Brevibacillus laterosporus and application thereof

Abstract

The invention provides brevibacillus laterosporus LY15-1 and application of the brevibacillus laterosporus LY15-1, the brevibacillus laterosporus LY15-1 is preserved in China General Microbiological Culture Collection Center on February 8, 2025, and the preservation number of the brevibacillus laterosporus LY15-1 is CGMCC No. 33504. The brevibacillus laterosporus disclosed by the invention has excellent effects of promoting growth and preventing and treating root rot at the same time.

Description

Technical Field

[0001] The present invention relates to the technical field of microorganisms, in particular to Brevibacillus laterosporus and applications thereof. Background Art

[0002] In my country's crop production, the long-term and large-scale application of chemical fertilizers has caused soil acidification and compaction, a decrease in the number of active microorganisms, and low utilization rates of nutrients such as phosphorus and potassium, making it difficult to provide the balanced and sufficient nutrition required for crop growth, thereby significantly limiting the improvement of crop yield and quality. At the same time, continuous cropping for many years has led to serious soil-borne diseases and other problems, seriously affecting the improvement of crop yield and quality. Destructive soil-borne diseases such as wilt, blight, and root rot are serious and often lead to large-scale plant deaths. There is currently no better prevention and control method. Chemical fungicides have a short efficacy and cannot provide long-term protection for plants. Their pollution to the environment and their residues on fruits affect people's health.

[0003] Microbial fertilizers, formulations containing active beneficial microorganisms, can promote nutrient supply and absorption, regulate plant growth, enhance plant stress resistance, improve the soil environment, and increase crop yields. They play a vital role in crop cultivation and soil remediation. Brevibacillus laterosporus is a widely used microorganism in agricultural microbial agents, characterized by strong stress resistance, high enzyme production activity, and a broad antimicrobial spectrum.

[0004] How to obtain a Brevibacillus laterosporus that has excellent growth-promoting and root rot prevention functions, and its application in the fields of biological control, plant growth promotion and soil improvement, needs further exploration. Summary of the Invention

[0005] The present invention aims to at least partially address one of the problems in the related art. To this end, the present invention provides a strain of Brevibacillus laterosporus and its use in a microbial agent, a composite agent, and a microbial fertilizer, which can simultaneously achieve positive effects in promoting plant seedling growth and preventing and controlling plant root rot.

[0006] The first aspect of the present invention provides a Brevibacillus laterosporusLY15-1, which was deposited in the General Microbiology Center of the China Culture Collection Administration on February 8, 2025, with a deposit number of CGMCC No. 33504, and a deposit address of No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing.

[0007] The Brevibacillus laterosporus provided by the present invention is a pure strain isolated from corn rhizosphere soil in Yinan County, Linyi City, Shandong Province.

[0008] According to an embodiment of the present invention, the Brevibacillus laterosporus has a 16S rRNA sequence as shown in SEQ ID NO: 1.

[0009] A second aspect of the present invention provides a microbial agent, which includes the Brevibacillus laterosporus described in the first aspect.

[0010] According to an embodiment of the present invention, the effective viable count of the Brevibacillus laterosporus in the microbial agent is at least 5.0×10 10 CFU / g.

[0011] According to an embodiment of the present invention, the bacterial agent is in dry powder form.

[0012] The third aspect of the present invention provides a composite bacterial agent, which includes the microbial agent described in the second aspect.

[0013] According to an embodiment of the present invention, the composite microbial agent includes a first microbial agent and a second microbial agent, the first microbial agent is the microbial agent described in the second aspect, the first microbial agent includes Brevibacillus laterosporus, and the second microbial agent includes at least one selected from Bacillus subtilis, Bacillus licheniformis, Bacillus velezii, and Bacillus amyloliquefaciens.

[0014] According to an embodiment of the present invention, the composite microbial agent includes 20 to 50 parts by weight of the first microbial agent and 20 to 50 parts by weight of the second microbial agent; wherein the second microbial agent is selected from at least one of the following:

[0015] 20-50 parts by weight of Bacillus subtilis;

[0016] 20-50 parts by weight of Bacillus licheniformis;

[0017] 20-50 parts by weight of Bacillus Velez;

[0018] 20 to 50 parts by weight of Bacillus amyloliquefaciens.

[0019] According to an embodiment of the present invention, the composite bacterial agent includes Brevibacillus laterosporus and at least one selected from Bacillus subtilis, Bacillus licheniformis, Bacillus velezensis, and Bacillus amyloliquefaciens;

[0020] in,

[0021] The effective viable bacterial count of Brevibacillus laterosporus is at least 5.0×10 10 CFU / g;

[0022] The effective viable bacteria count of the Bacillus subtilis is at least 1.0×10 11 CFU / g;

[0023] The effective viable bacterial count of the Bacillus licheniformis is at least 1.0×10 11 CFU / g;

[0024] The effective viable bacterial count of the Velez Bacillus is at least 1.0×10 11 CFU / g;

[0025] The effective viable bacterial count of the Bacillus amyloliquefaciens is at least 1.0×10 11 CFU / g.

