Method for producing L-threonine through specific binding and immobilized fermentation of recombinant escherichia coli with surface display adhesin protein and modified material

Abstract

The invention relates to the field of production of L-threonine through microbial fermentation, in particular to a method for producing L-threonine through specific binding and immobilized fermentation of recombinant escherichia coli with adhesion protein displayed on the surface and a modified material. Escherichia coli delta ycgF is taken as a starting strain, and the fimbrin protein FimH is anchored by anchoring protein, so that the recombinant escherichia coli with the fimbrin protein displayed on the surface is constructed, and the formation of a biological membrane of the recombinant strain is promoted. When the recombinant escherichia coli is utilized to produce L-threonine through immobilized fermentation, a fiber material carrier is subjected to mannose saccharide substance modification, so that specific adsorption between the escherichia coli and the carrier is realized, combination between thalli and the carrier is promoted, and L-threonine production through escherichia coli fermentation is promoted. Meanwhile, the fermentation period is shortened, so that the cells have higher metabolic activity, the cells can be recycled, the cost is saved, and a more suitable fermentation method is provided for industrial fermentation production of L-threonine.

Description

Technical Field

[0001] The present invention relates to the field of L-threonine production by microbial fermentation, and in particular to a method for producing L-threonine by utilizing recombinant Escherichia coli displaying adhesin protein on its surface to specifically bind to a modified material for immobilized fermentation. Background Art

[0002] L-threonine is an essential amino acid that the human body cannot synthesize on its own and must be consumed through the diet. It is primarily involved in protein synthesis, maintaining muscle and tissue health, and supporting immune system function (such as antibody production). It also helps form a mucus barrier in the intestine to protect the digestive system, promotes fat metabolism and detoxification in the liver, and serves as a neurotransmitter precursor, indirectly supporting brain function. L-threonine plays a crucial role in health management and production practices, with significant applications across multiple sectors. It is used in pharmaceuticals and nutritional supplements to improve protein synthesis, repair tissue, enhance immunity, and maintain intestinal health. In the livestock industry, it is a key additive to animal feed, promoting growth, boosting immunity, and improving meat quality. Furthermore, in the food industry, it is fortified into specific functional foods (such as protein powders or special diets) to meet the body's essential amino acid needs. Currently, with its widespread application in the food, chemical, and pharmaceutical industries, demand for L-threonine is rapidly increasing.

[0003] During biofilm immobilization fermentation, cells communicate with each other, coordinate gene expression, and achieve physiological synergy, thereby enhancing bacterial metabolic activity. This not only increases substrate and product tolerance, but also ensures cell viability, shortens the fermentation cycle, and improves product quality. Therefore, biofilm immobilization technology has broad prospects for industrial application. Fimbriae are the cellular motility organs of Gram-negative bacteria. Escherichia coli has numerous types of fimbriae, of which type I fimbriae are important adhesion organelles and include nine genes, including fimA to fimH. The fimH gene encodes the adhesin protein FimH of type I fimbriae, which is responsible for adhesion to abiotic surfaces and is a key gene for E. coli biofilm formation.

[0004] Currently, the production of L-threonine using microbial fermentation has been widely used in the industrial production of L-threonine. However, there is still a problem with L-threonine cells that cannot be reused after a single batch of free fermentation. Batch fermentation and disposable cells increase operating costs and reduce productivity. At the same time, the free cells dispersed in the fermentation medium are challenged by stress conditions (such as shear force) during aerobic fermentation, resulting in reduced cell viability during the fermentation process. Therefore, the development of an industrialized method for producing L-threonine that can increase L-threonine production while shortening the fermentation cycle, making cells more metabolically active, and achieving cell recycling and cost savings has great practical significance. Summary of the Invention

[0005] The technical problem to be solved by the present invention is to provide a recombinant Escherichia coli in view of the deficiencies of the existing technology.

[0006] The technical problem that the present invention also aims to solve is to provide the use of the recombinant Escherichia coli in the production of L-threonine by immobilized fermentation.

[0007] The final technical problem to be solved by the present invention is to provide a method for producing L-threonine by immobilizing and fermenting recombinant Escherichia coli specifically combined with a modified material.

[0008] In order to solve the above technical problems, the present invention provides the following technical solutions:

[0009] A recombinant Escherichia coli is constructed by using Escherichia coli ΔycgF as a starting strain and using an anchoring protein to anchor an adhesin protein FimH to obtain a recombinant Escherichia coli with surface-displaying adhesin protein.

[0010] The Escherichia coli ΔycgF, also known as Escherichia coli W1688-bluF, has detailed information disclosed in patent CN114317389A.

[0011] Wherein, the anchoring protein includes any one of LPP-OmpA, Ag43, and eCPX.

[0012] Preferably, the anchoring protein includes any one of LPP-OmpA and eCPX; more preferably, the anchoring protein is LPP-OmpA.

[0013] Among them, the adhesin protein FimH has a nucleotide sequence as shown in SEQ ID NO:4; the anchoring protein Lpp-OmpA has a nucleotide sequence as shown in SEQ ID NO:1; the anchoring protein Ag43 has a nucleotide sequence as shown in SEQ ID NO:2; and the anchoring protein eCPX has a nucleotide sequence as shown in SEQ ID NO:3.

[0014] The anchoring protein anchors the adhesin protein FimH to form a fusion protein, and the expression of the fusion protein is driven by a promoter.

