Endonuclease Gs12a2-5 and nucleic acid detection technology mediated by endonuclease Gs12a2-5

By mining the Gs12a2-5 endonuclease and crRNA structural sequences from the metagenome, the CRISPR-Gs12a2-5 system was developed, which solved the limitations of the existing CRISPR/Cas system in terms of target recognition range and detection sensitivity, and realized efficient and accurate nucleic acid detection technology, which was suitable for multiple application fields.

CN120424907APending Publication Date: 2025-08-05HUAZHONG AGRI UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510571916.0
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-04-30
Publication Date
2025-08-05

AI Technical Summary

Technical Problem

The existing CRISPR/Cas systems have limitations in target recognition range and detection sensitivity, and it is difficult to meet the needs of efficient and accurate nucleic acid detection.

Method used

The new Cas endonuclease Gs12a2-5 was mined from the genome of unknown microbial organisms of metagenome, and nucleic acid detection technology based on the CRISPR-Gs12a2-5 system was developed. The Gs12a2-5 endonuclease and crRNA structural sequence were used to achieve specific recognition and cleavage of the target nucleic acid, and combined with single-stranded DNA fluorescence-quenching reporter gene to generate detectable signals.

Benefits of technology

It has achieved rapid, sensitive and specific detection of target nucleic acids, improved the accuracy and efficiency of nucleic acid detection, and is suitable for pathogen detection, genetic diagnosis, food safety detection and environmental monitoring.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure BDA0005387371200000062
    Figure BDA0005387371200000062
  • Figure BDA0005387371200000071
    Figure BDA0005387371200000071
  • Figure BDA0005387371200000081
    Figure BDA0005387371200000081
Patent Text Reader

Abstract

The invention discloses an endonuclease Gs12a2-5 and a nucleic acid detection technology mediated by the endonuclease Gs12a2-5. A novel Cas endonuclease Gs12a2-5 and a related crRNA structure sequence are excavated from unknown microbial genomes of metagenomes through a bioinformatics technology, and compared with known SuCas12a2 endonuclease, the Gs12a2-5 endonuclease shows good trans-cleavage activity, is higher in sensitivity in nucleic acid detection, and can be applied to detection of various microorganisms. Therefore, a CRISPR-Gs12a2-5 system-mediated nucleic acid visual detection technology is developed, and the CRISPR-Gs12a2-5 system-mediated nucleic acid visual detection technology has the advantages of simplicity and convenience in operation, rapidness in detection, high sensitivity, strong specificity and the like, and has a wide application prospect in the field of nucleic acid detection.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the field of nucleic acid detection technology, and specifically relates to a CRISPR-Gs12a2-5 nuclease and a nucleic acid detection technology mediated by the same. Background Art

[0002] As a key technology in modern life sciences, gene editing plays an important role in a variety of fields, including gene function research, gene therapy, and agricultural breeding. The CRISPR / Cas system, with its advantages of high efficiency, precision, and ease of operation, has become one of the most widely used gene editing tools. This system uses guide RNA (gRNA) to specifically bind to the target DNA sequence, directing the Cas protein to cut the target DNA and achieve gene editing. While traditional CRISPR / Cas systems, such as Cas12 and Cas13, have achieved remarkable results in gene editing-mediated nucleic acid detection, they still have some limitations, such as the need to improve target recognition range and detection sensitivity.

[0003] In recent years, with the development of metagenomics, mining novel Cas proteins from unknown microbial genomes in the environment has become an important research direction in the field of gene editing. Through bioinformatics methods, Cas proteins with potential gene editing functions can be screened from massive amounts of metagenomic data, providing new resources for the development of gene editing technology. It is against this background that the present invention mines the novel Cas endonuclease Gs12a2-5 from the genomes of unknown microorganisms in the metagenomics and develops a nucleic acid detection technology based on the CRISPR-Gs12a2-5 system. Summary of the Invention

[0004] The present invention aims to provide a CRISPR-Gs12a2-5 system and a nucleic acid detection technology mediated by it, so as to solve the limitation problem of existing gene editing technology in the field of nucleic acid detection. The present invention discloses for the first time the Gs12a2-5 nuclease, whose amino acid sequence is unique and exhibits good trans-cleavage activity, providing a powerful tool for gene editing. A DNA sequence encoding the protein is provided, which is suitable for prokaryotic and eukaryotic expression systems to ensure efficient expression of the protein and meet the needs of gene editing. An expression vector containing a DNA sequence encoding the Gs12a2-5 nuclease is constructed, which is suitable for a variety of host cells to achieve stable expression and inheritance of the protein, providing a stable basis for nucleic acid detection. A crRNA structural sequence that acts synergistically with the Gs12a2-5 nuclease is designed to specifically recognize the target nucleic acid, guide the protein for precise cutting, and improve the accuracy of nucleic acid detection. We have developed a nucleic acid visualization detection technology based on the CRISPR-Gs12a2-5 system and a nucleic acid detection kit for detecting ASFV and PRRSV. By utilizing the Gs12a2-5 nuclease and crRNA structural sequence, we can achieve rapid, sensitive and specific detection of target nucleic acids, providing innovative solutions for the field of nucleic acid detection.

