Hypoxia response promoter element and application thereof

Abstract

The invention provides an anoxia response promoter element and application thereof, and belongs to the technical field of biological medicine. The hypoxia response promoter element disclosed by the invention is obtained by transforming a whole sequence of a 1000bp region of an HAND1 gene promoter into a sequence as shown in SEQ ID NO.10 or SEQ ID NO.11. The hypoxia response promoter element disclosed by the invention is a hypoxia response promoter element disclosed by the invention. According to the invention, the HAND1 gene promoter region is analyzed and modified, and the modified promoter shows stronger transcriptional activation ability under an anoxic condition, and is a powerful tool for transcriptional regulation of engineered cardiac fibroblasts.

Description

Technical Field

[0001] The present invention belongs to the technical field of biomedicine, and in particular relates to a hypoxia-responsive promoter element and an application thereof. Background Art

[0002] Advances in stem cell technology in recent years have made it possible to differentiate in vitro from induced pluripotent stem cells (iPSCs) into the main cell types of human cardiac tissue. iPSC-derived cardiomyocytes, cardiac fibroblasts, endothelial cells, etc. have shown great potential in clinical applications of cardiac repair and regeneration. Cardiac fibroblasts play a key role in maintaining the structure and function of cardiac tissue by producing and secreting extracellular matrix components, participating in interactions with other cardiac cells, and regulating electrophysiological properties. Genetically engineered cardiac fibroblasts can secrete specific peptides or proteins into adjacent tissues to promote cardiac protection and repair after myocardial infarction. However, the hypoxic microenvironment in the infarcted area inhibits the survival and proliferation of transplanted cells, reducing the sustained efficacy of cell therapy. Developing a hypoxia-tolerant cardiac fibroblast that can secrete specific peptides or proteins under hypoxic conditions is a feasible solution to endow exogenous cardiomyocytes with hypoxia resistance.

[0003] Hypoxia response elements (HREs) are a class of DNA sequences located in promoter regions. Under low oxygen conditions, hypoxia-inducible factors (HIFs) can bind to these sequences and initiate expression of downstream genes. Utilizing the properties of HREs and HIFs, cells can specifically overexpress a specific functional protein in hypoxic environments, increasing their survival under hypoxic conditions and thereby enhancing the efficacy of cell therapy. Currently, there are few studies on the identification of HREs or hypoxia-responsive promoters in human induced pluripotent stem cell-derived cardiac fibroblasts (hiPSC-CFs). Summary of the Invention

[0004] By comparing the expression profiles of hiPSC-CFs under hypoxia and normoxia, the present study revealed a series of hypoxia-induced upregulated genes. Among these hypoxia-induced upregulated genes, the HAND1 gene exhibited rapid and robust transcriptional activity under hypoxia.

[0005] The present invention analyzed and modified the HAND1 gene promoter region. Specifically, the modified 1000-bp promoter region exhibited enhanced transcriptional activation under hypoxic conditions, making it a powerful tool for transcriptional regulation in engineered cardiac fibroblasts. The 3219-bp sequence of the HAND1 gene promoter can be found in the NCBI (National Center for Biotechnology Information) database: Homo sapiens chromosome 5, GRCh38.p14.

[0006] A hypoxia-responsive promoter element, the gene sequence of which is shown in SEQ ID NO.13 or SEQ ID NO.14;

[0007] They are obtained by transforming the entire sequence of the 1000 bp region of the HAND1 gene promoter into the sequence shown in SEQ ID NO.11 or SEQ ID NO.12;

[0008] The 3219 bp sequence of the HAND1 gene promoter is shown in SEQ ID NO. 8;

[0009] The sequence of the 1000 bp region of the HAND1 gene promoter is shown in SEQ ID NO.9.

[0010] This study used transcriptome sequencing technology to compare the expression profiles of hiPSC-CFs under hypoxia and normoxia, revealing a series of genes upregulated by hypoxia. Among them, the HAND1 gene has the following characteristics:

[0011] (1) Expression begins to increase 2 hours after hypoxia;

[0012] (2) expression continued to increase from 2 to 72 hours of hypoxia;

[0013] (3) It is hardly expressed or expressed at a very low level in a normoxic environment.

[0014] (4) The promoter region contains HRE elements.

[0015] Specifically, the present invention analyzed the 3219bp region of the HAND1 gene promoter. The results of the dual luciferase experiment showed that hiPSC-CFs carrying the 1000bp promoter region exhibited the strongest relative luciferase activity (17.55 times). The 1000bp promoter region may be the core response region of the hypoxia response within the HAND1 promoter.

