Novel annular RNAcircPlekha5 and application thereof
By screening and interfering with human circular RNA circPlekha5, using AAV2/5 viral vector injection, the addictive craving behavior and abnormal hippocampal neuron plasticity in methamphetamine addiction were alleviated, and the unknown function of circular RNA in methamphetamine addiction was solved, achieving effective therapeutic effects.
Patent Information
- Application Number
- CN202510574443.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-05-06
- Publication Date
- 2025-08-05
AI Technical Summary
The specific function and role of circular RNA in methamphetamine addiction in the prior art is unclear, and it is difficult to effectively improve addictive craving behavior and synaptic plastic damage caused by drug addiction.
Human homologous circular RNA circPlekha5 was screened out, and its interfering sequence was packaged as a CMV-DIO-U6-MCS-WPRE plasmid. It was injected through AAV2/5 virus as a vector to interfere with circPlekha5 to alleviate methamphetamine addictive behavior.
The interfering sequence of circular RNA circPlekha5 can effectively alleviate the addictive craving behavior of methamphetamine-addicted mice, improve abnormal structural and functional plasticity of hippocampal neurons, and has potential effects on the treatment and prevention of methamphetamine addiction.
Smart Images

Figure CN120424930A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the fields of neurological diseases and nucleic acid drugs, and in particular to a novel circular RNA circPlekha5, and provides an application thereof in improving drug addiction memory and drug craving. Background Art
[0002] Methamphetamine (METH) addiction is a chronic, relapsing brain disorder. Repeated abuse severely harms physical health and social stability, and is a major medical and social problem. Numerous studies have shown that METH addiction is closely related to drug-induced formation of addictive memories in brain regions such as the hippocampus, prefrontal cortex, striatum, and amygdala. Recent research has focused on elucidating the key brain regions involved in the formation of addictive memories, with the molecular mechanisms underlying specific neuronal circuit associations being a research hotspot. Therefore, exploring the key brain regions and neuronal circuit-specific molecular mechanisms underlying addictive memories is crucial for revealing the neural basis of drug addiction memories and guiding the prevention and treatment of drug addiction.
[0003] Circular RNAs (circRNAs) are a novel class of noncoding RNAs that play crucial roles in neurodevelopment, synaptic plasticity, and neurological diseases. Their specificity, stability, and evolutionary conservation make them promising biomarkers. Although circRNAs have been implicated in a variety of neurological diseases, their biological functions in drug addiction have only recently been partially revealed: ① differential alterations in circRNA expression profiles in the nucleus accumbens of addicted mice were predicted; ② detection of the opioid receptor-associated circOprm1 was derived; ③ circRNAs play a role in METH-induced neuronal injury; and ④ circRNAs participate in ATG5-mediated autophagy blockade during endothelial-to-mesenchymal transition and contribute to blood-brain barrier damage (Dong et al., 2023; R. Huang et al., 2017; Yang et al., 2018). However, their specific functions and potential roles remain unclear.
[0004] Related studies have found that circular RNA is differentially expressed in addiction, but the types, specific functions and effects of circular RNA still need to be further explored. Summary of the Invention
[0005] The purpose of the present invention is to provide a new circular RNA circPlekha5 based on the existing technology, which can be used to prepare drugs for improving addictive craving behavior and synaptic plasticity damage caused by drug addiction, including but not limited to circular RNA vaccines, nucleic acid drugs, plasmid packaging and transfection, etc.
[0006] The human homologous circular RNA circPleha5 screened by this invention can be used as a biomarker for methamphetamine addiction. Furthermore, the circPlekha5 interference sequence, packaged as a CMV-DIO-U6-MCS-WPRE plasmid and injected via AAV2 / 5 virus as a vector, can effectively alleviate methamphetamine addiction. Therefore, this circRNA interference sequence can serve as a potential key molecule for the treatment of methamphetamine addiction.
[0007] The technical solutions of the present invention are as follows:
[0008] The first object of the present invention is to provide circular RNA circPlekha5, the nucleotide sequence of which is shown in SEQ ID NO.1:
[0009] CCACAATGAAAGGAAAGTGACCTGCAAGCATCCGGTTACAGGACAGCCATCCCAAGACAACTGTATCTTTGTTGTGAATGATCAGACTGTTGCAACCATGACGTCCGAAGACAAGAAGGAACGACCCATAAGTATGATAAATGAAGCTTCCAATTACAACATGGCTTCAGATTATGCAGTGCATCCCATGAG CCCTGTGGGCAGGACCTCGCGGCCTCCAAAAAGGTTCATAATTTTGGGAAAAGGTCCAATTCAATTAAAAGGAACCCTAATGCACCTGTGGTCCGGCGTGGCTGGCTGTATAAGCAGGACAGCACCGGCATGAAGCTGTGGAAGAAGCGCTGGTTTGTGCTCTCTGACCTTTGCCTTTTCTATTACCGAG.