[0026] The fourth aspect of the present invention provides a microbial fertilizer, which includes the Brevibacillus laterosporus described in the first aspect, the microbial agent described in the second aspect, or the composite agent described in the third aspect. The Brevibacillus laterosporus and the microbial agent and composite agent containing the same provided by the present invention are used in the preparation of microbial fertilizers, which can achieve positive effects on promoting plant seedling growth and preventing and controlling plant root rot.

[0027] According to an embodiment of the present invention, the microbial fertilizer is a solid fertilizer, and the number of effective living microorganisms contained in the microbial fertilizer is at least 1.8×10 8 CFU / g; or, the microbial fertilizer is a liquid fertilizer, and the effective viable count of microorganisms contained in the microbial fertilizer is at least 1.8×10 8 CFU / mL.

[0028] According to an embodiment of the present invention, the microbial fertilizer further includes a basic fertilizer, and the basic fertilizer includes at least one selected from compound fertilizer, organic fertilizer, and organic-inorganic fertilizer.

[0029] The fifth aspect of the present invention provides a crop fertilization method, comprising: applying at least one of Brevibacillus laterosporus, a microbial agent, a composite agent, and a microbial fertilizer to the crop, wherein the Brevibacillus laterosporus is the Brevibacillus laterosporus described in the first aspect of the present invention, the microbial agent is the microbial agent described in the second aspect of the present invention, the composite agent is the composite agent described in the third aspect of the present invention, and the microbial fertilizer is the microbial fertilizer described in the fourth aspect of the present invention.

[0030] According to an embodiment of the present invention, the crop is selected from at least one of strawberry, tomato, corn, and potato.

[0031] The sixth aspect of the present invention provides a method for promoting crop seedling growth or preventing and controlling crop root rot, comprising: applying at least one of Brevibacillus laterosporus, a microbial agent, a composite agent, and a microbial fertilizer to the crop, wherein the Brevibacillus laterosporus is the Brevibacillus laterosporus described in the first aspect of the present invention, the microbial agent is the microbial agent described in the second aspect of the present invention, the composite agent is the composite agent described in the third aspect of the present invention, and the microbial fertilizer is the microbial fertilizer described in the fourth aspect of the present invention.

[0032] According to an embodiment of the present invention, the crop is selected from at least one of strawberry, tomato, corn, and potato.

[0033] The Brevibacillus laterosporus of the present invention has excellent effects of promoting growth and preventing and treating root rot, and is an innovative strain independently screened by the applicant.

[0034] Additional aspects and advantages of the present invention will be set forth in part in the description which follows and, in part, will be obvious from the description which follows, or may be learned by practice of the present invention.

[0035] Collection information:

[0036] Strain name: Brevibacillus laterosporus

[0037] Deposit date: February 8, 2025

[0038] Depository: General Microbiology Center of China Culture Collection Administration

[0039] Deposit number: CGMCC No.33504 BRIEF DESCRIPTION OF THE DRAWINGS

[0040] The above and / or additional aspects and advantages of the present invention will become apparent and readily understood from the following description of the embodiments with reference to the accompanying drawings, in which:

[0041] Figure 1 A photograph of the colony morphology of strain LY15-1 on culture medium is shown;

[0042] Figure 2 Gram-stained photographs of strain LY15-1 are shown;

[0043] Figure 3 A schematic diagram of the phylogenetic tree of strain LY15-1 is shown;

[0044] Figure 4 It shows that the present invention obtains the IAA standard curve. DETAILED DESCRIPTION

[0045] Below with reference to embodiment, the scheme of the present invention will be explained.It will be appreciated by those skilled in the art that the following examples are merely illustrative of the present invention and should not be regarded as limitations of the elements of the embodiments of the present invention, nor should they be regarded as limiting the scope of the present invention. Where specific techniques or conditions are not indicated in the examples, they are carried out according to the techniques or conditions described in the literature in this area or according to the product specifications. Reagents or instruments used that do not indicate manufacturers are conventional products that can be obtained commercially.

[0046] It should be noted that the terms "first" and "second" are used for descriptive purposes only and should not be understood to indicate or imply relative importance or implicitly specify the number of the technical features indicated. Therefore, features defined as "first" or "second" may explicitly or implicitly include one or more of such features. Furthermore, in the description of the present invention, unless otherwise specified, "plurality" means two or more.

[0047] The endpoints of the ranges and any values disclosed herein are not limited to the precise ranges or values, and these ranges or values should be understood to include values close to these ranges or values. For numerical ranges, the endpoints of each range, the endpoints of each range and individual point values, and the individual point values can be combined with each other to obtain one or more new numerical ranges, which should be considered to be specifically disclosed herein.

[0048] In order to make the present invention more easily understood, certain technical and scientific terms are specifically defined below. Unless otherwise clearly defined elsewhere in this document, all other technical and scientific terms used herein have the meaning commonly understood by those skilled in the art to which the present invention belongs.

[0049] In this document, the terms “include” or “comprising” are open expressions, that is, including the contents specified in the present invention, but not excluding other contents.

[0050] As used herein, the terms "optionally," "optional," or "optionally" generally mean that the subsequently described event or circumstance may but need not occur, and that the description includes instances where the event or circumstance occurs and instances where it does not.