[0016] Therefore, the 1000bp promoter region of the HAND1 gene was modified. The modification information is as follows:

[0017]

[0018]

[0019]

[0020]

[0021] The results of the dual luciferase assay showed that the relative fluorescence units (RLU) of the mutant promoter region decreased by 59.6% compared with the wild-type 1000bp region, indicating that the sequence from -481 to -476 is one of the key HRE elements. Further experiments showed that the transcriptional activity of the 1K-4HRE and 1K-4HRE-TA regions were stronger than that of the wild-type 1000bp region, increasing by 2.03 times and 1.96 times, respectively. However, compared with the 1K-4HRE region, the addition of the TATA box did not significantly enhance the transcriptional activity of the 1K-4HRE-TA region. In summary, 1K-4HRE has significant application potential as a hypoxia-responsive promoter for hiPSC-CFs. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 The preparation and identification results of hiPSC-CFs in Example 1;

[0023] Figure 2 The identification results of hypoxia-responsive genes in hiPSC-CFs in Example 2;

[0024] Figure 3 The core region of the hypoxia response in the HAND1 promoter was confirmed in Example 3;

[0025] Figure 4 The following are the results of the dual-luciferase assay and the construction of engineered hiPSC-CFs containing the hypoxia promoter (EHP) in Example 4. DETAILED DESCRIPTION

[0026] In order to make the technical problems, technical solutions and advantages to be solved by the present invention clearer, a detailed description will be given below with reference to specific embodiments.

[0027] Example 1: Preparation and identification of hiPSC-CFs

[0028] Preparation of hiPSC-CFs. Differentiation of hiPSC-CFs was performed using the method described in the article "Fabrication of 3DCardiac Microtissue Arrays using Human iPSC-Derived Cardiomyocytes, Cardiac Fibroblasts, and Endothelial Cells" published by Dr. Joseph Wu's laboratory. Figure 1 a). Human induced pluripotent stem cells DYR0100 (ATCC) were seeded on Matrigel-coated culture plates (Corning, 356234) and cultured using StemFlex TM Culture medium (Gibco, A3349401). When the cell confluence reached 90%–95%, they were treated with differentiation medium #1 supplemented with 11 μM CHIR99021 (Tocris, 4423) for 3 days, where differentiation medium #1 consists of RPMI 1640 (Gibco, C11875500BT) + B27 supplement (Gibco, 17504-044). On day 3 of differentiation, 2 mL of differentiation medium #1 containing 5 μM IWR-1-endo (Selleck, S7086) was added to the culture medium to promote the expansion of cardiac progenitor cells. Starting from day 4 of differentiation, the culture medium was changed to cardiac fibroblast differentiation medium (ScienCell, 2331) and changed every 2 days until re-plating. On day 18, the cells were trypsinized and plated at 6×104 cells / cm 2 The cells were re-plated on 0.2% gelatin-coated culture plates at a density of 1.54 μg / cm2 and maintained in culture using DMEM medium containing 10% fetal bovine serum (Excell, FSP500).

[0029] Immunofluorescence identification of hiPSC-CFs. hiPSC-CFs were fixed with 4% formaldehyde for 20 minutes at room temperature and washed three times with PBS. Subsequently, the cells were permeabilized with 0.25% Triton X-100 for 10 minutes at room temperature. After blocking with 10% goat serum, the primary antibody (Anti-Vimentin antibody, Abcam, ab92547) was added and incubated overnight at 4°C. After washing three times with PBS containing 0.1% Triton X-100, the secondary antibody (Alexa Fluor555goat anti rabbit, Invitrogen, A-21428) was added and incubated in the dark at 37°C for 60 minutes. Finally, the cell nuclei were stained with Hoechst 33342 (Beyotime, C1022) for 10 minutes. Fluorescent images were taken using an inverted fluorescence microscope (Mshot, MF52-N).

[0030] Flow cytometry identification of hiPSC-CFs. hiPSC-CFs were seeded at 2×10 5 The cells were seeded into 6-well plates at a density of 100 cells / well and cultured for 48 hours. After trypsinization, the cells were washed twice with pre-cooled cell staining buffer (BioLegend, 420201) and stained with 5 μL human TrueStain FcX TM Cells were preincubated with PE anti-Vimentin (BioLegend, 422301) and then stained with PE anti-Vimentin (BioLegend, 699309), APC anti-human CD45 (BioLegend, 304012), or FITC anti-human CD31 (BioLegend, 303104). Samples were incubated in the dark at room temperature for 15 minutes and then washed with pre-chilled cell staining buffer. Flow cytometry analysis was performed using a NovoCyte D2040R (Agilent).