[0010] The second object of the present invention is to provide an interference vector of circular RNA circPlekha5.
[0011] Furthermore, the interference sequence shcircPlekha5 of the circular RNA circPlekha5 was connected to the basic vector. The nucleotide sequence of the interference sequence shcircPlekha5 of the interference vector is shown in SEQ ID NO.2:
[0012] GACAGCCATCCCAAGACAACTTTCAAGAGAAGTTGTCTTGGGATGGCTGTC.
[0013] Furthermore, the basic vector of the interference vector is AAV virus; the AAV virus serotype is AAV9 or AAV2 / 5 virus;
[0014] Preferably, the plasmid having the package sequence is a commercial viral expression vector, such as the vectors provided by BioVector: pBGN-ShRNA1, pBGN-ShRNA2, pBGN-ShRNA3, pBGN-ShRNA4, etc.
[0015] Furthermore, the basic vector of the interference vector is a plasmid with a U6 promoter packaged by an AAV virus. Preferably, the plasmid with a U6 promoter is selected from CMV-DIO-U6-MCS-WPRE or commercial vectors provided by Qingke Bio: pLVX-shRNA2-EF1a-ZsGreen-Puro, pLVX-shRNA2-mcherry-Puro, etc.
[0016] The nucleotide sequence of the CMV-DIO-U6-MCS-WPRE is shown in SEQ ID NO.4:
[0017]
[0018] The interference sequence shcircPlekha5 shown in SEQ ID NO.2 was connected between the U6 promoter sequence and the WPRE element site of the CMV-DIO-U6-MCS-WPRE vector to construct it.
[0019] In a particular embodiment, the interference vector further includes operations such as adding a polyA tail.
[0020] In a particular embodiment, the interference vector constructed is named
[0021] rAAV-CMV-DIO-(EGFP-U6)-shRNA1(circ_0013144)-WPRE-hGH polyA, the nucleotide sequence is shown in SEQ ID NO. 3:
[0022]
[0023] In SEQ ID NO.3, the CACgg before the interference sequence shcircPlekha5 shown in SEQ ID NO.2 is an Agel restriction site. When shRNA is expressed in vivo with the AAV virus, Agel recognizes this site and releases shRNA; and the end of the interference sequence shcircPlekha5 shown in SEQ ID NO.2 is connected to TTTTT, which is a polyⅢ transcription terminator.
[0024] The third object of the present invention is to provide a pharmaceutical composition for treating methamphetamine addiction, wherein the pharmaceutical composition comprises an interference vector of the aforementioned circular RNA circPlekha5.
[0025] Furthermore, the pharmaceutical composition also includes a pharmaceutically acceptable carrier or excipient.
[0026] A fourth object of the present invention is to provide the use of the aforementioned circular RNA circPlekha5 as a marker in the preparation of products for diagnosing nerve damage type diseases and / or methamphetamine addiction.
[0027] A fifth object of the present invention is to provide a method for detecting the aforementioned circular RNA circPlekha5 in the preparation of a product for diagnosing nerve damage type diseases and / or methamphetamine addiction.
[0028] The sixth object of the present invention is to provide the use of the aforementioned circular RNA circPlekha5 interference vector or the aforementioned pharmaceutical composition in the preparation of a drug for treating nerve damage type diseases and / or methamphetamine addiction.
[0029] In a particular embodiment, the neurological damage type disease is tauopathy, dementia, in particular Alzheimer's disease.
[0030] The AAV delivery system can be used to deliver the above-mentioned nucleic acid construct into cells, or to the lesion site, to regulate the expression of relevant genes such as circPlekha5 in relevant cells or tissues, thereby achieving the purpose of treatment.
