Folium artemisiae argyi AaHDZ64 gene and application thereof in regulation and control of plant epidermal hair development

Abstract

The invention discloses a folium artemisiae argyi AaHDZ64 gene and application thereof in regulation and control of plant epidermal hair development, and belongs to the technical field of molecular biology. The nucleotide sequence of the gene is as shown in SEQ ID No. 1. The invention also provides a corresponding primer pair, a recombinant vector and a host cell containing the gene or the recombinant vector. Experiments show that the cloned folium artemisiae argyi AaHDZ64 gene is used for constructing an overexpression vector to be genetically transformed into a plant, so that the epidermal hair density of the transgenic plant can be remarkably improved, and the expression of epidermal hair development related genes AtGL1 and AtGL2 is up-regulated. The AaHDZ64 gene has a good application prospect in cultivation of new germplasm of artemisia argyi.

Description

Technical Field

[0001] The present invention belongs to the field of molecular biotechnology. More specifically, the present invention relates to a kind of Artemisia argyi AaHDZ64 Genes and their applications in regulating plant epidermal hair development. Background Art

[0002] Artemisia argyi Artemisia argyi The dried leaves of Lévl. et Vant., known as Artemisia argyi, can be taken orally or applied externally. They have the effects of warming the meridians and stopping bleeding, dispelling cold and relieving pain, and can also be used externally to dispel dampness and relieve itching. Currently, Artemisia argyi is primarily used to make moxa wool, which is the primary raw material for moxibustion products (moxa sticks, moxa cones, etc.). Previous studies have confirmed that the surface of Artemisia argyi is distributed with glandular and non-glandular hairs. These hairs are important sites for the storage and secretion of flavonoids, and their density is closely correlated with flavonoid content. Flavonoids are a major component of Artemisia argyi and have various pharmacological effects, including anti-inflammatory and anti-tumor properties. Furthermore, previous research by the research team has revealed that pure moxa wool exhibits numerous non-glandular hairs under a microscope, and that higher-grade moxa wool has more non-glandular hairs. Therefore, the density of non-glandular hairs on the surface of Artemisia argyi directly affects the yield of moxa wool.

[0003] Plant trichomes are specialized structures that grow in the epidermal tissue of plants, composed of single or multiple cells. They range in size from a few microns to several centimeters and exhibit a variety of shapes. Depending on whether they have secretory functions, trichomes are classified as glandular or non-glandular. The specialized structure of trichomes holds important implications for understanding the molecular mechanisms governing plant cell differentiation. With the advancement of molecular biology techniques, research on the regulatory mechanisms of trichome development in model plants such as Arabidopsis thaliana, tomato, tobacco, and cucumber has been conducted, and genes involved in regulating trichome initiation or morphogenesis have been identified. However, the molecular mechanisms governing the morphological development of multicellular trichomes in plants remain largely undefined. To date, no studies have examined the molecular mechanisms governing trichome development in mugwort. Genomic identification of a large number of transcription factors that regulate trichome development and validation of these identified transcription factors have become an effective approach to improving mugwort germplasm. Summary of the Invention

[0004] An object of the present invention is to solve at least the above problems and to provide at least the advantages which will be described hereinafter.

[0005] Another object of the present invention is to provide a HD-Zip transcription factor of Artemisia argyi AaHDZ64 Gene, which can provide an important basis for the subsequent use of biotechnology to increase the density of mugwort epidermal hairs.

[0006] In order to achieve these purposes and other advantages according to the present invention, there is provided an Artemisia annua HD-Zip transcription factor AaHDZ64 The gene has a sequence as shown in SEQ ID No. 1.

[0007] Primer pair for extending the HD-Zip transcription factor of Artemisia argyi AaHDZ64 The sequences of the gene and primer pair are shown in SEQ ID No. 2 and SEQ ID No. 3.

[0008] Recombinant vector containing the HD-Zip transcription factor AaHDZ64 Gene.