[0031] HiPSC-CFs hypoxia tolerance test: A hypoxic incubator (ESCO) was used to simulate a hypoxic environment with the following parameters: 1% oxygen, 5% carbon dioxide, and 94% nitrogen. hiPSC-CFs were cultured at 8×10 3 Cells were seeded at a density of 100 μL per well in 96-well plates, with 200 μL of culture medium per well. After 24 hours of incubation, cells were cultured under normoxic or hypoxic conditions. Cell viability was measured at various time points (2 hours, 6 hours, 24 hours, 72 hours, and 7 days) according to the instructions of the CCK-8 kit (Beyotime, C0037).

[0032] Result analysis: The morphology of hiPSC-CFs was fibroblast-like ( Figure 1 b). Immunofluorescence and flow cytometry results showed that more than 98% of cells expressed the fibroblast marker (Vimentin) ( Figure 1 d, 1e), and no immune cells (CD45+) or endothelial cells (CD31+) were detected ( Figure 1 d). The results of the cell activity experiment showed that the cell activity of hiPSC-CFs decreased steadily during the 7-day hypoxic culture period ( Figure 1 c) Furthermore, hiPSC-CFs exhibited a certain degree of hypoxia tolerance during the first three days of hypoxic culture, with cell viability after 72 hours of hypoxia only 37.1% lower than that after 2 hours of hypoxia. Furthermore, hiPSC-CFs cultured under hypoxic conditions for 7 days still exhibited a relative viability of 24.1%.

[0033] Example 2: Identification of hypoxia-responsive genes in hiPSC-CFs

[0034] 1. Cell Sample Preparation: hiPSC-CFs cultured in 6-well plates were placed under normoxic (21% oxygen, 5% carbon dioxide, 74% nitrogen) or hypoxic (1% oxygen, 5% carbon dioxide, 94% nitrogen) conditions. Cells were harvested at different time points (2, 6, 24, and 72 hours), and total RNA was extracted using the EZ-10 Total RNA Extraction Kit (BBI, B618583-0100).

[0035] 2. Sequencing and Analysis: RNA sequencing was performed by Novogene Co., Ltd., with three biological replicates per group. 150-bp paired-end sequencing was performed using the Illumina sequencing platform. Adapter sequences and low-quality bases were removed using the Trim Galore tool, and gene expression levels were quantified using Kallisto and the GENCODE database (v32). Differentially expressed genes (DEGs) were identified using DESeq2, with a false discovery rate (FDR) of <0.05 and a |log2(FoldChange)| of >1 as the screening threshold. Functional annotation and enrichment analysis of differentially expressed genes were performed using the ToppFun tool.

[0036] 3. Result analysis: Sequencing results showed that genes related to cellular respiration were significantly enriched in down-regulated genes. Genes related to synaptic signaling were significantly enriched in up-regulated genes ( Figure 2 a, 2b). Upregulated genes were screened according to the following criteria: (1) expression began to increase at 2 h of hypoxia; (2) expression continued to increase from 2 h to 72 h of hypoxia; (3) genes were ranked in descending order based on the fold change in expression after 72 h of hypoxia. Figure 2 c shows the top 20 upregulated genes that respond most rapidly to hypoxia. Among them, the expression level of HAND1 (Heart and Neural Crest Derivatives Expressed 1) increased over 30-fold within 6 hours of hypoxia. Analysis suggests that the promoter region of the HAND1 gene could serve as a candidate sequence for development as a gene regulatory element for hypoxia.

[0037] Example 3: Core region of hypoxia response in the HAND1 promoter

[0038] 1. Synthesize the 3219 bp sequence upstream of the start codon of the HAND1 gene ( Figure 3a) The HAND1 promoter sequence region (500, 1000, 1500, 2000, 2500, and 3219 bp) was divided into six different lengths and cloned into the Firefly luciferase reporter vector PGL6-TA (beyotime, D2105) by PCR. The synthetic sequence was synthesized by Beijing Qingke Biotechnology Co., Ltd. The primer sequences are as follows:

[0039]

[0040]