[0031] The beneficial effects of the technical solution of the present invention are:
[0032] The present invention discloses the use of the circular RNA circPlekha5, specifically as a diagnostic marker for methamphetamine addiction, and the use of an interfering sequence or interfering vector of the circular RNA circPlekha5 in the preparation of therapeutics for or prevention of addictive craving and relapse. Interfering with circPlekha5 can improve addictive craving behavior and alleviate abnormalities in the structural and functional plasticity of hippocampal neurons in methamphetamine-addicted mice. This suggests that interfering with circPlekha5 has potential therapeutic and preventive effects on addictive craving and relapse caused by new synthetic amphetamine-like drugs and other addictive drugs. BRIEF DESCRIPTION OF THE DRAWINGS
[0033] Figure 1 This is a heat map of the expression differences of high-throughput circRNA sequencing results in hippocampal tissues of mice in the control group and methamphetamine group;
[0034] Figure 2 A is the statistical diagram of differentially expressed genes verified by qPCR;
[0035] Figure 2 B is the gene tree analysis diagram of mouse differential circular RNA and human differential RNA;
[0036] Figure 2 C is a sequence alignment diagram of mouse differential circular RNA and human differential RNA;
[0037] Figure 3 A is a schematic diagram of the circular RNA circPlekha5 structure;
[0038] Figure 3 B is the fluorescence in situ hybridization photos and statistical graphs of circular RNA circPlekha5 in HT-22 cell lines and BV2 cell lines;
[0039] Figure 3 C is the co-localization photo of circular RNA circPlekha5 and neuronal marker (NeuN) in the hippocampus of the control group and methamphetamine group by fluorescence in situ hybridization and immunofluorescence;
[0040] Figure 3 D is the co-localization photo of circular RNA circPlekha5 and microglial marker (Iba1) in the hippocampus of the control group and methamphetamine group by fluorescence in situ hybridization and immunofluorescence;
[0041] Figure 4 A is a schematic diagram of the brain area injected with AAV virus;
[0042] Figure 4B is the statistical graph of circPlekha5 expression and Plekha5 gene expression in the CA1 brain region of the hippocampus of mice injected with AAV-shcircRNA(Plekha5)-EGFP and AAV-shcircRNA(scramble)-EGFP viruses;
[0043] Figure 4 C is a statistical graph showing the scores of conditioned place preference behavior in mice injected with AAV-shcircRNA(Plekha5)-EGFP and AAV-shcircRNA(scramble)-EGFP viruses in the saline group and after methamphetamine treatment;
[0044] Figure 5 This is the rAAV-CMV-DIO-(EGFP-U6)-shRNA1(circ_0013144)-WPRE-hGH polyA plasmid map;
[0045] Figure 6 Screening and validation of differentially expressed circular RNAs in METH-addicted patients, including:
[0046] Figure 6 A is a flowchart for screening differential circular RNA in human serum;
[0047] Figure 6 B is the craving scale assessment for HCs and DAs. HCs: N = 11; DAs: N = 17. *** P < 0.001 vs. DAs group, unpaired t test;
[0048] Figure 6 C Left panel, KEGG pathway enrichment of the top 50 differentially expressed genes between HCs and DAs; Right panel, screening results of circular RNAs related to addiction pathways; N=6 upregulated genes, N=6 downregulated genes;
[0049] Figure 6 D. Validation of circular RNA in human serum. HCs: N = 3-4 individuals; DAs: N = 3-5 individuals. ** P < 0.01 vs. DAs group; * P < 0.05 vs. DAs group, unpaired t test;
[0050] Figure 7 Correlation analysis of circPlekha5 and its role in the addiction craving scale and serum ROC curve, among which:
[0051] Figure 7 A is the expression level of CircPlekha5 in serum and its R value compared with the addiction craving degree 2=0.5613HCs: N=11;DAs: N=17;
[0052] Figure 7 B is the area under the ROC curve calculation of circPlekha5, N = 8 people; DAs: N = 8 people, AUC = 0.73438, P < 0.001. DETAILED DESCRIPTION
[0053] The detection method of the present invention is further illustrated by the following examples, but these examples do not constitute any limitation to the present invention.
[0054] The circPlekha5 described in the present invention refers to murine mmu_circ_0013144 and human has_circ_0006611. The nucleotide sequences of their interfering sequences, shcircPlekha5, are shown in SEQ ID NO. 2.
[0055] HCs is the abbreviation of Healthy Cares, which means healthy control group;
[0056] DAs is the abbreviation of Drug Abusers, which means drug addicts.
[0057] Example 1 Screening and Detection Analysis of Circular RNA circPlkeha5
[0058] Experimental methods:
[0059] 1. C57BL6 mice were selected to establish a methamphetamine-induced conditioned place preference (CPP) model.
[0060] Eight-week-old mice were divided into a saline group and a methamphetamine (METH) group. The METH group received alternating intraperitoneal injections of 2 mg / kg METH solution and saline solution every other day, each paired with a different environment to induce contextual memory for that specific environment. After eight days of repeated injections, mice were tested for preference for the METH-addicted environment to determine whether addictive memory had formed.
[0061] 2. Obtaining hippocampal tissue from control and addiction groups
[0062] (1) Experimental preparation: Soak surgical scissors and forceps in DEPC water overnight and sterilize them in an autoclave. Prepare PBS prepared with DEPC water and pre-cool it in a refrigerator at 4°C. Prepare nuclease-free consumables.
[0063] (2) After successful modeling, mice were anesthetized with 5% isoflurane and decapitated. The intact brain was removed and rinsed with ice-cold PBS. The cortex was gently peeled off with fine forceps, and the bilateral hippocampal regions were removed. The brains were placed in enzyme-free cryovials, quickly frozen in liquid nitrogen, and transported on dry ice.