[0015] Specifically, the promoter is a nucleotide sequence such as any one of SEQ ID NOs: 5 to 9.

[0016] In some embodiments of the present invention, the promoters whose nucleotide sequences are shown in SEQ ID NOs: 5 to 9 are promoter 100, promoter 101, promoter 105, promoter 106, and promoter 119, respectively.

[0017] Preferably, the promoter is promoter 101, promoter 105, promoter 106, or promoter 119; more preferably, the promoter is promoter 106 (ie, the nucleotide sequence is shown in SEQ ID NO: 8).

[0018] Preferably, the fusion protein is LPP-OmpA-fimH, and its nucleotide sequence is shown in SEQ ID NO:10.

[0019] The use of the recombinant Escherichia coli in the production of L-threonine by immobilized fermentation is also within the scope of protection of the present invention.

[0020] A method for producing L-threonine by immobilizing and fermenting recombinant Escherichia coli specifically combined with a modified material is also within the scope of protection of the present invention.

[0021] Specifically, the modified fiber material is used as a carrier, and the recombinant Escherichia coli is immobilized and fermented to produce L-threonine.

[0022] The fiber material includes any one or a combination of cotton fiber, linen, nylon, polyester, polypropylene fiber, and polyethylene fiber.

[0023] Preferably, the fiber material is cotton fiber.

[0024] Wherein, the modified fiber material is obtained by placing the fiber material in a modification solution for reaction.

[0025] Specifically, the solute of the modified solution is any one or a combination of polyethyleneimine, dopamine and mannose, and the solvent is water.

[0026] Specifically, the mass ratio of dopamine:polyethyleneimine:mannose is 0-1:0-2:0-40, and the three are not all 0. The specific value of 0-1 is 0 or 1; the specific value of 0-2 is: 0, 0.5, 1, 1.5 or 2; the specific value of 0-40 is: 0, 2, 4, 6, 8, 10, 20, 30 or 40.

[0027] Preferably, in the No. 1 and No. 5 triangular flasks, the mass ratio of dopamine, polyethyleneimine, and mannose is 1:0.5-2:2-40, and the order of adding the solvents is different.

[0028] Specifically, in the No. 1 triangular flask, polyethyleneimine was added first, then mannose was added, and finally dopamine was added; in the No. 5 triangular flask, dopamine, polyethyleneimine, and mannose were added simultaneously.

[0029] In some embodiments of the present invention, the mass ratio of dopamine, polyethyleneimine, and mannose in the No. 1 and No. 5 Erlenmeyer flasks is 1:1:10.

[0030] Preferably, in the No. 2 conical flask, the mass ratio of dopamine, polyethyleneimine, and mannose is 0:1:2-20.

[0031] In some embodiments of the present invention, in the No. 2 Erlenmeyer flask, the mass ratio of dopamine, polyethyleneimine, and mannose is 0:1:10.

[0032] Preferably, in the No. 3 conical flask, the mass ratio of dopamine, polyethyleneimine and mannose is 1:0.5 to 2:0.

[0033] In some embodiments of the present invention, in the No. 3 Erlenmeyer flask, the mass ratio of dopamine, polyethyleneimine, and mannose is 1:1:0.

[0034] Preferably, the mass ratio of dopamine, polyethyleneimine and mannose in the No. 4 conical flask is 1:0:2-40.

[0035] In some embodiments of the present invention, the mass ratio of dopamine, polyethyleneimine, and mannose in the No. 4 conical flask is 1:0:10.

[0036] Wherein, the fiber material is added in an amount of 10 to 40 g / L, and preferably in an amount of 20 to 30 g / L.

[0037] The reaction conditions are as follows: reaction time of 0.5 to 30 h, reaction temperature of 20 to 80° C., rotation speed of 80 to 200 rpm, and reaction pH of 3.5 to 10.5.

[0038] Wherein, the inoculation amount of the seed liquid of the recombinant Escherichia coli is 2-8% v / v.

[0039] In some embodiments of the present invention, the inoculation amount of the seed solution is 4% v / v.

[0040] The immobilized fermentation medium comprises: 20-40 g / L glucose, 1-3 g / L yeast powder, 0.5-2 g / L KH2PO4, 20-30 g / L (NH4)2SO4, 0.5-1 g / L MgSO4·7H2O, 0.01-0.05 g / LMnSO4·5H2O, 0.01-0.04 g / L FeSO4·7H2O, 0.001-0.003 g / L vitamin B1, and 10-30 g / L CaCO3.

[0041] Specifically, the glucose concentration can be the following specific values: 20 g / L, 25 g / L, 30 g / L, 35 g / L or 40 g / L.

[0042] Specifically, the yeast powder concentration can be the following specific values: 1 g / L, 1.5 g / L, 2 g / L, 2.5 g / L or 3 g / L.

[0043] Specifically, the KH2PO4 concentration can be the following specific values: 0.5 g / L, 1 g / L, 1.5 g / L or 2 g / L.

[0044] Specifically, the (NH4)2SO4 concentration can take the following specific values: 20g / L, 22g / L, 24g / L, 26g / L, 28g / L or 30g / L.

[0045] Specifically, the concentration of MgSO4·7H2O can be the following specific values: 0.5 g / L, 0.6 g / L, 0.7 g / L, 0.8 g / L, 0.9 g / L or 1.0 g / L.