[0041] 2. Using 4D-Nucleofector TM hiPSC-CFs were electroporated using X-cell (Lonza). TM According to the optimized protocol of X kit S (Lonza, V4XP-3032), 0.5 μg Firefly luciferase reporter vector and 0.5 μg Renilla luciferase reporter vector pRLTK (Beyotime, D2760) were mixed with 1×10 5 Each hiPSC-CFs cell was suspended in 20 μL electroporation buffer. After electroporation, the hiPSC-CFs were transferred to a 6-well plate. After 48 hours of inoculation, the cells were cultured under normoxic or hypoxic conditions. After 24 hours of culture, the cells were lysed using cell lysis buffer (Beyotime, RG126S) and the cells were visualized using Dual-Lumi TM The activities of two luciferases were detected using the Firefly II Dual-Luciferase Reporter Gene Assay Kit (Beyotime, RG089S). PRL-TK served as an internal control reporter gene. Each experiment was repeated four times, and the results are expressed as the ratio of firefly luciferase activity to Renilla luciferase activity.

[0042] 3. Result analysis: The results of the dual-luciferase reporter assay showed that hiPSC-CFs carrying the 1000bp promoter region exhibited the strongest relative luciferase activity (17.55 times, Figure 3 b). HiPSC-CFs carrying other promoter regions showed lower relative luciferase activity (500 bp region, 4.92-fold; 1500 bp region, 7.80-fold; 2000 bp region, 6.51-fold; 2500 bp region, 8.28-fold; and 3219 bp region, 5.65-fold). These results suggest that the 1000 bp region may be the core hypoxia-responsive region within the HAND1 promoter.

[0043] Example 4: Construction of engineered hiPSC-CFs containing hypoxia promoter (EHP)

[0044] 1. Based on the above research, we selected the core hypoxia response region of the HAND1 gene promoter region (1000 bp) for research and optimization. The JASPAR database was used to predict the potential binding sites for HIF1A within the 1000 bp region ( Figure 4 a) The first base upstream of the start codon was designated as position -1, and the sequence from positions -481 to -476 was identified as a predicted HIF1A binding site (orientation: parallel). To verify this prediction, we mutated this candidate binding site from "GTACGT" to "TGCGAC" within a 1000 bp region.

[0045] 2. Modify this 1000 bp region to enhance its transcriptional activity. Two constructs were generated: (1) a sequence containing four copies of "AAGCACGTAG" replacing the region from -483 to -474 ( Figure 4 b); (2) Based on (1), the region from -39 to -34 was replaced by the TATAbox sequence ("TATATATA"). Figure 4 c). The two constructs were named "1K-4HRE" and "1K-4HRE-TA", respectively.

[0046] 3. The mutant (Mut) sequence, 1K-4HRE sequence, and 1K-4HRE-TA sequence were synthesized by Beijing Qingke Biotechnology Co., Ltd. and cloned into the Firefly luciferase reporter vector PGL6-TA (beyotime, D2105) by PCR.

[0047] 3219 bp sequence of HAND1 gene promoter region:

[0048]

[0049] 1000 bp region of the wild-type HAND1 gene promoter before modification:

[0050] TGCCCGTGGGCCTGGAGTCCGCCTCCTCCTTCCCGCCCCACCCCTACCCCTGCCTCCGAAAGGCTTCTTCGCTGGTCAGTAGCTGCGTGCCCGTCTGCCTGAGGCTGGGTCAGAATTGGCGGGCTGGTAACGACCCCGTGCACAAGCGGCTCCCAGTCTCTCCAGAAAGGGCCGATGACTAAGGGGTGGGGGTGGGGGCGGAGGGCTGGAAGGTGTTAGGGAAGAACGTTAGCGGCCTATCCTGTCTTCAGCAGCGCCCTCTCATCTTCTAGCTCTGACGCCGAGCAGAGCAGTTGGAGCTCGGGACTGGGAACTGCTGGAATTCCTATTTAGACTTCTAGACAGTCTAGAAACAAGAACCTTTCTTTCCCTGGGCCTCAGTTTCCTTGTCTGTAAAATCAAAAGGCGGGCTCTAGGTGTAGGCCTTCTTTTCGCTTGGTGATTCTGGATTCCTTTCCTTGGATCCGTGGGGAGGGGGTGGCAGCAACAGTCCAGGGCGTTGGCCGTCCTGTGCCTCAA GTACG TAGTCCCCGTGCCCGCCCCCTCAACACCCCCAGCAGCCCGCCCCCCTAAGCCCGCAGAGCAGGGAGCTGAGTGGGAGGGGCAGAGGCGGGGCCGGTTCCCAGTCCCTGCTGGCGGACTAGAGTGGCGCGGGCTGAGCGTAAAACCTGGGATAGCCACTCCCCCTTTTCCTTATCCCCGCCCCCCTGCCATTGGCTCCCGGGAGAGGTTGACATCAAAGCCGCGGTCTTATATAAGCCAGATCCGCAGGGGAGTCCGCAGAAGGGTTAAACAGGTCTTTGGGCTTCGGCGACCTCGCCCGCGGCAGAAACCGGTAAGAAGACAGTGGGCTGCGCGTCTCATTTTCAGCCTTGCCCGGACTCTCCCAAAGCCGGCGCCCAGTAGTGGCTCCAGAGCCCACAGGTGGCCCCCGGCAGTCTCTGGGGCGCATGGAGCGGCGTTAATAGGGCTGGCGGCGCAGGCCAGTAGCCGCTCCAAC(SEQ ID NO.9)