[0009] Preferably, the recombinant vector includes a prokaryotic recombinant vector, a eukaryotic recombinant vector and an RNAi recombinant vector.

[0010] Host cell containing the Artemisia argyi HD-Zip transcription factor AaHDZ64 gene or the recombinant vector.

[0011] Artemisia HD-Zip transcription factor AaHDZ64 Application of genes in increasing the density of plant epidermal hairs.

[0012] Preferably, the plants are Arabidopsis thaliana and Artemisia argyi.

[0013] The present invention has at least the following beneficial effects: the present invention clones Artemisia argyi AaHDZ64 Gene, by constructing an overexpression vector and genetically transforming it into plants, can significantly increase the density of epidermal hairs of the resulting transgenic plants, and at the same time, increase the expression of genes related to epidermal hair development in transgenic plants. AtGL1 and AtGL2 The expression is significantly upregulated, and it can be widely used to increase the density of epidermal hairs in plants, and has good application prospects for breeding high-quality mugwort varieties with high hair rate.

[0014] Other advantages, objectives and features of the present invention will be reflected in part from the following description and will be understood by those skilled in the art through study and practice of the present invention. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] Figure 1 The cloned Artemisia argyi of the present invention AaHDZ64 Electropherogram of the gene; Figure 2 Folium Artemisiae Argyi of the present invention AaHDZ64 Phylogenetic tree analysis of genes; Figure 3 The cloned Artemisia argyi of the present invention AaHDZ64 Diagram of gene vector construction; Figure 4 The cloned Artemisia argyi of the present invention AaHDZ64 Plot of gene expression levels in mugwort leaves and non-glandular hairs; Figure 5 The cloned Artemisia argyi of the present invention AaHDZ64 Electrophoresis diagram of positive plants detected after the gene was transfected into Arabidopsis; Figure 6 The cloned Artemisia argyi of the present invention AaHDZ64 After the gene was genetically modified into Arabidopsis AaHDZ64 Gene expression level analysis diagram; Figure 7 The cloned Artemisia argyi of the present invention AaHDZ64 Microscopic observation of the epidermal hairs of leaves after the gene was transfected into Arabidopsis thaliana; A is WT; B is OE12; C is WT; D is OE7; E is OE9; F is OE12; Figure 8 The cloned Artemisia argyi of the present invention AaHDZ64 Analysis of differences in leaf epidermal hair density after the gene was transgenic into Arabidopsis thaliana; Figure 9 The cloned Artemisia argyi of the present invention AaHDZ64 After the gene was genetically modified into Arabidopsis AtGL1 and AtGL2 Gene expression level analysis diagram. DETAILED DESCRIPTION

[0016] The present invention will be described in further detail below in conjunction with the accompanying drawings so that those skilled in the art can implement the invention with reference to the description.

[0017] It should be understood that terms such as “having”, “including” and “comprising” used herein do not preclude the existence or addition of one or more other elements or combinations thereof.

[0018] It should be noted that the experimental methods described in the following embodiments are conventional methods unless otherwise specified, and the reagents and materials can be obtained from commercial channels unless otherwise specified.

[0019] 1. Mugwort AaHDZ64 Gene cloning mugwort AaHDZ64 Gene acquisition includes the following steps: Step 1: RNA Extraction: Total RNA was extracted from fresh young leaves of Artemisia argyi using an RNA extraction kit and pretreated with RNase-Free DNase (Promega, USA) to eliminate genomic DNA contamination. RNA integrity was analyzed on a 1.5% agarose gel, and RNA purity and concentration were determined by spectrophotometry.

[0020] Step 2. First-Strand cDNA Synthesis: Add the following reagents to a 0.2 mL PCR tube: 5 μL total RNA, 1 μL Random Primer p(dN)6 (100 pmol), and 1 μL RNase-free ddH2O. Incubate at 70°C for 5 min, then on ice for 2 min. Centrifuge for 3–5 s. Add the following reagents: 2.0 μL 5× First-Strand Buffer, 0.25 μL RNase Inhibitor, 0.25 μL Reverse Transcriptase, 0.5 μL 10 mmol dNTPs, and the total volume of 10.0 μL. Incubate at 42°C for 60 min, and then at 72°C for 10 min.