[0046] Specifically, the concentration of MnSO4.5H2O can be the following specific values: 0.01 g / L, 0.02 g / L, 0.03 g / L, 0.04 g / L or 0.05 g / L.

[0047] Specifically, the FeSO4·7H2O concentration can take the following specific values: 0.01 g / L, 0.02 g / L, 0.03 g / L or 0.04 g / L.

[0048] Specifically, the vitamin B1 concentration can be the following specific values: 0.001 g / L, 0.002 g / L or 0.003 g / L.

[0049] Specifically, the CaCO3 concentration can take the following specific values: 10g / L, 15g / L, 20g / L, 25g / L or 30g / L.

[0050] In some embodiments of the present invention, the fermentation medium of the immobilized fermentation is: 30g / L glucose, 2g / L yeast powder, 1g / L KH2PO4, 22g / L (NH4)2SO4, 0.8g / L MgSO4·7H2O, 0.02g / L MnSO4·5H2O, 0.02g / LFeSO4·7H2O, 0.002g / L vitamin B1, and 30g / L CaCO3.

[0051] The immobilized fermentation conditions are as follows: constant temperature fermentation at 30-44°C and 150-250rpm; when the glucose content in the fermentation broth is lower than 1g / L, the first batch of fermentation is terminated, 60%-90% of the fermentation broth is discharged, and an equal volume of fermentation medium is added before the second batch of fermentation is carried out; the immobilized fermentation process of discharging 60%-90% of the fermentation broth and adding an equal volume of fermentation medium is repeated for 5-8 batches.

[0052] In some embodiments of the present invention, the immobilized fermentation is carried out continuously for 7 batches.

[0053] Beneficial effects:

[0054] (1) Based on the ΔycgF strain, the present invention uses anchoring protein to anchor the adhesin protein FimH to construct a recombinant Escherichia coli that displays the fimH gene on the surface, which promotes the biofilm formation of the recombinant strain; further, by modifying the modified fiber material carrier with mannose substances, specific adsorption between Escherichia coli and the carrier is achieved, which promotes the binding between the bacteria and the material and promotes the fermentation of L-threonine by Escherichia coli.

[0055] (2) The present invention is the first to combine surface display with material modification systems and apply them to the production of amino acids based on biofilm immobilized fermentation, shortening the fermentation cycle, making cells more metabolically active, and achieving cell recycling while saving costs, providing a more suitable fermentation method for industrial fermentation of L-threonine. BRIEF DESCRIPTION OF THE DRAWINGS

[0056] The present invention will be further described in detail below with reference to the accompanying drawings, and the above and / or other advantages of the present invention will become more apparent.

[0057] Figure 1 This is the plasmid map of the recombinant plasmid ptrc99a-LPP-OmpA-fimH.

[0058] Figure 2 This is the electrophoresis diagram of the extracted plasmid pTrc99a. Lane 1 is the pTrc99a plasmid, which is 4176 bp. Lane 2 is the pTrc99a plasmid after enzyme digestion, and lane 3 is the 10000 DNA marker.

[0059] Figure 3 This is the electrophoresis diagram of the recombinant plasmid ptrc99a-LPP-OmpA-fimH. Lane 1 is the recombinant plasmid ptrc99a-LPP-OmpA-fimH, which is 5477 bp, and lane 2 is the 10000 DNA marker.

[0060] Figure 4 The electrophoresis diagram of colony PCR verification is shown in Figure 1. Lane 1 is the 2000DNA marker, lane 2 is the colony PCR band verification of ptrc99a-LPP-OmpA-fimH, and lane 3 is the blank control of the original strain colony PCR.

[0061] Figure 5The growth curves and SDS-PAGE images of each modified strain are shown below. A shows the growth curve of the strain; B shows the SDS-PAGE image. The markers used in the three images from left to right are Low Marker, Low Marker, and High Marker, respectively.

[0062] Figure 6 Flow cytometry was used to detect whether fimH in each transformed strain was successfully displayed on the cell surface and the display efficiency.

[0063] Figure 7 This is the result of the crystal violet staining experiment to investigate the biofilm formation ability.

[0064] Figure 8 Figure 2 shows fiber materials after different glycosylation modifications.

[0065] Figure 9 FTIR spectra of unmodified cotton fiber carrier and modified cotton fiber carrier.

[0066] Figure 10 The images were observed using a confocal laser scanning microscope (CLSM).

[0067] Figure 11 The top graph shows the trend of various parameters during immobilized continuous fermentation of the ΔycgF strain using unmodified cotton fiber supports; the bottom graph shows the trend of various parameters during immobilized continuous fermentation of the ΔycgF+LPP-OmpA-fimH strain using modified and modified cotton fiber supports.

[0068] Figure 12 The scanning electron microscope (SEM) image of the carrier.

[0069] Figure 13 The OD of the supernatant was measured after elution with different buffers. DETAILED DESCRIPTION

[0070] The present invention will be further described below in conjunction with specific embodiments, and the above and / or other advantages of the present invention will become more apparent.

[0071] The experimental methods described in the following examples are conventional methods unless otherwise specified; the reagents and materials are commercially available unless otherwise specified.

[0072] In the following examples, the Escherichia coli ΔycgF strain, also known as the W1688-bluF strain, has detailed information disclosed in patent CN114317389A.

[0073] This patent was approved by the 2025 Jiangsu Province Graduate Practice Innovation Program, project number SJCX25_0583.