[0051] In a first aspect, the present invention provides a Brevibacillus laterosporus LY15-1, which was deposited in the General Microbiology Center of the China Culture Collection Administration on February 8, 2025, with a deposit number of CGMCC No. 33504. The microorganism was isolated from corn rhizosphere soil in Yinan County, Linyi City, Shandong Province. The strain was identified as Brevibacillus laterosporus by analysis of morphological, physiological and biochemical, and molecular biological characteristics.

[0052] According to an embodiment of the present invention, the colonies of Brevibacillus laterosporus LY15-1 of the present invention are round, small, off-white, with neat edges, a moist and smooth surface, no wrinkles, opaque, Gram-positive, rod-shaped cells, canoe-shaped lateral spores, oval, and swollen cysts.

[0053] According to an embodiment of the present invention, the Brevibacillus laterosporus has a 16S rRNA sequence as shown in SEQ ID NO: 1.

[0054] A second aspect of the present invention provides a microbial agent, which includes the Brevibacillus laterosporus described in the first aspect.

[0055] According to an embodiment of the present invention, the effective viable count of the Brevibacillus laterosporus strain in the microbial inoculant is at least 5.0×10 10 CFU / g.

[0056] According to an embodiment of the present invention, the microbial agent is in dry powder form and is prepared by the following steps: subjecting the Brevibacillus laterosporus to liquid fermentation culture, collecting the fermentation liquid and spray drying it to obtain the microbial agent.

[0057] According to an embodiment of the present invention, the culture medium used for the liquid fermentation culture comprises, in parts by weight:

[0058] 1 to 7 parts by weight of corn starch,

[0059] 1 to 7 parts by weight of soybean meal powder,

[0060] 0.2 to 1 parts by weight of calcium carbonate,

[0061] 0.5 to 5 parts by weight of glucose,

[0062] 0.1 to 0.4 parts by weight of potassium dihydrogen phosphate,

[0063] 0.1 to 0.4 parts by weight of dipotassium hydrogen phosphate,

[0064] 0.1 to 0.3 parts by weight of magnesium sulfate,

[0065] 0.01 to 0.05 parts by weight of manganese sulfate.

[0066] According to an embodiment of the present invention, the indoleacetic acid IAA yield of the Brevibacillus laterosporus or the microbial agent of the present invention reaches 92.65 mg / L.

[0067] The third aspect of the present invention provides a composite bacterial agent, which includes the microbial agent described in the second aspect.

[0068] According to an embodiment of the present invention, the composite microbial agent includes a first microbial agent and a second microbial agent, the first microbial agent is the microbial agent described in the second aspect, the first microbial agent includes Brevibacillus laterosporus, and the second microbial agent includes at least one selected from Bacillus subtilis, Bacillus licheniformis, Bacillus velezii, and Bacillus amyloliquefaciens.

[0069] According to an embodiment of the present invention, the composite microbial agent includes 20 to 50 parts by weight of the first microbial agent and 20 to 50 parts by weight of the second microbial agent; wherein the second microbial agent is selected from at least one of the following:

[0070] 20-50 parts by weight of Bacillus subtilis;

[0071] 20-50 parts by weight of Bacillus licheniformis;

[0072] 20-50 parts by weight of Bacillus Velez;

[0073] 20 to 50 parts by weight of Bacillus amyloliquefaciens.

[0074] According to an embodiment of the present invention, the composite bacterial agent includes Brevibacillus laterosporus and at least one selected from Bacillus subtilis, Bacillus licheniformis, Bacillus velezensis, and Bacillus amyloliquefaciens.

[0075] According to an embodiment of the present invention,

[0076] The effective viable bacterial count of Brevibacillus laterosporus is at least 5.0×10 10 CFU / g;

[0077] The effective viable bacteria count of the Bacillus subtilis is at least 1.0×10 11 CFU / g;

[0078] The effective viable bacterial count of the Bacillus licheniformis is at least 1.0×10 11 CFU / g;

[0079] The effective viable bacterial count of the Velez Bacillus is at least 1.0×10 11 CFU / g;

[0080] The effective viable bacterial count of the Bacillus amyloliquefaciens is at least 1.0×10 11 CFU / g.

[0081] The fourth aspect of the present invention provides a microbial fertilizer, which includes the Brevibacillus laterosporus described in the first aspect, and / or the microbial agent described in the second aspect, and / or the composite agent described in the third aspect. The Brevibacillus laterosporus and the microbial agent and composite agent containing the same provided by the present invention are used in the preparation of microbial fertilizers, which can achieve positive effects on promoting plant seedling growth and preventing and controlling plant root rot.

[0082] According to an embodiment of the present invention, the microbial fertilizer is a solid fertilizer, and the number of effective living microorganisms contained in the microbial fertilizer is at least 1.8×10 8 CFU / g; or, the microbial fertilizer is a liquid fertilizer, and the effective viable count of microorganisms contained in the microbial fertilizer is at least 1.8×10 8 CFU / mL.

[0083] According to an embodiment of the present invention, the microbial fertilizer further includes a basic fertilizer, and the basic fertilizer includes at least one selected from compound fertilizer, organic fertilizer, and organic-inorganic fertilizer.