[0005] In order to achieve the above object, the present invention adopts the following technical solutions:

[0006] 1. Gs12a2-5 endonuclease

[0007] The present invention provides a Gs12a2-5 endonuclease, the amino acid sequence of which is shown in SEQ ID NO. 5. This protein is a novel Cas endonuclease discovered from an unknown microbial genome in a metagenomic genome. It has unique structural and functional properties, particularly exhibiting excellent trans-cleavage activity, providing a new tool for gene editing and nucleic acid detection.

[0008] 2. DNA sequence encoding Gs12a2-5 endonuclease

[0009] The present invention also provides a DNA sequence encoding the Gs12a2-5 endonuclease, as shown in SEQ ID NO. 10. This DNA sequence can be used to express the Gs12a2-5 endonuclease in a prokaryotic or eukaryotic expression system. Specifically, the DNA sequence can be cloned into an expression vector and transformed or transfected into a host cell to achieve efficient expression of the Gs12a2-5 endonuclease, providing sufficient protein resources for subsequent gene editing and nucleic acid detection applications.

[0010] 3. Expression vector

[0011] The present invention further provides an expression vector comprising the DNA sequence encoding the Gs12a2-5 endonuclease, capable of effectively expressing the Gs12a2-5 endonuclease in a host cell. The expression vector may be a commonly used gene expression vector such as a plasmid, phage, or viral vector, and may be provided with suitable promoters, terminators, and selectable markers to ensure efficient expression and stable inheritance of the Gs12a2-5 endonuclease in the host cell. The expression vector has important application value in the fields of gene editing and nucleic acid detection, and can provide a convenient protein source for related research and applications.

[0012] 4. crRNA structure sequence

[0013] The present invention also provides a crRNA structural sequence (direct repeat sequence, DR) that acts synergistically with the Gs12a2-5 endonuclease, and the crRNA structural sequence is shown in SEQ ID NO.11. The crRNA structural sequence can specifically bind to the Gs12a2-5 endonuclease and activate it to cut the target nucleic acid, thereby achieving editing or detection of a specific gene. The crRNA structural sequence has a high degree of specificity and sensitivity, and provides an accurate guiding tool for gene editing and nucleic acid detection.

[0014] 5. Nucleic acid detection technology based on the CRISPR-Gs12a2-5 system

[0015] The present invention has developed a nucleic acid visualization detection technology based on the CRISPR-Gs12a2-5 system. This technology uses a guide RNA paired with the target nucleic acid to guide the Gs12a2-5 endonuclease to specifically recognize and cleave the target nucleic acid sequence. The single-stranded DNA fluorescence-quenching reporter gene produces a detectable signal, achieving rapid, sensitive, and specific detection of the target nucleic acid. This nucleic acid detection technology has the advantages of simple operation, rapid detection, high sensitivity, and strong specificity. It can be widely used in pathogen detection, genetic diagnosis, food safety testing, environmental monitoring and other fields, providing a new technical means for the field of nucleic acid detection.

[0016] 6. Test kit

[0017] The present invention also provides a visual nucleic acid detection kit comprising the Gs12a2-5 endonuclease, a specific guide RNA, and a single-stranded DNA fluorescence-quenching reporter gene. This kit can be directly used for nucleic acid detection technologies mediated by the CRISPR-Gs12a2-5 system, providing a convenient tool for related research and applications. This kit offers advantages such as good stability, ease of use, and accurate and reliable test results, meeting the needs of diverse users and possessing broad market prospects.

[0018] The technical solution of the present invention has the following main beneficial effects:

[0019] 1. The Gs12a2-5 endonuclease provided by the present invention has excellent trans-cleavage activity and can perform nucleic acid detection more sensitively. Compared with the known SuCas12a2 system, the Gs12a2-5 system is more sensitive in nucleic acid detection and provides a more reliable tool for nucleic acid detection.

[0020] 2. The nucleic acid visualization detection technology developed by the present invention, based on the CRISPR-Gs12a2-5 system, has the advantages of simple operation, rapid detection, high sensitivity, and strong specificity. This technology can specifically recognize and cleave target nucleic acid sequences, generating a detectable signal, enabling rapid, sensitive, and specific detection of target nucleic acids. This technology has broad application prospects in pathogen detection, genetic diagnosis, food safety testing, environmental monitoring, and other fields, providing a new technical means for the field of nucleic acid detection and expanding its scope of application.