[0021] Step 3: Gene cloning: Detection was performed using LA Taq (TaKaRa, DRR02AG) reagent on a PCR instrument (Eppendorf, Germany). Gene-specific primers were designed and synthesized using Primer 5.0 software. SEQ ID NO.2: aacacgggggactttgcaacatggagggtgggatggtgtttgaag; SEQ ID NO.3: cctgaagcggccgctgtacaaggccaaagccaaaaggtttgatcttcaatag; PCR reaction system: Nuclease-free water 20 μL, Biorun Pfu PCR Mix 25 μL, Primer (SEQ ID NO. 2, 100 μM) 2 μL, Primer (SEQ ID NO. 3, 100 μM) 2 μL, template (first-strand cDNA) 1 μL; The PCR amplification program was as follows: 94°C for 5 min; 30 cycles of 94°C for 30 s, 50°C for 45 s, and 72°C for 53 s; and 72°C for 10 min.

[0022] Step 4: PCR electrophoresis and recovery: Run the PCR product on 1% TAE agarose gel electrophoresis. Figure 1 As shown, the target fragment was recovered using a column-type DNA gel recovery kit (Axygen, AP-GX-50), and then the recovered fragment was sequenced to obtain SEQ ID NO.1.

[0023] The sequence of SEQ ID NO.1 is shown below: atggagggtgggatggtgtttgaagctatgctacaaaatcaaaggcttaacttttcttctgatcaagggtttgactctcaatggggttccaactcctttcatggagaaaaaactaatacgactaagtcgctttccgggccacacgaaaaagaggaaaactctgatgaggactacggaaagtgttttcggcaaccagagaagaaaaggagactatcagttgatcaagttcaatttcttgaaaaaagttttgaggaagaaaataagcttgagccagagaggaaaattcagctagcaaaagagcttaatttgcagcctagacaagttgcaatttggtttcaaaatcgtcgtgcaaggtgcaagacaaaacaactcgaaaaagattacgatatcttgaattcgagctacgataaactcaagtcggagtttgattgcctccaaaaacacaatgagaaattgaaacatgaggttcaaatgctcaaagaaaagttacatcaaagggaacaagattctatcccaaatgaactccccacacaagagttggattcaaatgctcaagaaacaaagccaagtccaatttcaattcaaacttggagcaatgaaccaaagatggttatatgcaaacaagaatatgcaaattcggtttcaacaaaaagcgacataatcgattcctatagccctgatgggaaccattcttcatttcttgagccttgtgattcttcaaatgtatttgaaaatcaatccgatttctctcaagatgaagaagataacttacccattcttcggtgtccaaagatcgagtatgagtcgtacattgacccaaatgagggttccttggggggataccctattgaagatcaaaccttttggctttggcctaa。

[0024] II. Artemisia argyi HD-Zip transcription factor AaHDZ64 Analysis of the phylogenetic tree of the gene Artemisia argyi HD-Zip transcription factor AaHDZ64The gene SEQ ID NO.1 sequence contains 878 nucleotides. AaHDZ64 The phylogenetic tree of genes and protein sequences of HD-Zip transcription factor family of mugwort and Arabidopsis was constructed using MEGA 7.0, and the constructed phylogenetic tree was visualized using the online tool Evolview (https: / / evolgenius.info / / evolview-v2). AaHDZ64 The genes belong to the HD-Zip Ⅰ subfamily. There is a similarity between the HD-Zip subfamily classification of mugwort and Arabidopsis, that is, the number of HD-Zip Ⅰ subfamily genes in mugwort is the largest, while the number of HD-Zip Ⅳ subfamily genes in mugwort is the smallest, while the number of HD-Zip Ⅲ subfamily genes in Arabidopsis is the smallest. Figure 2 shown.