[0074] Example 1: Molecular modification of target strains

[0075] Promoters with laboratory numbers 100, 101, 105, 106, and 119 were selected for screening, and LPP-OmpA / Ag43 / eCPX was selected for anchoring protein screening to construct modified strains of different anchoring adhesin proteins FimH.

[0076] Among them, the nucleotide sequence of the Lpp-OmpA is shown in SEQ ID NO: 1, the nucleotide sequence of the Ag43 is shown in SEQ ID NO: 2, the nucleotide sequence of the eCPX is shown in SEQ ID NO: 3, the nucleotide sequence of the fimH gene of the adhesin protein FimH is shown in SEQ ID NO: 4, and the nucleotide sequences of the promoters 100, 101, 105, 106, and 119 are shown in SEQ ID NOs: 5 to 9, respectively.

[0077] Take the modified strain ΔycgF+LPP-OmpA-fimH (also known as +p106-LPP) as an example.

[0078] 1. Synthesize the target gene

[0079] The LPP-OmpA, which is a mosaic of lipoprotein Lpp and outer membrane protein OmpA, was used as an anchor protein to anchor the adhesin protein fimH of type I fimbriae to prepare the fragment LPP-OmpA-fimH containing promoter 106. The connection method is as follows Figure 1 The above fragment LPP-OmpA-fimH was commissioned to be synthesized by Nanjing GenScript Biotechnology Co., Ltd., and its nucleotide sequence is shown in SEQ ID NO: 10.

[0080] 2. Construction of recombinant plasmid

[0081] 2.1 Plasmid extraction

[0082] E. coli DH5α glycerol bacteria (containing plasmid ptrc99a) were inoculated into liquid LB containing 50 μg / mL ampicillin resistance and cultured at 37°C for 12 hours. The cultured cells were collected in a 1.5 mL centrifuge tube and centrifuged at 10,000 rpm for 2 minutes. The supernatant was removed. Then, the plasmid ptrc99a ( Figure 2 ).

[0083] 2.2 Vector linearization

[0084] To ligate LPP-OmpA-fimH to the pTrc99a plasmid, the plasmid vector was enzymatically digested using the following digestion system (20 μL): 2 μL 0.1% BSA, 2 μL 1×M buffer, 1 μL NcoI, 1 μL HindIII, 10 μL pTrc99a, and 4 μL sterile water. The digestion reaction was incubated at 37°C for 2 h. After digestion, the linearized pTrc99a vector was recovered from the gel and used for subsequent experiments.

[0085] 2.3 Construction of recombinant plasmid ptrc99a-LPP-OmpA-fimH

[0086] The LPP-OmpA-fimH fragment synthesized in step 1 was combined with the purified linear vector ptrc99a according to the method of Vazyme II one-step cloning kit instructions to obtain the recombinant plasmid ptrc99a-LPP-OmpA-fimH. The plasmid map of the recombinant plasmid ptrc99a-LPP-OmpA-fimH is shown in Figure 1 shown.

[0087] The one-step cloning reaction system is shown in Table 1. After incubating in a water bath at 37°C for 30 minutes, the reaction was immediately ice-bathed for 5 minutes and stored at -20°C.

[0088] Table 1 One-step cloning reaction system

[0089]

[0090] 3. Transformation and screening of recombinant plasmids

[0091] Thaw competent E. coli DH5α cells on ice until liquid. Add competent cells and plasmid at a ratio of 10:1 to a pre-chilled centrifuge tube. Place on ice for 30 minutes, then heat shock in a 42°C water bath for 90 seconds. Chill in an ice box for 3 minutes, add 1 mL of LB, and incubate on a shaker at 37°C, 200 rpm, for 1 hour. Centrifuge, remove most of the supernatant, resuspend the culture, and plate on ampicillin-resistant plates.

[0092] Pick a single spot on the plate, place it in a shake tube (50 μg / mL ampicillin), culture it in a 37°C incubator overnight, and then extract the recombinant plasmid ptrc99a-LPP-OmpA-fimH. Design the sequencing primers shown in Table 2. Figure 3 It can be seen that the recombinant plasmid ptrc99a-LPP-OmpA-fimH was successfully constructed.

[0093] Table 2 Experimental primer sequences used for sequencing

[0094] Primer name Primer sequences LPP-F gactgcacggtgcaccaatg LPP-R cggcggatttgtcctactca

[0095] After successful sequencing verification, the constructed plasmid was transformed into E. coli ΔycgF competent cells using the same transformation method. Single colonies were picked for colony PCR verification, using the same primers as in Table 2. Figure 4 It can be seen that the bands of colony PCR are correct and the transformed strain is successfully constructed, that is, the transformed strain ΔycgF+LPP-OmpA-fimH (also known as +p106-LPP) is constructed.

[0096] Referring to the construction method of the target strain ΔycgF+LPP-OmpA-fimH (also known as +p106-LPP), different promoters and anchor proteins were replaced to construct different E. coli modified strains: +p100-LPP, +p101-LPP, +p105-LPP, +p100-eCPX, +p101-eCPX, +p105-eCPX, +p106-eCPX, +p119-eCPX, +p100-Ag43, +p101-Ag43, +p105-Ag43, +p106-Ag43, +p119-Ag43. Among them, LPP-OmpA is located at the N-terminus of fimH, and eCPX and Ag43 are located at the C-terminus of fimH.