[0064] 3. High-throughput sequencing analysis of circular RNA
[0065] (1) The system obtains the original files of the circular RNA high-throughput chip;
[0066] (2) The system performs quality control on the original signal files of the circular RNA high-throughput chip and eliminates low-quality signal data to obtain filtered signal data;
[0067] (3) The system corrects the foreground and background values of the filtered data to obtain circular RNA signal data that eliminates noise pollution;
[0068] (4) The system normalizes the corrected signal data and removes extreme values to obtain theoretically valid circular RNA expression values;
[0069] (5) Systematically screen for differentially expressed genes based on circular RNA expression profiles;
[0070] (6) The system performs co-expression analysis on the differential expression data of circular RNAs and genes, and predicts small RNA binding sites on circular RNA sequences;
[0071] (7) The system predicts the target genes of small RNAs that can bind to circular RNAs and performs functional annotation and enrichment analysis on co-expressed genes;
[0072] (8) Systematically construct a regulatory network for circular RNA as a competitive endogenous RNA function and systematically construct a regulatory network for circular RNA function.
[0073] 4. qPCR verification and screening of circRNAs related to METH addiction memory
[0074] (1) RT-PCR experiment:
[0075] 1) Total RNA extraction from tissue samples:
[0076] ① Experimental Preparation: Soak ultrasonic grinding rods, surgical scissors, forceps, and other instruments in DEPC water overnight and then autoclave. Prepare 75% ethanol with DEPC water and refrigerate with chloroform and isopropanol at 4°C. Prepare nuclease-free consumables.
[0077] ② Weigh the mouse, prepare a labeled 1.5 mL centrifuge tube, and anesthetize the mouse with 5% isoflurane in air. Decapitate the mouse with surgical scissors and dissect the hippocampus on ice. Remove the hippocampus and place it in a 1.5 mL centrifuge tube. Add 1 mL of Triozl lysis buffer and grind using an ultrasonic grinder until the tissue is completely broken down. Pour the Triozl lysis buffer into a 2 mL nuclease-free centrifuge tube.
[0078] ③ Add chloroform to each of the above EP tubes at a ratio of 200 μL chloroform per 1 mL Trizol. Close the lid and shake the tube vigorously up and down for 15 seconds. Let it rest at room temperature for 10 minutes. Prepare a set of 1.5 mL EP tubes without nuclease and label them.
[0079] ④ Place the EP tube in a cold centrifuge and centrifuge at 12,000 rpm at 4°C for 15 minutes. Gently remove the sample after centrifugation. The liquid should now separate into three layers, with the RNA being the top aqueous phase, approximately 400 μL. Use a 200 μL pipette to pipette the top aqueous phase three times into another labeled centrifuge tube, being careful not to aspirate the lower layer.
[0080] ⑤ Add an equal volume of isopropanol to the above EP tube, close the lid and gently mix by turning it upside down. Let it stand at room temperature for 10 minutes to allow the RNA to fully precipitate.
[0081] ⑥ Centrifuge in a cold centrifuge at 12,000 rpm and 4°C for 10 minutes. After centrifugation, slowly discard the supernatant. The white precipitate at the bottom is the RNA precipitate.
[0082] ⑦ Add 1 mL of pre-cooled 75% ethanol to the EP tube and vortex until the precipitate floats to wash the organic phase in the precipitate; place it in a centrifuge and centrifuge at 4°C, 12,000 rpm for 10 minutes, and gently pour off the supernatant.
[0083] ⑧Place the EP tube upside down on the table and dry it at room temperature for about 10 minutes until the 75% ethanol is almost completely evaporated.
[0084] ⑨ Add an appropriate amount (20-50 μL) of nuclease-free water to dissolve the RNA precipitate. Pipette to mix or gently shake to completely dissolve the precipitate.
[0085] ⑩ Determine RNA concentration using a NanoDrop 1000 Nucleic Acid Analyzer. Rinse the sample well with nuclease-free water before measurement. Measure each sample twice and average the results. Note the N260 / N280 ratio, which should be between 1.8 and 2.0. Record the RNA concentration of the sample. Store the total RNA sample at -80°C until further use.
[0086] 2) mRNA Reverse Transcription: Prepare a 200μL nuclease-free EP tube and label it. Calculate the volume of 1μg RNA based on the RNA concentration. Remove the RNA and place it in an EP tube. Add nuclease-free water to a total volume of 8μL. Add 2μL of reverse transcription reagent to each sample, for a total of 10μL. Gently vortex to mix, then centrifuge. Place in a PCR machine and set the program to denature at 25°C for 5 minutes, 42°C for 15 minutes, 85°C for 5 seconds, and 12°C for 10 minutes. Immediately place on ice after denaturation. Store the resulting cDNA at -20°C.
[0087] 3) RT-PCR: Upstream and downstream primer sequences were designed and synthesized by Shanghai Sangon Biotechnology Co., Ltd. Remove the primers from the refrigerator, centrifuge, and add the appropriate amount of nuclease-free water according to the manufacturer's instructions. Dilute to 10 mM, aliquot, and store at -20°C until needed. The PCR reaction system and primer sequences are shown in the table below. Duplicate wells were set for each sample, and β-actin was used as an internal control.