[0051] Mutated (Mut) sequence

[0052]

[0053] 1K-4HRE sequence

[0054]

[0055] 1K-4HRE-TA sequence

[0056]

[0057] Modified HAND1 gene promoter 1:

[0058] TGCCCGTGGGCCTGGAGTCCGCCTCCTCCTTCCCGCCCCACCCCTACCCCTGC CTCCGAAAGGCTTCTTCGCTGGTCAGTAGCTGCGTGCCCGTCTGCCTGAGGCTGGGTCAGAATTGGCGGGCTGGTA ACGACCCCGTGCACAAGCGGCTCCCAGTCTCTCCAGAAAGGGCCGATGACTAAGGGGTGGGGGTGGGGGCGGAGGG CTGGAAGGTGTTAGGGAAGAACGTTAGCGGCCTATCCTGTCTTCAGCAGCGCCCTCTCATCTTCTAGCTCTGACGC CGAGCAGAGCAGTTGGAGCTCGGGACTGGGAACTGCTGGAATTCCTATTTAGACTTCTAGACAGTCTAGAAACAAG [[ID= ​ ​ ​ ​ ​ ​ CTCATTTTCAGCCTTGCCCGGACTCTCCCAAAGCCGGCGCCCAGTAGTGGCTCCAGAGCCCACAGGTGGCCCCCGG CAGTCTCTGGGGCGCATGGAGCGGCGTTAATAGGGCTGGCGGCGCAGGCCAGTAGCCGCTCCAAC (SEQ ID NO.13).

[0059] Modified HAND1 gene promoter 2:

[0060] TGCCCGTGGGCCTGGAGTCCGCCTCCTCCTTCCCGCCCCACCCCTACCCCTGC CTCCGAAAGGCTTCTTCGCTGGTCAGTAGCTGCGTGCCCGTCTGCCTGAGGCTGGGTCAGAATTGGCGGGCTGGTA ACGACCCCGTGCACAAGCGGCTCCCAGTCTCTCCAGAAAGGGCCGATGACTAAGGGGTGGGGGTGGGGGCGGAGGG CTGGAAGGTGTTAGGGAAGAACGTTAGCGGCCTATCCTGTCTTCAGCAGCGCCCTCTCATCTTCTAGCTCTGACGC CGAGCAGAGCAGTTGGAGCTCGGGACTGGGAACTGCTGGAATTCCTATTTAGACTTCTAGACAGTCTAGAAACAAG AACCTTTCTTTCCCTGGGCCTCAGTTTCCTTGTCTGTAAAATCAAAAGGCGGGCTCTAGGTGTAGGCCTTCTTTTC GCTTGGTGATTCTGGATTCCTTTCCTTGGATCCGTGGGGAGGGGGTGGCAGCAACAGTCCAGGGCGTTGGCCGTCC TGTGCCTCAAGCACGTAGAAGCACGTAGAAGCACGTAGAAGCACGTAGTCCCCGTGCCCGCCCCCTCAACACCCCC AGCAGCCCGCCCCCCTAAGCCCGCAGAGCAGGGAGCTGAGTGGGAGGGGCAGAGGCGGGGCCGGTTCCCAGTCCCT GCTGGCGGACTAGAGTGGCGCGGGCTGAGCGTAAAACCTGGGATAGCCACTCCCCCTTTTCCTTATCCCCGCCCCC CTGCCATTGGCTCCCGGGAGAGGTTGACATCAAAGCCGCGGTCTTATATAAGCCAGATCCGCAGGGGAGTCCGCAG AAGGGTTAAACAGGTCTTTGGGCTTCGGCGACCTCGCCCGCGGCAGAAACCGGTAAGAAGACAGTGGGCTGCGCGT CTCATTTTCAGCCTTGCCCGGACTCTCCCAAAGCCGGCGCCCAGTAGTGGCTCCAGAGCCCACAGGTGGCCCCCGG CAGTCTCTGGGGCGCATGGAGCGGCGTATATATAGGGCTGGCGGCGCAGGCCAGTAGCCGCTCCAAC (SEQ ID NO. 14)