[0097] Example 2: Characterization of the adhesin protein fimH of type I fimbriae

[0098] 1. Growth curve

[0099] Fifteen modified E. coli strains, including ΔycgF, +p100-LPP, +p101-LPP, +p105-LPP, +p106-LPP, +p100-eCPX, +p101-eCPX, +p105-eCPX, +p106-eCPX, +p119-eCPX, +p100-Ag43, +p101-Ag43, +p105-Ag43, +p106-Ag43, and +p119-Ag43, were cultured overnight in liquid LB medium. For all modified strains except the ΔycgF strain, 100 mg / mL Amp was added to the medium. The OD values of each overnight culture were calculated. 600 After diluting to 1, inoculate into fresh LB medium, culture at 37℃, 200rpm for 14h, and measure OD every 2h. 600 .

[0100] The results are as follows Figure 5 As shown in A, the growth trend of the modified strain is basically the same as that of WT (ΔycgF). The strain modification did not change the growth condition of the strain, but the growth state of the strain based on ΔycgF + p100-LPP changed significantly.

[0101] 2. SDS-PAGE

[0102] The cultured cells of different modified E. coli strains were centrifuged at 4°C, 8000 rpm for 10 minutes to obtain a cell pellet. The cell pellet was resuspended in 5 mL of PBS and centrifuged at 4°C, 8000 rpm for 10 minutes. The supernatant was discarded to obtain a cell pellet. The cell pellet was resuspended in 5 mL of PBS and then disrupted with a cell disruptor at 30% power, 3 seconds on, 7 seconds off, for 10 minutes. The cells were kept in an ice-water bath throughout the disruption process to prevent protease denaturation and inactivation. After disruption, the suspension was centrifuged at 4°C, 12000 rpm for 10 minutes, and the pellet was collected as a sample.

[0103] The preparation process of SDS-PAGE denaturing acrylamide gel is as follows: SDS-PAGE denaturing acrylamide gel is prepared using a Sangon kit (Cat. No. C631100). According to the protein size of the present invention, a 6% to 10% separation gel is selected. The separation gel components are shown in Table 3. The prepared separation gel is added to the fixed glass plates and waited for it to solidify. After the separation gel solidifies, the concentrated gel is prepared according to the components in Table 4. The prepared concentrated gel is added to the fixed glass plates containing the separation gel, and a comb is inserted and waited for it to solidify. The running buffer is prepared by Sangon (Cat. No. C520001-0500) 10× Tris-Glycine SDS PAGE Running Buffer.

[0104] Table 3 Separation gel components (mL)

[0105] A piece of 6% separating gel A piece of 10% separating gel Distilled Water 2.7 2.0 30% Acr-Bis (29:1) 1.0 1.7 Gel buffer A 1.25 1.25 10% APS 0.05 0.05 TEMED 0.005 0.003

[0106] Table 4 Concentrated gel components (mL)

[0107] 2 stacking gels Distilled Water 0.67 30% Acr-Bis (29:1) 0.33 Gel buffer B 1.0 10% APS 0.02 TEMED 0.002

[0108] The relative protein concentration was determined by SDS-PAGE denaturing acrylamide gel electrophoresis. The specific steps were as follows: 9 μL of sample was mixed with 3 μL of 4× loading buffer, placed in a 95°C water bath for 10 min, 10 μL was added to the gel wells, and 10 μL of the same marker was also added. Premixed Protein Marker (Broad or Low) (Takara Code No. 3597A and No. 3595A, concentration 0.5 μg / μL) was selected, 150 V voltage, and electrophoresis time was 50 min. After electrophoresis, the gel was removed and placed in a glass dish containing 1% Coomassie Brilliant Blue dye (formula: Coomassie Brilliant Blue R-250 1 g, ethanol 450 mL, glacial acetic acid 100 mL, dissolved in ultrapure water and fixed to 1 L) for staining for 2 h at 60 rpm / min. After staining, the eluent (formula: ethanol 100 mL, glacial acetic acid 100 mL, ultrapure water 800 mL) was replaced and eluted three times until the gel background was transparent without blue. The gel was then placed in a gel imager and photographed.

[0109] turn out( Figure 5 B) A series of strains with LPP-OmpA and eCPX as anchor proteins (+p100-LPP, +p101-LPP, +p105-LPP, +p106-LPP, +p100-eCPX, +p101-eCPX, +p105-eCPX, +p106-eCPX, +p119-eCPX) can express the fusion protein on the cell wall, while Ag43 cannot successfully express the fusion protein.

[0110] 3. Flow cytometer

[0111] In order to verify whether fimH is successfully displayed on the surface of E. coli cells and the display efficiency, this example further performed flow cytometric analysis to observe the display efficiency of the strain. The specific process is as follows: 1 mL of bacterial solution was taken from the cultured cells and centrifuged to collect the bacteria. The bacteria were washed 3 times with PBS (pH = 7.4) and then suspended with PBS containing 2% BSA (pH = 7.4). Then, 200 to 1000 μL of cell suspension was added with 200 μL of HIS-tagged mouse monoclonal antibody (His Tag Mouse Monoclonal Antibody 1:100 dilution), and incubated at 37°C for 30 minutes to 2 hours, and the bacteria were washed with PBS. The sample was detected on a flow cytometer, the excitation wavelength of FITC was 488 nm, and the distribution of the fluorescence signal was recorded.