[0088] Table 1 PCR reaction system
[0089]
[0090] 4) Perform PCR amplification using a real-time fluorescence quantitative PCR instrument. After adding the sample, seal the 96-well PCR plate with sealing film, centrifuge at 2000 rpm for 5 minutes, and then place the plate in an LC480 thermal cycler. Set the PCR program on the computer as follows: Program 1: Activation: 95°C, 10 minutes; Program 2: PCR: 95°C, 15 seconds; 60°C, 30 seconds, 50 cycles; Program 3: Melting curves: 95°C, 15 seconds; 60°C, 60 seconds; 95°C, continuous; Program 4: Cooling: 40°C, 30 seconds. After the reaction is complete, save the experiment, calculate the sample CP value, and export the data using PDF.
[0091] 5) The 2-△△ct method was used to analyze the expression of circRNA in each sample.
[0092] (2) Gene tree analysis and sequence alignment:
[0093] Sequencing data were screened using R x64 4.0.5 and RStudio software using the pheatmap package to identify differentially expressed circRNAs in human and mouse addiction. Sequence information for differentially expressed circRNAs in human and mouse addiction was retrieved using NCBI (https: / / www.ncbi.nlm.nih.gov / ). The sequence information was converted into a FASTA file using Notepad++. Phylogeny in MEGA software was used to analyze the sequence information and construct a phylogenetic tree. Homology modeling was performed for the differentially expressed circRNA sequences. RNA sequence alignment analysis was performed using Sequence in BioEdit software to identify differentially expressed circRNAs with the highest homology.
[0094] Experimental results: We used high-throughput sequencing and qPCR verification to identify circular RNAs with significant differences in expression in the hippocampus between control mice and METH-addicted mice. We also used gene tree analysis and sequence alignment to identify a homologous circular RNA, circPlekha5 ( Figure 1 、 Figure 2 )
[0095] Example 2. Structure and expression of circular RNA circPlekha5
[0096] Experimental methods:
[0097] 1. CircRNA structure description: The circPlkeha5 sequence was searched on the circbase website (www.circBase.org) and the specific structural location was queried through (https: / / genome.mdc-berlin.de / ).
[0098] 2. Cell Culture Techniques: Culture cells under conditions of 95% air, 5% carbon dioxide, 37°C, and 70%-80% humidity in the incubator. Prepare DMEM culture medium, 10% high-quality fetal bovine serum, and 1% double-antibody. First, thaw a cryovial containing 1 mL of cell suspension by rapid shaking in a 37°C water bath. Add the suspension to a centrifuge tube containing 4-6 mL of complete culture medium and mix thoroughly. Centrifuge at 1000 rpm for 3-5 minutes, discard the supernatant, and resuspend the cells in complete culture medium. Then, add the cell suspension to a culture flask (or dish) containing 6-8 mL of complete culture medium and culture overnight at 37°C. Observe cell growth and cell density under a microscope the next day. When the cell density reaches 80%-90%, subculture can be performed. Seed the cells on a 24-well plate slide at a density of 70%-80% for subsequent experiments to facilitate fluorescence imaging.
[0099] 3. Preparation of hippocampal brain slices:
[0100] (1) Mice were anesthetized with 5% isoflurane and perfused with DEPC-treated pre-cooled PBS at the apex, followed by perfusion with 4% PFA, and the brain tissue was completely removed.
[0101] (2) Fix with 4% PFA for 8 h.
[0102] (3) Dehydrate the brain tissue using 30% sucrose for 48 to 72 hours.
[0103] (4) Brain tissue was embedded in OCT, frozen at -20°C, and sliced into sagittal sections with a thickness of 30 μm. The hippocampus was cut and immersed in PBS solution, and the sections were floated and mounted.
[0104] 4. Fluorescence in situ hybridization (FISH): Experiments were performed using the Bes1001 RNA-FISH kit from Boxin Biotechnology. The circPlekha5 probe was synthesized by Shanghai Bioengineering. ① Cell slides were fixed with 4% PFA, permeabilized with PBST and proteinase K, then refixed and dehydrated in a gradient of ethanol. Prehybridization was performed at 37°C for 30 min. ② The probe and hybridization buffer were mixed at a ratio of 1:39 and immediately placed on ice. ③ The hybridization reaction solution was added dropwise to the sample to be tested. After covering with a membrane, the cells were denatured at 73°C for 5–8 min. The cells were then quickly transferred to 37°C for hybridization overnight (16–20 h). ④ Wash twice with 53°C preheated 25% formamide / 2× SSC, 5 min each; twice with 42°C preheated 0.1% NP-40 / 2× SSC, 5 min each; once with 42°C preheated 0.5× SSC, 5 min; and once with 42°C preheated 0.2× SSC, 5 min. ⑤DAPI staining of nuclei, sealing of sections, and observation under a fluorescence microscope.
[0105] 5. Immunofluorescence (IF) After rinsing with PBS, the brain slices were blocked with 5% fetal bovine serum containing PBST, and then incubated with primary antibody at 4°C overnight, rinsed 3 times with PBST, incubated with secondary antibody for 1 hour at room temperature, and mounted with DAPI after rinsing.