[0061] 4. Using 4D-Nucleofector TM hiPSC-CFs were electroporated using X-cell (Lonza). TM According to the optimized protocol of X kit S (Lonza, V4XP-3032), 0.5 μg of these Firefly luciferase reporter vectors and 0.5 μg of Renilla luciferase reporter vector pRLTK (Beyotime, D2760) were mixed with 1×10 5 Each hiPSC-CFs cell was suspended in 20 μL electroporation buffer. After electroporation, the hiPSC-CFs were transferred to a 6-well plate. After 48 hours of inoculation, the cells were cultured under normoxic or hypoxic conditions. After 24 hours of culture, the cells were lysed using cell lysis buffer (Beyotime, RG126S, Shanghai, China) and the cells were visualized using Dual-Lumi TM The activities of two luciferases were detected using the Firefly II Dual-Luciferase Reporter Gene Assay Kit (Beyotime, RG089S). PRL-TK served as an internal control reporter gene. Each experiment was repeated four times, and the results are expressed as the ratio of firefly luciferase activity to Renilla luciferase activity.

[0062] 5. Result analysis: The results of the dual luciferase reporter assay showed that the relative fluorescence unit (RLU) of the mutant promoter region decreased by more than half compared with the wild-type 1000bp region, reaching 59.6% ( Figure 4 d), indicating that the sequence from -481 to -476 is one of the key hypoxia response elements (HRE). The transcriptional activity of the 1K-4HRE and 1K-4HRE-TA regions was stronger than that of the wild-type 1000bp region, increasing by 2.03 times and 1.96 times, respectively. However, compared with the 1K-4HRE region, the addition of the TATA box did not significantly enhance the transcriptional activity of the 1K-4HRE-TA region ( Figure 4e). Based on the above experimental results, the modified HAND1 gene promoter carrying 1K-4HRE and 1K-4HRE-TA has significant application potential as a hypoxia-responsive promoter for hiPSC-CFs.

[0063] The above is a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principles of the present invention. These improvements and modifications should also be regarded as within the scope of protection of the present invention.

Claims

1. A hypoxia-responsive promoter element, characterized in that Its gene sequence is shown as SEQ ID NO.13 or SEQ ID NO.

14.

2. The method for modifying a hypoxia-responsive promoter element according to claim 1, wherein: The steps include: (1) Based on the 1000 bp region of the HAND1 gene promoter, the sequence at position -481 to -476 was mutated from "GTACGT" to "TGCGAC"; (2) Continue to replace the region from position -483 to -474 with four consecutive "AAGCACGTAG" to obtain a promoter containing the sequence shown in SEQ ID NO.

11.

3. The method for modifying a hypoxia-responsive promoter element according to claim 2, wherein: Also includes step (3): The sequence "TTAATA" in the region from position -39 to -34 in the sequence shown in SEQ ID NO. 11 was further replaced with the TATA box sequence "TATATATA" to obtain a promoter comprising the sequence shown in SEQ ID NO.

12.

4. Use of the hypoxia-responsive promoter element according to claim 1 in constructing hypoxia-tolerant cells.

5. The use according to claim 4, characterized in that Hypoxia-tolerant cells have stronger transcriptional activation ability under hypoxic conditions.

6. The use according to claim 4, characterized in that The cells are cardiac fibroblasts.

7. A hypoxia-tolerant cell, characterized in that: Contains the hypoxia-responsive promoter element as claimed in claim 1.

8. The hypoxia-tolerant cell according to claim 7, wherein The cells are cardiac fibroblasts.

9. Use of the hypoxia-tolerant cells according to claim 8 in the preparation of a drug for protecting and repairing the heart after myocardial infarction.

10. A drug for protecting and repairing the heart after myocardial infarction, characterized in that: The method comprises the hypoxia-tolerant cell according to claim 8.

Images