[0025] 3. Construction of HD-Zip transcription factor AaHDZ64 Gene overexpression vector By cloning the multiple cloning sites and AaHDZ64 The restriction enzyme sites of the gene sequence were analyzed and BsaI / Eco31I restriction enzyme sites were added to both ends of the primers. The vector pBWA(V)HS was digested with BsaI / Eco31I endonucleases and the target gene was inserted into the target gene by homologous recombination. AaHDZ64 Connect to the pBWA(V)HS-osgfp vector to obtain the fusion vector pBWA(V)HS-AaHDZ64 - osgfp was transformed into E. coli DH5α competent cells, and positive clones were screened by PCR amplification (primer sequences are as follows) and restriction enzyme digestion and sequence verification. Figure 3 shown.

[0026] SEQ ID NO.4: ttcatttggagagaacacgggggac; SEQ ID NO.5: cgctttttgttgaaaccgaatttgcat.

[0027] 4. Artemisia HD-Zip transcription factor AaHDZ64 Analysis of gene expression differences in leaves and non-glandular hairs of Artemisia selengensis Step 1. Material preparation: Collect fresh mugwort leaves and non-glandular hair samples, freeze them in liquid nitrogen, and store them in a -80°C ultra-low temperature freezer.

[0028] Step 2: RNA Extraction: Total RNA was extracted from mugwort leaves and non-glandular hairs using an RNA extraction kit. RNA was pretreated with RNase-Free DNase (Promega, USA) to eliminate genomic DNA contamination. RNA integrity was analyzed using a 1.5% agarose gel, and RNA content was determined spectrophotometrically.

[0029] Step 3: Transcriptome Sequencing: RNA-seq transcriptome libraries were prepared using an Illumina HiSeq sequencer using the TruSeq™ RNA Kit. Full-length cDNA was synthesized using the Clontech SMART cDNA First-Strand Synthesis Kit. Fragment size selection and PCR amplification were performed using Blue Pippin™. SMRT bell adapters were added to the resulting cDNA to construct a single-molecule real-time (SMRT) cDNA library.

[0030] Step 4. Gene expression level and differential analysis: After second-generation data quality control, TopHat (http: / / tophat.cbcb.umd.edu / ) was used for reference pair analysis. Based on the comparison results, cufflinks (http: / / cole-trapnell-lab.github.io / cufflinks / ) was used to calculate the FPKM value of each gene / transcript in the sample. Cuffdiff (http: / / cufflinks.cbcb.umd.edu / ) was used to calculate gene expression differences between samples. The screening criteria for significantly differentially expressed genes / transcripts were: FDR <= 0.05 & FC >= 2 & FPKM >= 5. The logarithm function was calculated based on the RPKM (Reads Per Kilobases per Million reads) value of the HD-Zip gene, and a gene expression heat map was drawn. Results are shown. AaHDZ64 The gene expression level in the non-glandular hairs of mugwort was much higher than that in leaves. Figure 4 shown.

[0031] 5. Artemisia HD-Zip transcription factor AaHDZ64 Gene function research and application (I) Transformation of Arabidopsis The constructed recombinant plasmid pBWA(V)HS-AaHDZ64-osgf was transformed into Agrobacterium GV3101, and the wild-type Arabidopsis thaliana was transformed using the Agrobacterium-mediated floral immersion method. The immersion cycle was 7 days, and a total of 3 immersions were performed. The infected seedlings were placed at 23°C with a 16h / 8h light / dark cycle and cultured until they set seeds. After 2 rounds of corresponding resistance screening, T3 generation positive plants were obtained. After they grew up, leaf DNA was extracted for PCR identification. The positive plants screened were transgenic Arabidopsis thaliana. The results obtained a total of AaHDZ64There are 17 positive plants, and the results are as follows Figure 5 Specific primers for qRT-PCR were designed using Primer 5.0 software: SEQ ID NO.6: agtcggagtttgattgcctc; SEQ ID NO.7: tgtgtggggagttcatttgg; qRT-PCR amplification was performed using cDNA from leaves of transgenic plants as templates, and the specific amplification of target genes was analyzed using the melting curve method. AtActin As the endogenous reference gene, 2 -ΔΔCT The expression level of the target gene was calculated by the method, and the significance of the difference in gene expression level was analyzed using SPSS19.0 software. Three biological replicates were set for all treatments. By detecting the expression level of the target gene in the overexpression positive plants, the results showed that the expression level of the target gene in the positive plants was significantly higher than that in the control plants. AaHDZ64 The gene expression level was 1849~7106 times that of the control. Figure 6 shown.

