., 1970, 35, 3800-3803), the synthesized crude oligonucleotide was treated with 80% aqueous acetic acid solution at 100 °C. Specifically, 3 mg of the crude product obtained in Reference Example 1 was placed in a 2-mL glass test tube (manufactured by Agilent) and dissolved in 1 mL of 80% aqueous acetic acid solution. The test tube containing the mixed solution was placed in an oil bath preheated to 100 °C and allowed to stand for 20 minutes. After standing, the test tube taken out from the oil bath was cooled to room temperature, and the ratio of the branched form to FLP was calculated by the method described in the aforementioned Measurement Method 1. The results are shown in Table 2.

[0324] The results of Examples 1 to 9 and Comparative Examples 1 to 4 are shown in Table 2. In Table 2, N.D. means not detected.

[0325] [Table 2]

[0326] Table 2

[0327]

[0328] In Table 2, the branched body ratio refers to the ratio (area percentage) of the branched bodies in the oligonucleotide obtained by analyzing the oligonucleotide using the aforementioned measurement method 1. In addition, the FLP ratio refers to the ratio (area percentage) of the FLP in the oligonucleotide obtained by analyzing the oligonucleotide using the aforementioned measurement method 1. "Branched body / FLP" refers to the content ratio of the branched body when the ratio of the FLP in the oligonucleotide is set to 100%, and is calculated by the following formula.

[0329] "Branched body / FLP" (%) = Branched body ratio / FLP ratio × 100

[0330] Industrial applicability

[0331] By using the production method of the present invention, the branched bodies generated in the production of oligonucleotides can be selectively decomposed. Thus, an increase in the yield and purity of the oligonucleotides can be expected.

[0332] Sequence listing free text

[0333] The sequence numbers 1 to 10 in the sequence listing represent the base sequences of the oligonucleotides produced by the production method of the oligonucleotides according to the present invention.

Claims

1. A method for producing an oligonucleotide, the method for producing the oligonucleotide comprising a step of decomposing a branch by reacting n polymeric oligonucleotides (n represents any integer of 2 or more) with water or an aqueous solution having a pH of 1 to 8.

2. The method for producing an oligonucleotide according to claim 1, wherein, The step of decomposing the branch includes a reaction of selectively cleaving the aminophosphate bond of the branch.

3. The method for manufacturing an oligonucleotide according to any one of claims 1 or 2, wherein, The crude oligonucleotide after solid-phase synthesis is used as a starting material.

4. The method for producing an oligonucleotide according to any one of claims 1 to 3, wherein, The step of decomposing the branch includes a step of mixing and reacting n polymeric oligonucleotides (n represents any integer of 2 or more) with water or an aqueous solution having a pH of 1 to 8 for 10 minutes or more.

5. The manufacturing method according to any one of claims 1 to 4, wherein, The reaction temperature is 0 to 60 °C.

6. The manufacturing method according to any one of claims 1 to 5, wherein, The water or aqueous solution having a pH of 1 to 8 is an aqueous solution containing acetic acid or acetate.

7. The manufacturing method according to any one of claims 1 to 5, wherein, The water or aqueous solution having a pH of 1 to 8 is a Tris-HCl buffer solution having a pH of 7 to 8.

8. The manufacturing method according to any one of claims 1 to 5, wherein, The water or aqueous solution having a pH of 1 to 8 is water.

9. The manufacturing method according to any one of claims 1 to 8, wherein, The n polymeric oligonucleotides are n polymeric oligonucleotides containing nucleotides having 2'-OMe.

10. The manufacturing method according to any one of claims 1 to 9, wherein, The n polymeric oligonucleotides are n polymeric oligonucleotides containing nucleotides having 2'-OH.

11. The manufacturing method according to any one of claims 1 to 10, wherein, The pH of the aqueous solution is 1 to 2, and the reaction temperature is 0 to 30 °C.

12. The manufacturing method according to any one of claims 1 to 10, wherein, The pH of the aqueous solution is 3 to 4, and the reaction temperature is 0 to 50 °C.

13. The manufacturing method according to any one of claims 1 to 10, wherein, The pH of the aqueous solution is 5 to 8, and the reaction temperature is 20 to 60 °C.

14. An oligonucleotide, wherein, The content ratio of the branch is 15% or less relative to the full-length body (FLP).

15. An oligonucleotide, wherein, The content ratio of the branch is 5% or less relative to the FLP.

16. An oligonucleotide having a chain length of 50 or more, wherein, The content ratio of the branch is 5% or less relative to the FLP.

17. An oligonucleotide having a chain length of 100 or more, wherein, The content ratio of the branch is 5% or less relative to the FLP.

18. The manufacturing method according to any one of claims 1 to 13, wherein, The oligonucleotide is RNA.

19. The oligonucleotide according to any one of claims 14 to 17, wherein The oligonucleotide is RNA.

Images