[0084] The fifth aspect of the present invention provides a crop fertilization method, comprising: applying an effective amount of at least one of Brevibacillus laterosporus, a microbial agent, a composite agent, and a microbial fertilizer to the crop, wherein the Brevibacillus laterosporus is the Brevibacillus laterosporus described in the first aspect of the present invention, the microbial agent is the microbial agent described in the second aspect of the present invention, the composite agent is the composite agent described in the third aspect of the present invention, and the microbial fertilizer is the microbial fertilizer described in the fourth aspect of the present invention.

[0085] According to an embodiment of the present invention, the crop is selected from at least one of strawberry, tomato, corn, and potato.

[0086] The sixth aspect of the present invention provides a method for promoting crop seedling growth or preventing and controlling crop root rot, comprising: applying at least one of Brevibacillus laterosporus, a microbial agent, a composite agent, and a microbial fertilizer to the crop, wherein the Brevibacillus laterosporus is the Brevibacillus laterosporus described in the first aspect of the present invention, the microbial agent is the microbial agent described in the second aspect of the present invention, the composite agent is the composite agent described in the third aspect of the present invention, and the microbial fertilizer is the microbial fertilizer described in the fourth aspect of the present invention.

[0087] According to an embodiment of the present invention, the crop is selected from at least one of strawberry, tomato, corn, and potato.

[0088] Below, the scheme of the present invention will be explained in conjunction with embodiment.It will be understood by those skilled in the art that the following examples are only used to illustrate the present invention and should not be regarded as limiting the scope of the present invention.In the embodiment, if specific technology or conditions are not indicated, the technology or conditions described in the literature in this area or the product instructions are used.The reagents or instruments used are not indicated by the manufacturer, and are all conventional products that can be obtained by commercial purchase.

[0089] Example 1 Isolation and identification of Brevibacillus laterosporus LY15-1

[0090] Step 1: Isolation of Brevibacillus laterosporus LY15-1

[0091] Brevibacillus laterosporus LY15-1 was isolated from rhizosphere soil using a dilution spreading method, which specifically includes the following steps:

[0092] From the corn field in Yinan County, Linyi City, Shandong Province, 10 g of corn rhizosphere soil was placed in 90 mL of sterile water, shaken and dispersed thoroughly, and allowed to stand at room temperature for 30 min to separate. 1 ml of the upper layer liquid was added to 9 mL of sterile water and diluted to 10 -4 , 10 -5 , 10 -6 Concentration. Use the dilution plate method to -4 , 10 -5 , 10 -6 Take 0.1 mL of the diluted solution with the highest concentration and spread it evenly on an LB plate. Incubate it at 37°C for 24 h. Select strains with different colony morphologies and streak them on the LB plate for purification twice to obtain strain LY15-1. Store it at 4°C for later use.

[0093] Step 2: Identification of Brevibacillus laterosporus LY15-1

[0094] The strain LY15-1 obtained in step 1 was identified by morphological, physiological and biochemical, and molecular biological characteristics, as follows:

[0095] (1) Morphological characteristics

[0096] On the LB plate, the colonies are round, small, off-white, with neat edges, a moist and smooth surface, no wrinkles, and opaque. Figure 1 As shown; Gram staining is positive, microscopic examination of the cells is rod-shaped, with canoe-shaped lateral spores, oval, and swollen cysts, such as Figure 2 shown.

[0097] (2) Physiological and biochemical characteristics

[0098] The fatty acid composition of strain LY15-1 was detected by the rapid identification system of microbial fatty acids (MIDI), and it was found that the main fatty acids of the strain of the present invention were C 15:0anteiso, C 15:0 iso,C 16:0 ISO and C 16:0 , and their contents were 57.19%, 23.05%, 3.67% and 1.90% respectively. The specific fatty acid results are shown in Table 1. The strain of the present invention conforms to the main cellular fatty acid characteristics of Brevibacillus.

[0099] Table 1 Fatty acid data of strain LY15-1

[0100]

[0101]

[0102] The carbohydrate metabolism ability of the patented strain was tested by API 50CH, and the test results are shown in Table 2. Positive reactions included glycerol, ribose, galactose, glucose, fructose, arbutin, esculin and maltose; weak positive reactions included mannose, amygdalin, cellobiose, trehalose and galangal; negative reactions included control, erythrose, D-arabinose, L-arabinose, D-xylose, L-xylose, adonol, β-methyl-D-xylose, sorbose, rhamnose, dulcitol, inositol, mannitol, sorbitol, α-methyl-D-mannose, α-methyl-D-glucose Glycosides, N-acetyl-glucosamine, salvinol, lactose, melibiose, sucrose, inulin, melezitose, raffinose, starch, glycogen, xylitol, D-turanose, D-lyxose, D-tagatose, D-rockose, L-rockose, D-arabinitol, L-arabinitol, gluconate, 2-keto-gluconate and 5-keto-gluconate. The test results show that the patented strain meets the biochemical metabolic characteristics of Brevibacillus.

[0103] Table 2 API 50CH data of strain LY15-1

[0104]

[0105]

[0106] Note: +, positive; -, negative; w, weakly positive.