[0112] from Figure 6As can be seen, the modified strains +p100-LPP and +p106-LPP showed the highest display efficiencies, at 71.22% and 60.68%, respectively. However, the +p100-LPP strain had growth issues in the growth curve experiment, so the subsequent experimental strain was determined to be +p106-LPP, namely ΔycgF+LPP-OmpA-fimH.

[0113] 4. Crystal violet staining

[0114] In order to verify the biofilm formation ability of strain ΔycgF and modified strain + p106-LPP, this example further conducted a crystal violet staining experiment. The specific process is as follows: 200 μL of OD were added to each well of a 24-well plate. 600 = 1 strain suspension and 1800 μL of LB liquid medium were incubated at 37°C for 30 hours. The medium was then removed and free cells were washed with PBS buffer. After fixation with 4% paraformaldehyde for 15 minutes, the paraformaldehyde was removed and the biofilm was stained with 1% crystal violet dye. After washing and drying, the biofilm was dissolved with glacial acetic acid. Finally, the absorbance at 570 nm was read using a microplate reader.

[0115] The results are as follows Figure 7 As shown in the figure, it can be seen that the OD of +p106-LPP 570 It is higher than ΔycgF, indicating a stronger biofilm-forming ability.

[0116] Example 3: Preparation of Mannose-Modified Modified Carrier

[0117] The fiber material (cotton fiber, flax, nylon, polyester, polypropylene fiber or polyethylene fiber) is placed in any one or more reagents containing polyethyleneimine, dopamine, and mannose (α-methyl-D-mannose, D-mannose) to obtain a mannose-modified modified fiber material.

[0118] Taking cotton fiber (CF) as an example, the cotton fiber material was added at an addition amount of 20g / L to 1000mL of a modified solution composed of different dopamine, polyethyleneimine and mannose (α-methyl-D-mannoside), with water as the solvent. The reaction time was 0.5-30h, the reaction temperature was 20-80℃, the rotation speed was 80-200rpm, and the reaction pH was 3.5-10.5. Then it was rinsed with pure water and dried at 100℃ to constant weight to obtain five kinds of mannose-modified modified cotton fiber carriers, such as Figure 8 As shown. Unmodified cotton fiber was used as control ( Figure 7 0 in ).

[0119] Wherein, the mass ratio of dopamine:polyethyleneimine:mannose is 0-1:0-2:0-40.

[0120] Specifically, the mass ratio of dopamine, polyethyleneimine, and mannose in flasks No. 1 and No. 5 was 1:1:10, and the order of solvent addition was different. In flask No. 1, polyethyleneimine was added first, followed by mannose, and finally dopamine; in flask No. 5, dopamine, polyethyleneimine, and mannose were added simultaneously.

[0121] Specifically, in the No. 2 conical flask, the mass ratio of dopamine:polyethyleneimine:mannose is 0:1:10.

[0122] Specifically, in the No. 3 conical flask, the mass ratio of dopamine, polyethyleneimine, and mannose is 1:1:0.

[0123] Specifically, in a No. 4 conical flask, the mass ratio of dopamine, polyethyleneimine, and mannose is 1:0:10.

[0124] choose Figure 7 Subsequent research and analysis were carried out on the modified cotton fiber carrier modified with mannose in the No. 2 triangular flask.

[0125] 1. Fourier transform infrared spectroscopy (FITR)

[0126] At 4000cm -1 Up to 1000cm -1 The FTIR spectrum of the modified cotton fiber carrier modified with No. 2 mannose was recorded in the range to analyze the characteristic functional groups on its surface.

[0127] The infrared spectrum results are as follows Figure 9 As shown, the mannose-modified modified cotton fiber carrier is at 3661 cm -1 There is a -NH2 vibration peak in polyethyleneimine at 1640 cm -1 There is a C=N vibration peak at 890cm -1 The presence of -NH- vibration peaks indicates the successful modification of the cotton fiber carrier.

[0128] 2. HPLC determination of α-methyl-D-mannoside content on the carrier

[0129] The analysis of α-methyl-D-mannoside (α-D-Man) was completed at 60°C on an Agilent 1260 InfinityⅡ differential index detector (RID) and an Aminex HPX-87H analytical HPLC column with 5 mmol / L H2SO4 as the mobile phase at a flow rate of 0.4 mL / min.

[0130] The results showed that the amount of α-methyl-D-mannoside modified before modification was 0 mg / g support, while the amount of α-methyl-D-mannoside modified after modification was 165.5 mg / g support. This indicates that during the modification process, α-methyl-D-mannoside was successfully modified onto the cotton fiber support, with the modification amount reaching 165.5 mg / g support.

[0131] 3. Observation using confocal laser scanning microscopy (CLSM)

[0132] 200 μL of 50 μg / mL concanavalin A (excitation wavelength: 488 nm; emission wavelength: 505 nm) was added to the modified and unmodified vectors. The slides were stained in the dark at 4°C for 30 min. Unstaining stain was removed with PBS buffer, and the slides were dried at room temperature in the dark. The slides were then mounted with an anti-fluorescence mountant and observed using a confocal laser scanning microscope (CLSM).