[0021] 3. The present invention has discovered a new Cas endonuclease Gs12a2-5 and its related crRNA structure sequence from the genome of an unknown microorganism in the metagenome, providing new resources and ideas for the development of nucleic acid detection technology. The discovery and application of the CRISPR-Gs12a2-5 system not only enriches the types of CRISPR / Cas systems, but also provides a foundation for further optimization and innovation of gene editing technology. This discovery will help promote the application and development of nucleic acid detection technology in the fields of life sciences, medicine, agriculture, etc., and provide new tools and methods for research and practice in related fields. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 The phylogenetic tree analysis of five novel Gs12a2 endonucleases discovered by metagenomics methods is presented.

[0023] Figure 2 The conservation analysis of the amino acid sequences of five novel nucleases Gs12a2-1, Gs12a2-2, Gs12a2-3, Gs12a2-4, and Gs12a2-5 with the known SuCas12a2 nuclease is presented.

[0024] Figure 3 Shown are alignments of the loci, domains, and guide RNA DR sequences for five novel endonucleases, Gs12a2-1, Gs12a2-2, Gs12a2-3, Gs12a2-4, and Gs12a2-5. A. Schematic diagram of the locus; B. Schematic diagram of the domains; C. Alignment of the guide RNA DR sequences.

[0025] Figure 4This study demonstrates the in vitro cleavage assay for the trans-cleavage activity of five novel endonucleases against a single-stranded DNA (ssDNA)-FQ reporter gene. A. Principle of the CRISPR-Cas12a2 system-mediated nucleic acid detection assay; B. Comparison of the trans-cleavage activity of the five novel endonucleases, Cas12a2.

[0026] Figure 5 The trans-cleavage activities of five novel endonucleases against a target with a PFS of 3'-AAAN-5' were evaluated and compared.

[0027] Figure 6 The rapid visualization detection effect of ASFV nucleic acid mediated by five new nucleases was demonstrated.

[0028] Figure 7 The study evaluated the effect of guide RNA spacer length on the activity of nucleic acid visualization detection mediated by the CRISPR-Gs12a2-5 system. A. A blue light analyzer was used to examine the effect of spacer length on the activity of the Gs12a2-5 endonuclease in detecting the p72 gene encoding the African swine fever virus; B. A microplate reader was used to examine the effect of spacer length on the activity of nucleic acid detection mediated by the CRISPR-Gs12a2-5 system.

[0029] Figure 8 This study evaluated the specificity of nucleic acid detection mediated by the CRISPR-Gs12a2-5 system. A. Sequence characteristics of base mismatches at the prepared target site; B. Quantitative detection of the CRISPR-Gs12a2-5 system's ability to recognize single-base mismatches in non-PFS regions using a microplate reader.

[0030] Figure 9 The purpose of this study was to evaluate the sensitivity and specificity of the RPA-CRISPR-Gs12a2-5 system-mediated rapid visualization detection of PRRSV nucleic acid. A. Schematic diagram of the RPA-CRISPR-Gs12a2-5 system-mediated rapid visualization detection of PRRSV nucleic acid; B. Screening for the most active crRNA; C. Screening for the most efficient RPA primer pairs; D. Testing the sensitivity of the RPA-CRISPR-Gs12a2-5 system; E. Testing the specificity of the RPA-CRISPR-Gs12a2-5 system. DETAILED DESCRIPTION

[0031] Terminology

[0032] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.

[0033] Genie scissor (Lingjian) endonuclease. "Genie" means "elf," indicating its bacterial origin, and "scissor" stands for "gene scissors," indicating its potential gene-editing capabilities. The Chinese equivalent of Genie scissor endonuclease is "Lingjian" endonuclease.

[0034] The present invention will be further described below in conjunction with specific implementation. It should be understood that these examples are intended only to illustrate the present invention and are not intended to limit the scope of the present invention. The experimental methods in the following examples where specific conditions are not specified are generally based on conventional conditions.

[0035] Example 1. Mining novel endonucleases from metagenomic data based on bioinformatics strategies

[0036] Based on the inventors' novel gene-editing tools, they developed a bioinformatics mining pipeline to conduct in-depth mining of bacterial proteins within large amounts of metagenomic sequencing data from public databases such as the Global Microbial Gene Catalog (GMGC) and NCBI. The specific analysis process involved searching and locating CRISPR arrays for all contig sequences in the target database using Minced software. Proteins expressed near the CRISPR arrays were then predicted using Prodigal software. Redundancy in the predicted proteins was removed using CD-hit software. Protein clustering analysis was then performed using Mega software, and CRISPR-Cas-like proteins were identified and classified using Hmmer software. Ultimately, five new, unknown bacterial proteins were identified.