[0107] (3) Molecular biological characteristics

[0108] The 16S rRNA gene sequence was determined using bacterial 16S rRNA gene universal primers 27F and 1492R to obtain a 1386 bp gene fragment:

[0109] GGTTACCTCACCGACTTCGGGTGTTGCAAACTCCCGTGGTGTGACGGGCG

[0110] GTGTGTACAAGGCCCGGGAACGTATTCACCGCGGCATGCTGATCCGCGATT

[0111] ACTAGCGATTCCGACTTCATGTAGGCGAGTTGCAGCCTACAATCCGAACTG

[0112] AGATTGGTTTTAAGAGATTAGCATCTTCTCGCGAAGTAGCATCCCGTTGTAC

[0113] CAACCATTGTAGCACGTGTGTAGCCCAGGTCATAAGGGGCATGATGATTTG

[0114] ACGTCATCCCCGCCTTCCTCCGTCTTGTCGACGGCAGTCTCTCTAGAGTGC

[0115] CCAACTGAATGCTGGCAACTAAAGATAAGGGTTGCGCTCGTTGCGGGACTT

[0116] AACCCAACATCTCACGACACGAGCTGACGACAACCATGCACCACCTGTCA

[0117] CCACTGCCCCGAAGGGAAGCTCTATCTCTAGAGCGGTCAGTGGGATGTCAA

[0118] GACCTGGTAAGGTTCTTCGCGTTGCTTCGAATTAAACCACATGCTCCACCG

[0119] CTTGTGCGGGCCCCCGTCAATTCCTTTGAGTTTCACTCTTGCGAGCGTACTC

[0120] CCCAGGCGGAGTGCTTATTGCGTTAGCTGCGGCACTAAGGGTATTGAAACC

[0121] CCTAACACCTAGCACTCATCGTTTACGGCGTGGACTACCAGGGTATCTAATC

[0122] CTGTTTGCTCCCCACGCTTTCGCGCCTCAGTGTCAGTTACAGGCCAGAAAG

[0123] TCGCCTTCGCCACTGGTGTTCCTCCACATCTCTACGCATTTCACCGCTACAC

[0124] GTGGAATACCACTTTCCTCTCCTGCACTCAAGCTACACAGTTTCCAATGCG

[0125] AACCGAGGTTGAGCCTCGGGCTTTAACATCAGACTTACATAGCCACCTGCG

[0126] CGCGCTTTACGCCCAATAATTCCGGACAACGCTTGCCACCTACGTATTACCG

[0127] CGGCTGCTGGCACGTAGTTAGCCGTGGCTTTCTCGTTAGGTACCGTCAAGG

[0128] TGCTACCTTATTTAAATAGCACTGTTTCTTCCCTAACAACAGAACTTTACGA

[0129] CCCGAAAGCCTTCATCGTTCACGCGGCGTTGCTCCATCAGACTTTCGTCCA

[0130] TTGTGGAAAATTCCCTACTGCTGCCTCCCGTAGGAGTCTGGGCCGTGTCTC

[0131] AGTCCCAGTGTGGCCGGTCACCCTCTCAGGTCGGCTACGCATCGTCGCCTT

[0132] GGTGAGCCGTTACCTCACCAACTAGCTAATGCGCCGCAGGCCCATCTGTAA

[0133] GTGATAGCTTGCGCCATCTTTCCGTTTCGCTTCAGGCGAAGCAAAACCCTAT

[0134] CCGGTATTAGCATAAGTTTCCCTATGTTATCCCAGTCTCACAGGCAGGTTGC

[0135] CTACGTGTTACTCACCCGTCCGCCGCTAGGGTCCGAAGACCCTCGCTCGACTGC (SEQ ID NO: 1)

[0136] The 16S rRNA sequence of the patent strain was subjected to BLAST analysis in NCBI to construct a phylogenetic tree. Figure 3 The results showed that the patented strain was similar to Brevibacillus laterosporus DSM 25. T Clustered into the same branch with 100% support.

[0137] Based on comprehensive morphological characteristics, physiological and biochemical properties, and molecular biological identification and analysis, the patented strain was identified as Brevibacillus laterosporus.

[0138] Example 2 Determination of the IAA Synthesis Ability of LY15-1

[0139] Weigh indoleacetic acid (IAA) standard and prepare IAA standard solutions at concentrations of 10, 20, 40, 60, 80, and 100 mg / L with double-distilled water. Mix with Salkowski colorimetric solution at a volume ratio of 1:1. Leave at room temperature in the dark for 30 minutes, and then measure the OD of each concentration at 530 nm. Plot the OD value of each concentration on the x-axis and the concentration of the IAA standard solution on the y-axis to obtain the IAA standard curve (y = 167.49x - 7.5123). Figure 4 .