[0133] Figure 10 Laser scanning confocal microscopy images of the carrier before and after modification and after staining with Concanavalin A in the dark are provided. Concanavalin A specifically recognizes and binds to sugar chains containing sugar molecules such as α-D-mannose, α-D-glucose, and α-D-galactose. As can be seen from the image, the modified carrier exhibits a significant Con A fluorescence signal compared to the unmodified carrier, indicating the presence of Concanavalin A on its surface and the successful introduction of mannose modification onto the carrier surface, further confirming the successful application of the mannose-modified coating on the carrier surface.

[0134] Example 4: Study on the adsorption performance of the target strain and the carrier and the fermentation performance of L-threonine production

[0135] 1. Carrier processing

[0136] The original cotton fiber carrier (CF) was soaked in an appropriate amount of 1M NaOH for 1 hour, then cleaned with ultrapure water, soaked in 1M HCl solution for 1 hour, washed with sterile water to a pH of 7.0, and placed in an oven to dry the moisture. The original cotton fiber carrier was modified according to the modification method of Example 3 to obtain a mannose-modified cotton fiber carrier (CF-Man). The carrier was cut into squares according to the amount of 30g / L and inoculated into a fermentation medium (formula: 30g / L glucose, 2g / L yeast powder, 1g / L KH2PO4, 22g / L (NH4)2SO4, 0.8g / L MgSO4·7H2O, 0.02g / L MnSO4·5H2O, 0.02g / L FeSO4·7H2O, 0.002g / L vitamin B1, 30g / L CaCO3), sterilized at 115°C for 20min, and then cooled.

[0137] 2. Immobilized Continuous Fermentation

[0138] 1. Restore the vitality of the strain

[0139] Take the preserved tube and place it in an ice box to wait for thawing. After thawing, take appropriate amounts of ΔycgF and ΔycgF+LPP-OmpA-fimH strains and inoculate them into LB shake tubes respectively. Culture at a constant temperature of 37°C to obtain revitalized bacterial liquid.

[0140] 2. Receive fermentation liquid

[0141] (1) Add 1 mL of revitalized bacterial solution to each 100 mL shake flask and culture in a 37°C incubator for 12 h to obtain seed solution.

[0142] (2) Pour 50 mL of fermentation medium into a 500 mL Erlenmeyer flask, take 2 mL of the seed solution in step (1) (i.e., 4% v / v inoculation amount) and inoculate it into the Erlenmeyer flask respectively, and add 100 mg / mL Amp resistance.

[0143] (3) Fermentation was carried out at a constant temperature at 37°C and 200 rpm in a shaking incubator. The residual glucose content and L-threonine production in the fermentation broth were monitored every 6 hours. When the glucose content in the fermentation broth was less than 1 g / L, the first batch of fermentation was terminated. 80% of the fermentation broth was aspirated from the container, the carrier was retained, and an equal volume of sterile fermentation medium was added to the next batch of fermentation. The immobilized continuous fermentation was terminated until the L-threonine production stabilized.

[0144] 3. Determination of glucose content and L-threonine production

[0145] 2 mL of fermentation broth sample was taken every 6 hours and centrifuged at 4°C, 12000 rpm for 5 min. The supernatant was taken and the glucose content was measured using a sugar meter.

[0146] The L-threonine production was measured by high performance liquid chromatography (HPLC), and the parameters are shown in Table 5. The L-threonine production by immobilized continuous fermentation is shown in Table 6. Figure 11 ΔycgF strain+CF( Figure 11 ), ΔycgF+LPP-OmpA-fimH strain+CF-Man ( Figure 11 (Lower figure) Trend diagram of various parameters of immobilized continuous fermentation.

[0147] Table 5 Liquid chromatography parameters

[0148]

[0149] Table 6 Immobilized continuous fermentation data

[0150]

[0151] 4. SEM electron microscope photography

[0152] Two kinds of carriers that use respectively in the immobilized continuous fermentation process in step 3 are taken out, carry out SEM electron microscope and shoot.Use PBS to soak carrier 3 times, add 2.5% glutaraldehyde, 4 ℃ of fixing 12h, then use PBS to soak carrier 2 times.Then use 0%, 50%, 70%, 80%, 90%, 95%, 100% ethanol to carry out gradient dehydration respectively, every kind of concentration alcohol dehydration 2 times, each 15min.Soak 10min with the tributyl alcohol again, after the centrifugal removal tributyl alcohol, place and spend the night in-80 ℃ of refrigerators, use vacuum freeze dryer at last that sample is freeze-dried, send sample and use scanning electron microscope (SEM) Hitachi Japan Hitachi SU 8020 to shoot.

[0153] 5. Carrier elution

[0154] After the two carriers immobilized and continuously fermented in step 3 were washed with PBS to remove free bacteria, 30-50 mL of PBS buffer or PBS buffer containing mannoside was added to elute the E. coli on the carriers.