[0037] Phylogenetic tree analysis revealed that these five new bacterial proteins were distributed on different Cas12a2 evolutionary branches ( Figure 1 ), it is speculated that they may be new Cas12a2 family homologous RNA-guided endonucleases. The present invention names this type of newly discovered protein from different bacteria as Genie scissor (spiritual shear) endonuclease, in view of its origin from unannotated bacterial genomes, for ease of subsequent research, the inventors named these 5 new unknown bacterial proteins as Gs12a2-1, Gs12a2-2, Gs12a2-3, Gs12a2-4, Gs12a2-5, and the naming convention is "endonuclease + digital numbering", and its amino acid sequence is shown in SEQ ID NO.1, 2, 3, 4, 5, and its DNA coding sequence is shown in SEQ ID NO.6, 7, 8, 9, 10.

[0038] Subsequently, the inventors used the localized blast program to compare the sequence similarity of these five newly discovered bacterial proteins with the NCBI nr database. The results showed that the amino acid sequence conservation of Gs12a2-1, Gs12a2-2, Gs12a2-3, Gs12a2-4, and Gs12a2-5 proteins with the known nuclease SuCas12a2 was 37.10%, 34.78%, 44.94%, 45.94%, and 42.18%, respectively. Figure 2 ).

[0039] Furthermore, the inventors used CRISPRCasFinder software to analyze the loci of these five proteins. The results showed that all five new nucleases contained CRISPR array sequences, among which Gs12a2-1, Gs12a2-2, Gs12a2-3, and Gs12a2-5 contained multiple repeat and spacer sequences as well as Cas4, Cas1, and Cas2 proteins ( Figure 3 A). Markov model comparison analysis was performed using the HMMER and Pfam databases, and the domains were found to be WED, REC, PI, unknow, RuvC, ZR, etc. Cas12a2 and SuCas12a2 have homologous RuvC functional domains and N-termini with similar secondary structures. However, corresponding to the BH domain and Nuc functional domain of the Cas12a protein, Cas12a2 has completely different domains of unknown function and ZR domains ( Figure 3 B). Then, the inventors compared the DR sequences of Gs12a2-1, Gs12a2-2, Gs12a2-3, Gs12a2-4, Gs12a2-5 and SuCas12a2 respectively through the RNAfold web server (http: / / rna.tbi.univie.ac.at / cgi-bin / RNAWebSuite / RNAfold.cgi) online website. The results showed that the DR sequences of Gs12a2-1, Gs12a2-2, Gs12a2-3, Gs12a2-5 and the known SuCas12a2 were different only at the eleventh base. The known SuCas12a2 was guanine (G), Gs12a2-1, Gs12a2-3, and Gs12a2-5 were all adenine (A), and Gs12a2-2 was uracil (U) ( Figure 3 C). Therefore, further experiments are urgently needed to determine whether they have trans-cleavage activity.

[0040] Example 2. Evaluation and comparison of the trans-cleavage activity of five novel Gs12a2 endonucleases

[0041] This example tests the trans-cleavage activity of Gs12a2-1, Gs12a2-2, Gs12a2-3, Gs12a2-4, and Gs12a2-5 endonucleases against ssDNA-FQ reporter genes through in vitro experiments. In the experiment, guide RNAs paired with target nucleic acids were used to guide five different Gs12a2 endonucleases to recognize and bind to target nucleic acids. By stimulating the cis-cleavage activity of Gs12a2 on the target nucleic acid, its trans-cleavage activity was activated, and the ssDNA-FQ reporter gene in the reaction system was cut off. The fluorescent signal and recorded data can be detected by the blue light excitation light and the microplate reader, thereby evaluating whether the CRISPR-Gs12a2 system is suitable for nucleic acid detection.

[0042] The target nucleic acid selected in this example is a partial fragment of the African swine fever (ASFV) p72 gene, the sequence of which is

[0043]

[0044] The bold part is the PFS sequence, the underlined area is the targeting region, and the guide RNA sequence is 5'-AAUUUCUACUGUUGUAGAU AGAGCAGACAUUAGUUUUUUC -3' (the underlined area is the targeting area). First, using the p72 partial fragment gene as a template (100ng), PCR amplification was performed with p72-F (5'-TAATACGACTCACTATAGGGCCCCTGAAATACACAACCT-3') and p72-R (5'-CTCGGTGTTGATGAGGATT-3') as primers to obtain p72 double-stranded DNA, and then in vitro transcription was performed to obtain p72 single-stranded RNA. Secondly, the DNA sequences encoding Gs12a2-1, Gs12a2-2, Gs12a2-3, Gs12a2-4, Gs12a2-5 and SuCas12a2 nuclease were synthesized after Escherichia coli codon optimization, and NLS nuclear localization signals were added to their C-termini respectively.