[0106] Experimental results: The structure of circPlkeha5 was determined by website query, and circPlekha5 was co-labeled with neurons in the hippocampal CA1 region by in situ hybridization of HT-22 and BV2 cells, fluorescence in situ hybridization of brain regions and immunofluorescence co-labeling. Figure 3 )
[0107] Example 3 Interference with circular RNA circPlekha5 improves METH addiction behavior in mice
[0108] 1. circPlekha5 interferes with AAV2 / 5 virus construction:
[0109] Prepare the AAV viral vector containing shcircPlekha5, CMV-DIO-U6-MCS-WPRE, named rAAV-CMV-DIO-(EGFP-U6)-shRNA1(circ_0013144)-WPRE-hGH polyA. The plasmid map is as follows: Figure 5 The plasmid nucleotide sequence is shown in SEQ ID NO. 3, and this plasmid was transfected into 293T cells. The interfering sequence is shown in SEQ ID NO. 2. After 72 hours, the cell supernatant was collected and the virus was purified using a heparin-agarose column. After purification and concentration, the viral particles were aliquoted into virus tubes and stored in liquid nitrogen until use. Viruses were purchased from Wuhan Shumi Brain Science and Technology Co., Ltd.
[0110] 2. CircPlekha5 was injected into the hippocampal CA1 region to interfere with AAV2 / 5 virus:
[0111] CaMKII-Cre mice were anesthetized with 5% isoflurane in air, fixed in a stereotaxic apparatus, and maintained with 1% isoflurane in air. The injection coordinates were 1.95–2.0 mm posterior to bregma, 1.5 mm lateral, and 1.5 mm deep. AAV particles were injected slowly at a rate of 0.1 μL / min, and the needle was left in place for 20 min to allow for adequate diffusion of the solution. After the hippocampal injection, the wound was sutured, iodine-coated, and gel-coated. Every other day, 5% carprofen was injected intraperitoneally at a volume of 0.2 mL / 10 g for anti-inflammatory and analgesia. Penicillin (0.2 million units / day) was also injected intraperitoneally once daily for 5 days (AAV-shcircRNA(Plekha5)-EGFP group). A control group of mice was injected with the same control virus (AAV-shcircRNA(scramble)-EGFP group).
[0112] 3. qPCR verification of virus interference efficiency and specificity
[0113] The qPCR experimental method was the same as step 4 in Example 1.
[0114] 4. Methamphetamine-based CPP behavioral test
[0115] After virus injection, the subjects were divided into four groups: shscramble+Saline, shscramble+METH, shcircPlekha5+Saline, and shcircPlekha5+METH. The shscramble+Saline group received a control virus injection followed by saline (10 mL / kg intraperitoneally); the shscramble+METH group received a control virus injection followed by methamphetamine (2 mg / kg intraperitoneally); the shcircPlekha5+Saline group received an interfering virus injection followed by saline (10 mL / kg intraperitoneally); and the shcircPlekha5+METH group received an interfering virus injection followed by methamphetamine (2 mg / kg intraperitoneally). Experimental Methods: Conditioned place preference (CPP) is a classic model for assessing drug addiction. The apparatus consists of a three-chamber system measuring 18 cm wide, 38 cm long, and 30 cm high, with two removable partitions inside. One box had black sidewalls and a floor with several vertical stripes and gaps; the other box had black and white stripes and a floor with several circular holes, creating distinct environments. Mice were either C57BL / 6 or CaMKII-Cre mice that had undergone stereotactic virus injection. Behavioral testing divided the mice into a saline control group and a model group. Three weeks prior to behavioral testing of conditioned place preference (CPP) in mice, interfering viruses and control viruses were injected. Mouse behavior was recorded with an industrial camera and analyzed in real time using Trackermaster behavioral software. The behavioral testing lasted 10 days. The first day was a pretest phase, in which mice in each group were placed in the behavioral apparatus and allowed to freely explore for 15 minutes. The behavioral software recorded the time each mouse spent in each box. The initial CPP score and initial preferred side were calculated by subtracting the time spent in the black box from the time spent in the white box. Mice without a natural preference (initial CPP score less than ±300 seconds) were selected for the next stage of the experiment. From day 2 to day 9, the behavioral matching phase began: METH model group mice were intraperitoneally injected with METH (2 mg / kg) on day 2 and placed in a partitioned, unnatural preference box (drug-side). On day 3, they were intraperitoneally injected with saline and placed in a partitioned, natural preference box (non-drug-side). The mice were confined to this box for 45 minutes. This cycle was repeated four times: intraperitoneal injections of METH matched the drug-side box on days 2, 4, 6, and 8, and intraperitoneal injections of saline matched the non-drug-side box on days 3, 5, 7, and 9. Control group mice were intraperitoneally injected with saline before matching the drug-side box and the non-drug-side box. All other matching strategy model group mice were treated the same way. A post-test phase was conducted on day 10, using the same procedures as the pre-test phase on day 1, and CPP scores were calculated.