[0140] The preserved LY15-1 strain was inoculated with an inoculation loop and inoculated into LB liquid medium. The culture was shaken at 37°C and 200 rpm for 12 hours to prepare a seed solution. The seed solution was then inoculated into sterilized fermentation medium (7% soybean meal, 5% corn starch, 0.5% calcium carbonate, 1.5% glucose, 0.3% potassium dihydrogen phosphate, 0.3% dipotassium hydrogen phosphate, 0.2% magnesium sulfate, 0.03% manganese sulfate, 0.1% L-tryptophan, pH adjusted to 7.6) and incubated at 37°C and 200 rpm for 48 hours. The culture was centrifuged at 10,000 rpm for 10 minutes, and the supernatant was collected. 2 mL of the supernatant was mixed with equal volumes of 2 mL of Salkowski colorimetric solution (1 mL of 0.5 mol / L FeCl3·6H2O in 50 mL of 35% (v / v) HClO4). The mixture was incubated at room temperature in the dark for 30 minutes. The OD of the reaction solution was measured at 530 nm and was 0.598.

[0141] Substituting the OD value of 0.598 into the IAA standard curve, it can be seen that the LY15-1 strain can produce 92.65 mg / L of indoleacetic acid IAA after 48 hours of culture, and has excellent indoleacetic acid IAA synthesis ability and growth-promoting effect.

[0142] Example 3 Preparation of composite bacterial agent and verification of growth-promoting effect

[0143] This embodiment provides a composite bacterial agent, which is prepared by the following method:

[0144] The preserved LY15-1 strain was inoculated into a triangular flask (volume: 250mL) containing 100mL LB culture medium and a triangular flask (volume: 2000mL) containing 500mL LB culture medium, respectively. The culture temperature was 37°C, the rotation speed was 200rpm, and the culture was incubated in a shaking incubator for 12 hours. The above bacterial liquid was inoculated into a scaled-up fermentation tank (volume: 50L-500L), cultured at 37°C, and fermented step by step. The scaled-up fermentation medium formula was: soybean meal 7%, corn starch 5%, calcium carbonate 0.5%, glucose 1.5%, potassium dihydrogen phosphate 0.3%, potassium hydrogen phosphate 0.3%, magnesium sulfate 0.2%, manganese sulfate 0.03%, and the pH was adjusted to 7.6. The fermentation liquid was mixed with magnesium sulfate and spray-dried to obtain an effective viable count of 5.0×10 10 CFU / g of microbial agent of Brevibacillus laterosporus LY15-1.

[0145] According to the LY15-1 microbial agent preparation process, the corresponding culture medium and fermentation conditions were used to prepare Bacillus subtilis agents (deposit number CGMCC No. 19584, effective viable count of 1.0×10 11 CFU / g), Bacillus licheniformis agent (self-screened strain number LY9-1, effective viable count of 1.0×10 11 CFU / g), Bacillus Velezii agent (deposit number CGMCC No. 25831, effective viable count of 1.0×10 11 CFU / g), Bacillus amyloliquefaciens agent (preservation number CGMCC No. 25835, effective viable count of 1.0×10 11 CFU / g), the above Bacillus subtilis, Bacillus licheniformis, Bacillus Velez, and Bacillus amyloliquefaciens are all functional strains independently screened by the applicant. Two of these bacterial agents were selected and compounded with Brevibacillus laterosporus inoculum at a mass ratio of 1:1:1, and three groups were prepared (T1: LY15-1 + Bacillus subtilis + Bacillus licheniformis; T2: LY15-1 + Bacillus subtilis + Bacillus Velez; T3: LY15-1 + Bacillus subtilis + Bacillus amyloliquefaciens). At the same time, Brevibacillus laterosporus inoculum (with an effective viable count of 5.0×1010 CFU / g) was compounded with homemade Bacillus subtilis inoculum and Bacillus amyloliquefaciens inoculum at a mass ratio of 1:1:1 to form CK2.

[0146] The corn potting effect was verified with 7 kg of soil per pot and 2 corn plants. Each treatment group had 15 pots. After the corn seedlings emerged, 20 mL of 8.3 × 10 7 CFU / mL of the composite bacterial agent (the above composite bacterial agent, accurately weighed 1.0g, added to 1L of sterile water and mixed thoroughly) was used for root irrigation. The blank group CK1 was irrigated with normal water volume. The growth promotion results were tracked for 30 days. The results of corn growth promotion with the composite bacterial agent are shown in Table 3:

[0147] Table 3 Results of the test on corn growth promotion by composite microbial agents

[0148] Plant height / cm Stem diameter / mm Average fresh weight / g Root length / cm Root fresh weight / g CK1 34.88 7.04 9.08 24.38 2.97 CK2 35.23 7.16 9.87 26.22 3.18 T1 39.25 7.51 11.84 29.88 3.90 T2 40.16 7.55 12.07 30.63 3.28 T3 39.63 7.92 12.35 31.16 4.02

[0149] The results showed that the composite microbial agent had a significant growth-promoting effect on corn potted plants. Among them, T3 treatment had the best growth-promoting effect. Compared with CK1, plant height, stem diameter, average fresh weight, root length and root fresh weight increased by 13.62%, 12.50%, 36.01%, 27.81% and 35.35%, respectively. T2 had a slightly better effect than T1. Compared with CK1, plant height, stem diameter, average fresh weight, root length and root fresh weight increased by 15.14%, 7.24% and 32.9%, respectively. The results showed that the plant height, stem diameter, average fresh weight, root length, and root fresh weight of T1 increased by 12.53%, 6.68%, 30.40%, 22.56%, and 31.31%, respectively, compared with CK1. The effect of CK2 was significantly worse than that of T1, T2, and T3, with the plant height, stem diameter, average fresh weight, root length, and root fresh weight only increasing by 1.00%, 1.70%, 8.70%, 7.55%, and 7.07%, respectively, compared with CK1. It can be seen that the Brevibacillus laterosporus of the present invention has an excellent growth-promoting function.