[0045] It was then connected to the pET-28a prokaryotic expression vector and transformed into the Escherichia coli BL21 strain. After identifying the positive clones, IPTG-induced expression was performed, and the target protein was obtained by affinity chromatography purification. The in vitro cleavage reaction used the following system: 10×r3.1 NEBuffer 2μL, target protein or SuCas12a2 protein 500ng, guide RNA 500ng, p72 RNA target 500ng, 1μM single-stranded DNA fluorescence-quenching reporter gene ROX-N12-BHQ2 (5'ROX / GTATCCAGTGCG / 3'BHQ2) 0.3μL. Incubate at 37°C for 15min. The experimental group added guide RNA and target nucleic acid, while the control group did not add target nucleic acid and added protein to the tube wall. After a brief centrifugation, it was placed in real-time fluorescence quantitative PCR. The experimental principle is as follows. Figure 4 As shown in A, the experimental results are Figure 4 As shown in B, the Gs12a2-5 nuclease in the experimental group can cut the ssDNA-FQ reporter gene in the reaction solution. By comparison, it was found that the fluorescence signal activity generated by Gs12a2-5 cutting the reporter gene was higher than that of the known SuCas12a2. However, under the same conditions, Gs12a2-1, Gs12a2-2, and Gs12a2-4 were not found to have trans-cutting activity, while Gs12a2-3 may have weak trans-cutting activity. This shows that the newly discovered Gs12a2-5 nuclease has high trans-cutting activity and is suitable for application in nucleic acid visualization detection.

[0046] Example 3. Detection of the cleavage activity of Gs12a2-5 in recognizing PFS as a 3'-AAAN-5' target

[0047] The SuCas12a2 endonuclease of the homologous family can specifically recognize targets with a PFS of 3'-AAAN-5'. However, sequence alignment revealed that the similarity between Gs12a2-5 and the known SuCas12a2 protein was only 42.18%. In view of this, this example selected a target site with a PFS of 3'-AAAN-5' to evaluate the target recognition activity of Gs12a2-5.

[0048] The target used in this example was a partial fragment of the p72 gene of the African swine fever virus (ASFV). Single-stranded RNA (ssRNA) obtained by in vitro transcription was used as a template with the following sequence: 5'--3'. The PFS and corresponding guide RNA sequences are shown in Table 1.

[0049] Table 1. Sequences of different PFS and guide RNAs

[0050]

[0051]

[0052] First, Gs12a2-1, Gs12a2-2, Gs12a2-3, Gs12a2-4, and Gs12a2-5 proteins were expressed and purified in prokaryotic cells. Guide RNAs and single-stranded RNAs targeting the p72 gene were then transcribed in vitro. The following reaction system was then used: 500 ng of Gs12a2-1, Gs12a2-2, Gs12a2-3, Gs12a2-4, or Gs12a2-5 protein, 500 ng of each guide RNA, 2 μL of 10× r3.1 NE Buffer, 0.3 μL of a 100 μM single-stranded DNA fluorescence-quenched reporter gene (5'ROX / GTATCCAGTGCG / 3'BHQ2), and 3 μL of in vitro transcribed target RNA. A negative control was performed without target RNA. The reaction was incubated at 37°C for 15 minutes and inactivated at 98°C for 2 minutes. The trans-cleavage activities of the five nucleases under the corresponding PFS were determined by measuring the fluorescence intensity of the reaction solution.

[0053] The results are as follows Figure 5 As shown, Gs12a2-1, Gs12a2-2, and Gs12a2-3 endonucleases showed no trans-cleavage activity against targets with four PFSs (AAAA, AAAT, AAAC, and AAAG), while Gs12a2-4 showed weak trans-cleavage activity. In contrast, Gs12a2-5 endonuclease showed trans-cleavage activity against targets with a PFS of 3'-AAAN-5' (N is A, T, C, or G). Therefore, a 3'-AAAN-5' PFS design is recommended for designing guide RNAs for Gs12a2-5.

[0054] Example 4. Establishment of a rapid visualization detection technology for ASFV nucleic acid mediated by the CRISPR-Gs12a2-5 system

[0055] This example establishes a rapid visualization detection technology for African swine fever virus (ASFV) nucleic acid mediated by the CRISPR-Gs12a2-5 system, using the following method: using the Gs12a2-5 nuclease to recognize the p72 gene of ASFV; then stimulating its "trans-cleavage" activity, thereby cutting the ssDNA-FQ in the reaction system; by detecting the excited fluorescence intensity, background noise, and observing the color change of the solution with the naked eye, the trans-cleavage activity of the nuclease can be judged, and thus a detection technology for ASFV nucleic acid is established.