[0155] In this embodiment, immobilized fermentation experiments were carried out on original cotton fiber carriers (CF) and modified cotton fiber carriers (CF-Man) using the original strain ΔycgF, and immobilized fermentation experiments were carried out on original cotton fiber carriers and modified cotton fibers using the recombinant strain ΔycgF+LPP-OmpA-fimH constructed by the present invention. After 7 batches of immobilized continuous fermentation experiments, the fermentation results are shown in Table 6. It can be seen from the data in Table 6 that the fermentation yield of ΔycgF strain + CF tended to be stable when the 5th batch was continuously fermented, and the yield of ΔycgF+LPP-OmpA-fimH strain + CF-Man tended to be stable when the 3rd batch was continuously fermented. The yields of ΔycgF strain + CF and ΔycgF+LPP-OmpA-fimH strain + CF-Man both reached the highest in the 7th batch, which were 11.15 g / L and 13.62 g / L, respectively. From Figure 11 As can be seen, the fermentation cycle of the ΔycgF+LPP-OmpA-fimH+CF-Man strain consistently shortened compared to the ΔycgF+CF strain. The final fermentation cycles for the ΔycgF+CF and ΔycgF+LPP-OmpA-fimH+CF-Man strains were 33 hours and 28 hours, respectively. Therefore, the immobilized yield of the ΔycgF+LPP-OmpA-fimH+CF-Man strain was 22.15% higher than that of the ΔycgF+CF strain, and the immobilized fermentation cycle of the ΔycgF+LPP-OmpA-fimH+CF-Man strain was 15.15% shorter than that of the ΔycgF+CF strain. Figure 12From the SEM electron microscopy results, it can be observed that the biofilm formed by ΔycgF+LPP-OmpA-fimH on the cotton fibers modified with mannose substances is significantly more than that formed by ΔycgF on the original cotton fibers. Figure 13 It can be observed from the OD value of the supernatant after elution that the buffer containing mannose substances can elute more Escherichia coli.

[0156] In summary, the modified strain ΔycgF+LPP-OmpA-fimH exhibited stronger adsorption on cotton fiber than the original strain. Mannose-modified cotton fiber supports adsorbed more E. coli. In particular, the ΔycgF+LPP-OmpA-fimH strain exhibited the best adsorption on CF+Man. The simultaneous modification of the strain and medium promoted bacterial adhesion, enhanced biofilm formation, and improved the efficiency of immobilized continuous fermentation.

[0157] The present invention provides a method and concept for producing L-threonine by immobilizing recombinant Escherichia coli cells displaying adhesin proteins and specifically binding to modified materials for fermentation. Numerous methods and approaches exist for implementing this technical solution. The foregoing merely represents a preferred embodiment of the present invention. It should be noted that those skilled in the art may make various improvements and modifications without departing from the principles of the present invention, and such improvements and modifications are also within the scope of protection of the present invention. Any components not specified in this example may be implemented using existing technologies.

Claims

1. A recombinant Escherichia coli, characterized in that Using Escherichia coli ΔycgF as the starting strain, the adhesin protein FimH was anchored by an anchoring protein to construct a recombinant Escherichia coli displaying the adhesin protein on its surface. Wherein, the anchoring protein includes any one of LPP-OmpA, Ag43, and eCPX.

2. The recombinant Escherichia coli according to claim 1, characterized in that The nucleotide sequence of the adhesin protein FimH is shown in SEQ ID NO:4; the nucleotide sequence of the anchoring protein Lpp-OmpA is shown in SEQ ID NO:1; the nucleotide sequence of the anchoring protein Ag43 is shown in SEQ ID NO:2; and the nucleotide sequence of the anchoring protein eCPX is shown in SEQ ID NO:

3.

3. The recombinant Escherichia coli according to claim 1, characterized in that The anchoring protein anchors the adhesin protein FimH to form a fusion protein, and the fusion protein is driven by a promoter for expression; Wherein, the promoter is a nucleotide sequence such as any one of SEQ ID NOs: 5 to 9.

4. Use of the recombinant Escherichia coli according to any one of claims 1 to 3 in the production of L-threonine by immobilized fermentation.

5. A method for producing L-threonine by immobilized fermentation, characterized in that: The modified fiber material is used as a carrier and the recombinant Escherichia coli according to any one of claims 1 to 3 is used for immobilized fermentation to produce L-threonine.

6. The method according to claim 5, characterized in that The fiber material includes any one of cotton fiber, flax, nylon, polyester, polypropylene fiber, and polyethylene fiber, or a combination of several of them.

7. The method according to claim 5, characterized in that The modified fiber material is obtained by placing the fiber material in a modification solution for reaction; Wherein, the solute of the modified solution is any one or a combination of polyethyleneimine, dopamine and mannose, and the solvent is water.

8. The method according to claim 7, characterized in that The mass ratio of dopamine, polyethyleneimine and mannose is 0-1:0-2:0-40, and the mass ratio of the three is not 0 at the same time.

9. The method according to claim 7, characterized in that The fiber material is added in an amount of 10 to 40 g / L.

10. The method according to claim 5, characterized in that The inoculation amount of the seed liquid of the recombinant Escherichia coli is 2-8% v / v; the fermentation medium of the immobilized fermentation is: 20-40 g / L glucose, 1-3 g / L yeast powder, 0.5-2 g / L KH2PO4, 20-30 g / L (NH4)2SO4, 0.5-1 g / L MgSO4·7H2O, 0.01-0.05 g / L MnSO4·5H2O, 0.01-0.04 g / L FeSO4·7H2O, 0.001-0.003 g / L vitamin B1, 10-30 g / L CaCO3; the immobilized fermentation conditions are: constant temperature fermentation at 30-44°C and 150-250rpm; when the glucose content in the fermentation broth is lower than 1g / L, the first batch of fermentation is terminated, 60%-90% of the fermentation broth is discharged, and an equal volume of fermentation medium is added, and then the second batch of fermentation is carried out; the immobilized fermentation process of discharging 60%-90% of the fermentation broth and adding an equal volume of fermentation medium is repeated for 5-8 batches.

Images