[0150] Example 4 Preparation and Application of Microbial Fertilizer

[0151] In the coating section of organic fertilizer and compound fertilizer, the composite bacterial agents CK2, T1, T2 and T3 prepared in Example 3 were mixed evenly with the anti-caking powder, and then added to granular organic fertilizer (total nutrients ≥5%, organic matter ≥30%) and pure sulfur-based compound fertilizer 15-15-15 / S at a mass ratio of 3‰. The corresponding fertilizers obtained were microbial fertilizers with a theoretical viable bacterial count of 2.5×10 8 CFU / g, effective viable bacteria count ≥1.8×10 8 CFU / g.

[0152] The prepared microbial fertilizer was tested in the field and the experiment was carried out in Linyi City, Shandong Province. A total of 7 treatment groups were set up, including control groups CK1-3 and experimental groups T1-T6, each group treated 3 areas, each area was 40m 2 Fertilizer application rates were 50 kg / mu of compound fertilizer or 30 kg of compound fertilizer plus 20 kg / mu of organic fertilizer. Control group CK1 received a pure sulfur-based compound fertilizer (15-15-15 / S) with no added microbial agents. Corn yield was measured after 120 days of growth. Specific treatments and results are shown in Table 4.

[0153] Table 4 Experimental results of each treatment of microbial fertilizer

[0154]

[0155] The results show that the per-acre yield of corn to which the organic fertilizer and compound fertilizer containing the T1, T2 and T3 bacterial agents in Example 3 are added is significantly better than that to which the organic fertilizer and compound fertilizer containing the control CK1 and the CK2 bacterial agent in Example 3 are added, indicating that the organic fertilizer and compound fertilizer containing the Brevibacillus laterosporus of the present invention achieve excellent growth-promoting effects under the growth-promoting effect of Bacillus laterosporus of the present invention.

[0156] Example 5 LY15-1 composite bacterial agent for the prevention and control of root rot

[0157] The disease resistance of corn potted plants was verified using the retained soil from the area where corn root rot occurred. Each pot contained 7 kg of soil and 2 corn plants, with 15 pots set for each treatment. When transplanting corn, the control group CK1 was fertilized and watered normally; the control group CK2 was treated with the CK2 composite microbial agent in Example 3 (Bacillus laterosporus + Bacillus subtilis + Bacillus amyloliquefaciens), and 20 mL of a concentration of 8.3 × 10 7 CFU / mL of compound fungal agent was used for root irrigation. One week after transplanting, 20 mL of 8.3×10 7 CFU / mL of the composite bacterial agent for secondary flushing; experimental group T1 was the T3 composite bacterial agent in Example 3 (LY15-1 + Bacillus subtilis + Bacillus amyloliquefaciens), and 20mL of the composite bacterial agent with a concentration of 8.3×10 7 CFU / mL of compound fungal agent was used for root irrigation; on the basis of T1, experimental group T2 was treated with 20mL of 8.3×10 7 CFU / mL of the composite microbial agent was applied twice, and the number of healthy plants, the number of susceptible (non-dead) plants, and the number of dead plants in each treatment were counted after 60 days, and the mortality rate, morbidity rate, relative control effect, etc. were calculated; the results are shown in Table 5:

[0158] Table 5. Incidence of root rot in potted corn plants using LY15-1 compound microbial agent

[0159] serial number Number of healthy plants Number of susceptible strains Number of dead plants Case fatality rate Incidence Relative prevention effect CK1 6 8 16 53.3％ 80.0％ / CK2 7 9 14 46.6％ 76.6％ 4.25％ T1 14 8 8 26.7％ 53.3％ 33.38％ T2 22 5 3 10.0％ 26.7％ 66.63％

[0160] Note: Mortality rate (%) = number of dead plants / total number of plants × 100%

[0161] Incidence rate (%) = (number of susceptible plants + number of dead plants) / total number of plants × 100%

[0162] Relative control efficacy (%) = (control incidence - treatment incidence) / control incidence × 100%

[0163] Results showed that the CK1 corn plant disease incidence reached 80.0% and the plant mortality rate was as high as 53.3%. The CK2 corn plant disease incidence reached 76.6% and the plant mortality rate reached 46.6%. The T1 treatment had a plant disease incidence of 53.3% and a plant mortality rate of 26.7%. The T2 treatment had a plant disease incidence of only 26.7% and a plant mortality rate of 10.0%. Both the T1 and T2 treatments reduced the incidence and plant mortality of corn root rot, with relative control effects of 33.38% and 66.63% respectively. The CK2 corn root rot incidence and plant mortality rate were slightly reduced, with a relative control effect of only 4.25%. This indicates that Brevibacillus laterosporus LY15-1 has a significant control effect on corn root rot.