[0056] The target used in this example is a partial sequence of the p72 gene of the African swine fever virus (ASFV). The single-stranded RNA (ssRNA) obtained by in vitro transcription is used as a template. The sequence is as follows:

[0057]

[0058] The bold mark is PFS, and the underline is the targeting sequence. The guide RNA sequence is 5'-AAUUUCUACUGUUGUAGAU AGAGCAGACAUUAGUUUUUUC -3' (the underlined region is the target region). The sequence of the single-stranded DNA fluorescence-quenching reporter gene is 5'ROX / GTATCCAGTGCG / 3'BHQ2. First, Gs12a2-1, Gs12a2-2, Gs12a2-3, Gs12a2-4, and Gs12a2-5 proteins were expressed and purified in prokaryotic cells, and guide RNA and p72 target gene single-stranded RNA were transcribed in vitro. The following reaction system was then used: 500 ng each of Gs12a2-1, Gs12a2-2, Gs12a2-3, Gs12a2-4, or Gs12a2-5 protein, 500 ng of guide RNA, 2 μL of 10× r3.1NE Buffer, 0.3 μL of 1 μM single-stranded DNA fluorescence-quenching reporter gene, and 3 μL of in vitro transcribed target RNA. A negative control was performed without target. The reaction was incubated at 37°C for 15 minutes and inactivated at 98°C for 2 minutes. The trans-cleavage activity of the above five proteins in vitro was determined by observing color changes, fluorescence intensity and background noise under blue light.

[0059] The results are as follows Figure 6 As shown, the color and fluorescence changes of the reaction solution before and after cleavage indicate that Gs12a2-5 endonuclease has high trans-cleavage activity and low false positive or background fluorescence signals, indicating that it is very suitable for nucleic acid visualization detection technology. This successfully established a new technology for African swine fever virus nucleic acid detection mediated by the CRISPR-Gs12a2-5 system.

[0060] We then evaluated the effect of guide RNA spacer length on the nucleic acid detection activity mediated by the CRISPR-Gs12a2-5 system. Using the aforementioned target as the nucleic acid detection site, the following reaction system was performed: 500 ng of Gs12a2-5 endonuclease, 500 ng of guide RNA, 2 μL of 10× r3.1 NE Buffer, 0.3 μL of a 1 μM single-stranded DNA fluorescence-quenched reporter gene (5'ROX / GTATCCAGTGCG / 3'BHQ2), and 3 μL of in vitro-transcribed single-stranded RNA of the p72 target gene. The guide RNA spacer lengths varied from 12 nt, 16 nt, 20 nt, 24 nt, and 26 nt. The reaction was performed at 37°C for 15 min and inactivated at 98°C for 2 min. Fluorescence intensity and background noise were accurately determined by observation under blue light and on a microplate reader. The results showed that when the spacer length was in the range of 20-24 nt, the trans-cleavage activity of Gs12a2-5 was relatively good, especially when the length was 24 nt, the trans-cleavage activity was the highest ( Figure 7 A, 7B).

[0061] Table 2. PCR primers for crRNA sequences with different spacer lengths

[0062]

[0063]

[0064] Example 5. Evaluation of the specificity of CRISPR-Gs12a2-5 endonuclease in recognizing base mismatch targets

[0065] This example evaluates the ability of the CRISPR-Gs12a2-5 system to recognize single-base mismatches in non-PFS regions. The target single-stranded RNA (ssRNA) used in this example is the conserved p72 gene of the African swine fever virus (ASFV), with the following sequence:

[0066]

[0067] The bold mark is PFS, and the underline is the targeting sequence. First, PCR amplified the guide RNA containing continuous spacer mutations from positions 1-20, respectively, with crRNA-F as upstream and crRNA-R to crRNA-R-20 primers as downstream to amplify the DNA template of the guide RNA and transcribe it. The primer sequences used in this example are shown in Table 3.

[0068] Table 3. PCR primers for single-base mutation crRNA sequences

[0069]

[0070]

[0071] The single-stranded DNA fluorescence-quenching reporter gene sequence is 5'ROX / GTATCCAGTGCG / 3'BHQ2. First, the Gs12a2-5 endonuclease was expressed and purified in prokaryotic cells. The p72 target RNA was transcribed in vitro. The DNA sequences of the guide RNAs were amplified by PCR and transcribed. The following reaction system was then used: 500 ng of Gs12a2-5 endonuclease, 500 ng of guide RNAs with different base mutations, 2 μL of 10× r3.1 NE Buffer, 0.3 μL of 1 μM single-stranded DNA fluorescence-quenching reporter gene (5'ROX / GTATCCAGTGCG / 3'BHQ2), and 500 ng of target single-stranded RNA. The single-base mismatch recognition ability of the Gs12a2-5 endonuclease was assessed by observing the fluorescence intensity and background noise on a microplate reader under blue light.

[0072] The results are as follows Figure 8 As shown in the figure, compared with the fully matched positive control, the sites with single base mismatches did not completely inhibit the nuclease cleavage activity of Gs12a2-5 endonuclease. This shows that Gs12a2-5 endonuclease is not sensitive to single base mismatches at the target site, and its ability to specifically detect target sites with single base mutations may be weak.