[0032] (II) Analysis of leaf epidermal hair density of transgenic plants The leaves of Arabidopsis plants with positive expression and wild-type plants were taken and placed under a stereomicroscope to observe the distribution of epidermal hairs and take pictures. The number of epidermal hairs per unit area of Arabidopsis leaves was counted using ImageJ software combined with naked eye identification. The results showed that the density of epidermal hairs on the surface of transgenic Arabidopsis leaves increased by 1.45 to 2.27 times compared with the control. Figure 7 、 8 As shown. AaHDZ64 Genes play an important role in the development of plant epidermal hairs.

[0033] (three) AaHDZ64 Gene overexpression regulates the expression of genes related to plant epidermal hair development Based on Arabidopsis AtGL1 and AtGL2 Primer 5.0 software was used to design specific primers for qRT-PCR based on the CDS sequence of the gene: AtGL1 -F:atcactgccgccacaccttc (SEQ ID NO.8) AtGL1 -R:cgacgccgttaaagctcttgg (SEQ ID NO.9) AtGL2 -F:tttctcctctccagccctctctc (SEQ ID NO.10) AtGL2-R:ctcatctccacagtgcgatcctc (SEQ ID NO.11) Agrobacterium-mediated floral dip method in transgenic Arabidopsis AtGL1 and AtGL2 The gene expression levels were analyzed and it was found that AaHDZ64 In transgenic Arabidopsis leaves, AtGL1 and AtGL2 Upregulated gene expression, AtGL1 The gene expression level was 1.50-3.75 times that of the control. AtGL2 The gene expression level was 1.14-1.46 times that of the control. Figure 9 shown.

[0034] Although the embodiments of the present invention have been disclosed above, they are not limited to the applications listed in the description and implementation methods. They can be fully applied to various fields suitable for the present invention. For those familiar with the art, additional modifications can be easily implemented. Therefore, without departing from the general concept defined by the claims and the scope of equivalents, the present invention is not limited to the specific details and illustrations shown and described herein.

Claims

1. Artemisia argyi HD-Zip transcription factor AaHDZ64 A gene characterized by The nucleotide sequence of the gene is shown in SEQ ID No.

1.

2. A primer pair, characterized in that Used to expand the Artemisia argyi HD-Zip transcription factor as claimed in claim 1 AaHDZ64 The sequences of the gene and primer pair are shown in SEQ ID No. 2 and SEQ ID No.

3.

3. A recombinant vector, characterized in that The recombinant vector contains the Artemisia argyi HD-Zip transcription factor according to claim 1 AaHDZ64 Gene.

4. The recombinant vector according to claim 3, wherein The recombinant vectors include prokaryotic recombinant vectors, eukaryotic recombinant vectors and RNAi recombinant vectors.

5. A host cell, characterized in that The host cell contains the mugwort HD-Zip transcription factor according to claim 1 AaHDZ64 The gene or the recombinant vector according to claim 3.

6. Artemisia HD-Zip transcription factor AaHDZ64 Application of genes in increasing the density of plant epidermal hairs.

7. The Artemisia argyi HD-Zip transcription factor according to claim 6 AaHDZ64 The application of a gene in increasing the density of plant epidermal hairs is characterized in that: The plants are Arabidopsis thaliana and Artemisia argyi.

Images