[0116] Experimental results: The efficiency and specificity of the circPlekha5 virus interference were detected by qPCR. Behavioral results showed that circPlekha5 interference significantly improved the METH-induced conditioned place preference scores of mice and alleviated the addiction of mice, indicating that circPlekha5 interference can improve methamphetamine addiction in mice. The interference sequence or interference vector of circular RNA circPlekha5 can be used to prepare drugs for the treatment of methamphetamine addiction ( Figure 4 ).
[0117] Example 4 Circular RNA circPlekha5 as a diagnostic marker
[0118] 1. Clinical Sample Acquisition and Patient Admission Criteria
[0119] 1. Inclusion criteria:
[0120] (1) Male, aged 18 to 60 years old.
[0121] (2) The patient self-reports or receives reliable evidence (e.g., witnesses, law enforcement records) that methamphetamine use occurred within 7 days prior to blood collection. Positive urine or blood toxicology test results coincide with the time window for methamphetamine use.
[0122] (3) No drugs that may affect methamphetamine metabolism or test results (such as antipsychotics, benzodiazepines) have been used within 7 days. No cardiovascular or cerebrovascular disease.
[0123] (4) The patient is in stable health condition, free from serious acute diseases (such as infection, trauma, acute poisoning, etc.), with stable vital signs, and free from cardiovascular and cerebrovascular diseases and blood-borne diseases.
[0124] 2. Exclusion criteria:
[0125] (1) The time of addiction cannot be clearly determined or the laboratory test results are inconsistent with the self-reported time window.
[0126] (2) Use of other addictive substances (such as heroin, cocaine, marijuana, alcohol, etc.) within 7 days.
[0127] (3) The patient has uncontrolled schizophrenia, bipolar disorder, severe depression with suicidal tendencies, or impaired cognitive function (such as dementia, intellectual disability) and is unable to cooperate with the research process.
[0128] (4) Severe liver and kidney dysfunction, active cardiovascular disease (such as arrhythmia, history of myocardial infarction), and uncontrolled hypertension or epilepsy.
[0129] 2. Experimental Methods
[0130] 1. Blood sample acquisition and processing
[0131] (1) Blood sample collection from volunteers
[0132] a. Preparation before blood collection
[0133] Confirm the patient's name, age, and gender, and ask whether the patient is on an empty stomach; find out whether the patient has a history of fainting from blood or allergies, etc.; check the skin at the blood collection site and choose the superficial vein in the elbow; prepare a blood collection needle, tourniquet, red vacuum blood collection tube, 75% alcohol cotton swab, sterile gloves, sharps box, medical waste garbage bag, etc.
[0134] b. Collect blood samples
[0135] Tie a tourniquet 5 to 10 cm above the puncture point. Using the puncture point as the center, use a 75% alcohol cotton swab to disinfect in a spiral motion from the inside out, with a diameter of ≥5 cm, and wait until dry. The operator wears sterile gloves, holds the skin tight with the left hand to fix the vein, holds the blood collection needle with the right hand, with the needle bevel facing up, and inserts the needle at an angle of 15° to 30° to the skin. After seeing the blood return, insert the other end of the blood collection needle into the vacuum blood collection tube, and the blood will automatically flow into the tube. The amount of blood collected must reach the marked line on the blood collection tube. Loosen the tourniquet first, then remove the needle, and press the puncture point longitudinally with a sterile cotton swab for 3 to 5 minutes. Turn the blood collection tube upside down 5 times and place it on ice.
[0136] (2) Serum extraction
[0137] The whole blood in the red vacuum blood collection tube was centrifuged at 4°C, 1800g for 10 minutes to separate the upper serum sample, which was transferred to an enzyme-free 1.5mL centrifuge tube, centrifuged at 4°C, 13000g for 2 minutes, and the supernatant was collected and divided into 1.5mL ultra-low temperature cryopreservation tubes, quickly frozen in liquid nitrogen, and stored at -80°C. The flow chart is as follows Figure 6 As shown in A.
[0138] (3) Addiction craving scale test for addicts and healthy volunteers:
[0139] The addicted patients and healthy volunteers were tested for craving score of addiction scale ( Figure 6 B) The experimental results showed that the craving scores of addicts were significantly higher than those of healthy volunteers.