[0073] Example 6. Development of a rapid visualization detection technology for PRRSV nucleic acid mediated by the RPA-CRISPR-Gs12a2-5 system

[0074] This embodiment further develops a rapid visualization detection technology for porcine reproductive and respiratory syndrome virus (PRRSV) nucleic acid based on RPA isothermal amplification combined with CRISPR-Gs12a2-5 system. The general process is to use RT-RPA to amplify the PRRSV coding gene, prepare cDNA, add T7 transcriptase to transcribe it into a single-stranded RNA target, and then use Gs12a2-5 and guide RNA to recognize the target; then stimulate its "trans-cleavage" activity for any single-stranded nucleic acid, thereby cutting the single-stranded DNA fluorescence-quenching reporter gene (ssDNA-FQ) in the reaction system; further, the nucleic acid of porcine reproductive and respiratory syndrome virus is rapidly detected on-site by visualization through the excited fluorescence intensity, background noise and color change of the naked eye ( Figure 9 A).

[0075] The target single-stranded RNA (ssRNA) used in this example is the conserved gene of the M portion of porcine reproductive and respiratory syndrome virus PRRSV, and the sequence is as follows:

[0076] The bold mark is PFS, and the underline is the target sequence. The primer sequences of RPA F: 5'-TAATACGACTCACTATAGGGGCAAGTACATTCTGGCCCCTGCCCACCAC G-3', R: 5'-TTGGCATATTTGACAAGGTTTACCACTC-3'.

[0077] The most active crRNA was screened for the RPA amplification products described above. First, the Gs12a2-5 protein was expressed and purified in prokaryotes, and the crRNAs listed in Table 4 were transcribed in vitro. The following reaction system was then used: 500 ng of Gs12a2-5 endonuclease, 500 ng of each crRNA, 2 μL of 10× r3.1NE Buffer, 0.3 μL of a 1 μM single-stranded DNA fluorescence-quenched reporter gene (5'ROX / GTATCCAGTGCG / 3'BHQ2), and 500 ng of target single-stranded RNA. The optimal crRNA was determined by observing under blue light and accurately interpreting fluorescence intensity and background noise on a microplate reader.

[0078] The results are as follows Figure 9 As shown in B, it was found that the crRNA3-mediated spacer was more conservative and more active, so crRNA3 was selected as the crRNA for subsequent experiments.

[0079] Table 4. crRNA sequences corresponding to PRRSV M genes

[0080]

[0081] To further screen the optimal RPA primers for amplification of the PRRSV M gene, RPA primers were screened according to Table 5. First, the prokaryotic expression and purification of the Gs12a2-5 protein was performed, and crRNA3 was transcribed in vitro. Then, 29.5 μL of Primer Free Rehydration buffer and 2.5 μL of each RPA upstream and downstream primer pair (10 μM) were used, and the mixture was added to 50 μL. After mixing, the mixture was added to the reaction microspheres and mixed. 2.5 μL of MgOAc (280 nM) was added to the tube wall. This was one system, and a total of 12 systems were prepared. The control group did not add the target, and the experimental group added 9.54×10 7 copies / μL, 9.54×10 3 copies / μL, 9.54×10 21 μL of each copy / μL of the plasmid containing the PRRSV M gene. After centrifugation and reaction at 39°C for 25 minutes, take the above 1 μL of RPA amplification product as a template and add the following systems: 1000 ng of Gs12a2-5 nuclease, 300 ng of guide RNA (crRNA3), 2 μL of 10×r3.1 NEBuffer, 0.3 μL of 20 μM single-stranded DNA fluorescence-quenched reporter gene (5'ROX / GTATCCAGTGCG / 3'BHQ2), 0.1 μL each of NTP (A, U, C, G, 100 mM), and 0.15 μL of T7 transcriptase (NEB HiScribe T7 High Yield RNA Synthesis Kit). React at 39°C for 15 minutes. Observe the color change, fluorescence intensity, and background noise under natural light and blue light. The results are as follows: Figure 9 As shown in C, in comparison, the F4+R1 primer pair has the highest amplification efficiency.

[0082] Table 5. RPA primer pairs

[0083]

[0084] To evaluate the sensitivity of the CRISPR-Gs12a2-5 system-mediated rapid visualization detection technology for PRRSV nucleic acid. First, the Gs12a2-5 protein was expressed and purified in prokaryotes, and the guide RNA was transcribed in vitro. Then, 29.5 μL of Primer Free Rehydration buffer and 2.5 μL of RPA upstream and downstream primers (10 μM) were added to 50 μL of water, mixed well, and added to the reaction microspheres. 2.5 μL of MgOAc (280 mM) was added to the tube wall. This was one system, and a total of 8 systems were prepared. The control group did not add the target, and the experimental group added 9.54×10 5 copies / μL、9.54×10 4 copies / μL, 9.54×10 3 copies / μL、9.54×10 2 copies / μL、9.54×10 1 copies / μL、9.54×10 0 copies / μL, 9.54×10 -1 copies / μL, 9.54×10 -21 μL of each plasmid containing the PRRSV M gene was added at 1000 copies / μL. After centrifugation and reaction at 39°C for 25 minutes, 1 μL of the RPA amplification product was used as a template and the following system was added: 1000 ng of Gs12a2-5 endonuclease, 300 ng of guide RNA (crRNA3), 2 μL of 10× r3.1 NEBuffer, 0.3 μL of a 20 μM single-stranded DNA fluorescence-quenched reporter gene (5'ROX / GTATCCAGTGCG / 3'BHQ2), 0.1 μL each of NTPs (A, U, C, G, 100 mM), and 0.15 μL of T7 transcriptase (NEB HiScribe T7 High Yield RNA Synthesis Kit). The reaction was continued at 39°C for 15 minutes. Color changes, fluorescence intensity, and background noise were observed under natural light and blue light.