[0164] In the description of this specification, the reference terms "one embodiment", "some embodiments", "example", "specific example", or "implementation method" mean that the specific features, structures, materials or characteristics described in conjunction with the embodiment or example are included in at least one embodiment or example of the present invention. In this specification, the schematic representations of the above terms do not necessarily refer to the same embodiment or example. Moreover, the specific features, structures, materials or characteristics described can be combined in any one or more embodiments or examples in a suitable manner. In addition, those skilled in the art can combine and combine different embodiments or examples described in this specification and features of different embodiments or examples without contradiction.

[0165] Although the embodiments of the present invention have been shown and described above, it will be understood that the above embodiments are illustrative and are not to be construed as limitations on the present invention. A person skilled in the art may change, modify, replace and modify the above embodiments within the scope of the present invention.

Claims

1. A Brevibacillus laterosporus, deposited in the General Microbiology Center of the China Culture Collection Administration on February 8, 2025, with the deposit number CGMCC No. 33504.

2. A microbial agent, characterized in that: The microbial agent includes the Brevibacillus laterosporus according to claim 1.

3. The microbial agent according to claim 2, characterized in that The effective viable bacteria count of the Brevibacillus laterosporus in the microbial agent is at least 5.0×10 10 CFU / g.

4. The microbial agent according to claim 3, characterized in that The microbial agent is in dry powder form.

5. A composite bacterial agent, characterized in that: The method comprises the microbial agent according to any one of claims 2 to 4.

6. The composite bacterial agent according to claim 5, characterized in that The composite microbial agent comprises a first microbial agent and a second microbial agent, wherein the first microbial agent is the microbial agent according to any one of claims 2 to 4, and the second microbial agent comprises at least one selected from the group consisting of Bacillus subtilis, Bacillus licheniformis, Bacillus velez, and Bacillus amyloliquefaciens.

7. The composite bacterial agent according to claim 6, characterized in that The composite microbial agent comprises 20 to 50 parts by weight of the first microbial agent and 20 to 50 parts by weight of the second microbial agent; wherein the second microbial agent is selected from at least one of the following: 20-50 parts by weight of Bacillus subtilis; 20-50 parts by weight of Bacillus licheniformis; 20-50 parts by weight of Bacillus Velez; 20 to 50 parts by weight of Bacillus amyloliquefaciens.

8. The composite bacterial agent according to any one of claims 6 or 7, characterized in that The effective viable bacteria count of Brevibacillus laterosporus in the composite bacterial agent is at least 5.0×10 10 CFU / g, and at least one of the following conditions is met: The effective viable cell count of Bacillus subtilis is at least 1.0×10 11 CFU / g; The effective viable count of Bacillus licheniformis is at least 1.0×10 11 CFU / g; The effective viable count of Bacillus velezensis is at least 1.0×10 11 CFU / g; The effective viable count of Bacillus amyloliquefaciens is at least 1.0×10 11 CFU / g.

9. A microbial fertilizer, characterized in that: The microbial fertilizer comprises the Brevibacillus laterosporus according to claim 1, the microbial agent according to any one of claims 2 to 4, or the composite microbial agent according to any one of claims 5 to 8.

10. The microbial fertilizer according to claim 9, characterized in that The microbial fertilizer is a solid fertilizer, and the number of effective living microorganisms contained in the microbial fertilizer is at least 1.8×10 8 CFU / g; Alternatively, the microbial fertilizer is a liquid fertilizer, and the number of effective living microorganisms contained in the microbial fertilizer is at least 1.8×10 8 CFU / mL.

11. The microbial fertilizer according to claim 10, characterized in that The microbial fertilizer further includes a basic fertilizer, and the basic fertilizer includes at least one selected from compound fertilizer, organic fertilizer, and organic-inorganic fertilizer.

12. A method for fertilizing crops, characterized in that: include: At least one of Brevibacillus laterosporus, a microbial agent, a composite agent, and a microbial fertilizer is applied to the crop, wherein the Brevibacillus laterosporus is the Brevibacillus laterosporus according to claim 1, the microbial agent is the microbial agent according to any one of claims 2 to 4, the composite agent is the composite agent according to any one of claims 5 to 8, and the microbial fertilizer is the microbial fertilizer according to any one of claims 9 to 11.

13. The crop fertilization method according to claim 12, characterized in that: The crop is selected from at least one of strawberry, tomato, corn and potato.

14. A method for promoting crop seedling growth or preventing and controlling crop root rot, characterized in that: include: At least one of Brevibacillus laterosporus, a microbial agent, a composite agent, and a microbial fertilizer is applied to the crop, wherein the Brevibacillus laterosporus is the Brevibacillus laterosporus according to claim 1, the microbial agent is the microbial agent according to any one of claims 2 to 4, the composite agent is the composite agent according to any one of claims 5 to 8, and the microbial fertilizer is the microbial fertilizer according to any one of claims 9 to 11.

15. The method for promoting crop seedling growth or preventing and controlling crop root rot according to claim 14, characterized in that: The crop is selected from at least one of strawberry, tomato, corn and potato.

Images