[0140] 2. CeRNA chip sequencing
[0141] The ceRNA sequencing performed in this study was assisted by Hangzhou Lianchuan Biotechnology Co., Ltd. and Shanghai Kangcheng Bioengineering Co., Ltd. The specific steps are briefly described as follows based on the references:
[0142] Total RNA was extracted using TRIzol and quantified using a NanoDrop ND-2000 spectrophotometer. RNA integrity was assessed using an Agilent Bioanalyzer 2100 system (RIN ≥ 7.0). RNA was then purified using an RNeasy Mini Kit. First-strand cDNA was synthesized using AffinityScript Reverse Transcriptase and Promoter Primer using 250 ng of purified RNA as a template. Cy3-labeled cRNA was then generated by in vitro transcription using T7 RNA polymerase. The labeled product was purified using RNeasy and hybridized to an Agilent SurePrint G3 microarray at 65°C for 17 hours. Raw data were acquired using an Agilent G5761A scanner. Background correction was performed using Feature Extraction software and quantile normalization was performed using GeneSpring GX. Probes that were detected as "present" in ≥80% of the samples in the comparison group were selected. Differentially expressed genes (DEGs) were screened by two-sample t-test (P<0.05) and |log2FC|≥1 criteria, and GO / KEGG enrichment analysis was performed after Benjamini-Hochberg correction (FDR<0.05). Finally, the expression patterns were visualized by unsupervised hierarchical clustering and heat map visualization ( Figure 6 C, D). The results showed that 12 groups of differentially expressed genes related to addiction memory were screened out based on enrichment analysis.
[0143] 3. RNA reverse transcription
[0144] The experiment was performed using the HiScript IIQ RT SuperMix for qPCR reverse transcription kit from Nanjing Novozymes Biotech Co., Ltd. The reaction system and operation procedures are as follows:
[0145] Table 2. RNA reverse transcription reaction system configuration table
[0146]
[0147] Mix the system and add it to an 80μL centrifuge tube. Centrifuge at 3000rpm for 30s to allow the components to settle to the bottom of the tube. Perform reverse transcription using a PCR instrument. The procedure is as follows:
[0148] Table 3. RNA reverse transcription procedures
[0149]
[0150] After reverse transcription, store the samples on ice.
[0151] 4. Real-time fluorescence quantitative PCR
[0152] (1) Primer design and synthesis:
[0153] Quantitative PCR was performed using the SYBR-Green method, and the required primers were synthesized by Shanghai Bioengineering Co., Ltd. The primer sequences are as follows:
[0154] Table 4. Real-time fluorescence PCR primer sequences for human genes
[0155]
[0156]
[0157] 3. R correlation between addiction craving 2 Coefficient and AUC curve area calculation
[0158] Correlation analysis: Correlation analysis was performed based on the addiction craving score and the expression of circPlekha5 in serum
[0159] Calculation of the area under the AUC curve: Origin 2018 software was used to list the circPlekha5 levels in the serum of 8 addicted patients and 8 healthy controls, and the area under the AUC curve was calculated.
[0160] The results showed that the expression level of CircPLEKHA5 in serum and its correlation with addiction craving were analyzed. 2 =0.7915, P < 0.001, and the area under the curve showed that AUC = 0.8125, P = 0.0357, indicating that circPlekha5 can be used as a marker for the diagnosis of methamphetamine addiction ( Figure 7 ).
[0161] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principles of the present invention. These improvements and modifications should also be regarded as within the scope of protection of the present invention.
Claims
1. Circular RNA circPlekha5, characterized in that The nucleotide sequence of the circular RNA circPlekha5 is shown as SEQ ID NO.
1.
2. Interference vector of circular RNA circPlekha5, preferably, the nucleotide sequence of the interference vector is shown in SEQ ID NO.
3.
3. The interference carrier according to claim 2, characterized in that The interference sequence shcircPlekha5 of the circular RNA circPlekha5 was connected to the basic vector. The nucleotide sequence of the interference sequence shcircPlekha5 of the interference vector is shown in SEQ ID NO.
2.
4. The interference carrier according to claim 2, characterized in that The basic vector is a plasmid with an encapsulation sequence packaged by an AAV virus; the AAV virus serotype is AAV9 or AAV2 / 5 virus.
5. The interference carrier according to claim 2, characterized in that The basic vector of the vector is a plasmid with a U6 promoter packaged by an AAV virus. Preferably, the plasmid with a U6 promoter is selected from CMV-DIO-U6-MCS-WPRE, pLVX-shRNA2-EF1a-ZsGreen-Puro, and pLVX-shRNA2-mcherry-Puro.
6. A pharmaceutical composition for treating methamphetamine addiction, characterized in that: The pharmaceutical composition comprises the interference vector of the circular RNA circPlekha5 according to claim 2.
7. The pharmaceutical composition according to claim 6, characterized in that The pharmaceutical composition further includes a pharmaceutically acceptable carrier or excipient.
8. Use of the circular RNA circPlekha5 according to claim 1 as a marker in the preparation of products for diagnosing nerve damage type diseases and / or methamphetamine addiction.
9. Use of a substance for detecting the circular RNA circPlekha5 according to claim 1 in the preparation of a product for diagnosing nerve damage type diseases and / or methamphetamine addiction.
10. Use of the interference vector of circular RNA circPlekha5 according to any one of claims 2 to 5 or the pharmaceutical composition according to claim 6 or 7 in the preparation of a medicament for treating nerve damage type diseases and / or methamphetamine addiction.