[0085] The results are as follows Figure 9 As shown in D, the established Gs12a2-5 system-mediated porcine reproductive and respiratory syndrome virus detection technology can achieve a naked eye detection limit of 9.54×10 2 copies / μL, and the detection limit of the enzyme reader can reach 9.54×10 1 copies / μL.

[0086] The specificity of the RPA-CRISPR-Gs12a2-5 detection technology was then evaluated. Primer Free Rehydration buffer (29.5 μL) and 2.5 μL of each RPA upstream and downstream primer (10 μM) were added to 50 μL of water. After mixing, the mixture was added to the reaction microspheres and mixed evenly. 2.5 μL of MgOAc (280 mM) was added to the tube wall. This constituted one system, and a total of six systems were prepared. No target was added to the control group, while 10 ng of TGEV, PDCOV, SADS, CSFV, and PRRSV plasmids were added as templates to the experimental groups. After centrifugation, the reaction was incubated at 39°C for 25 minutes. 1 μL of the RPA amplified product was used as a template and the following system was added: 1000 ng of Gs12a2-5 endonuclease, 300 ng of guide RNA, 2 μL of 10× r3.1 NE Buffer, 0.3 μL of a 20 μM single-stranded DNA fluorescence-quenched reporter gene (5'ROX / GTATCCAGTGCG / 3'BHQ2), 0.1 μL each of 100 mM NTPs (A, U, C, G), and 0.15 μL of T7 transcriptase (NEB HiScribe T7 High Yield RNA Synthesis Kit). The reaction was incubated at 39°C for 15 min. Color change, fluorescence intensity, and background noise were observed under natural light and blue light.

[0087] The results are as follows Figure 9As shown in Figure E, it was found that the RPA-CRISPR-Gs12a2-5 technology can specifically detect PRRSV target nucleic acid, but not target nucleic acids of other viruses. This shows that the RPA-CRISPR-Gs12a2-5 nucleic acid detection technology has good specificity.

Claims

1. Gs12a2-5 endonuclease, characterized in that Includes the following proteins: Ⅰ. Gs12a2-5 protein having the amino acid sequence shown in SEQ ID NO.5; II. A protein having a sequence identity of more than 80% with the amino acid sequence of SEQ ID NO. 5 and substantially retaining the biological function derived from the sequence.

2. A polynucleotide, characterized in that The polynucleotide is a polynucleotide encoding the Gs12a2-5 protein according to claim 1, and its sequence is shown in SEQ ID NO.

10.

3. A carrier, characterized in that The vector comprises the polynucleotide according to claim 2.

4. Use of the Gs12a2-5 endonuclease according to claim 1, or the polynucleotide according to claim 2, or the vector according to claim 3 in nucleic acid detection.

5. A visual nucleic acid detection kit, characterized in that: The invention comprises the Gs12a2-5 nuclease according to claim 1, a single-stranded DNA fluorescence-quenching reporter gene, and a guide RNA paired with a target nucleic acid.

6. The kit according to claim 5, characterized in that The DR sequence of the guide RNA is shown in SEQ ID NO.

11.

7. A kit for visually detecting African swine fever virus nucleic acid, characterized in that: The invention comprises the Gs12a2-5 endonuclease according to claim 1, a single-stranded DNA fluorescence-quenching reporter gene, and a target nucleic acid. p72 The gene-paired guide RNA, the guide RNA sequence is shown in SEQ ID NO.

12.

8. A kit for visually detecting porcine reproductive and respiratory syndrome virus nucleic acid, characterized in that: It comprises an RPA primer pair, the Gs12a2-5 nuclease according to claim 1, a single-stranded DNA fluorescence-quenching reporter gene, and a guide RNA, wherein the primer pair sequences are shown in SEQ ID NO.13 and 14, and the guide RNA sequence is shown in SEQ ID NO.

15.

9. The kit according to claim 7 or 8, characterized in that: The sequence of the single-stranded DNA fluorescence-quenching reporter gene is shown in SEQ ID NO.16.