Haynaldia villosa nitrate transporter HvNRT2-6V. 3 gene and application thereof

Abstract

The invention discloses a haynaldia villosa nitrate transporter protein HvNRT2-6V. 3 and an application of the haynaldia villosa nitrate transporter protein HvNRT2- The DNA (deoxyribonucleic acid) sequence of the HvNRT3-V is SEQ ID NO. 1, and the amino acid sequence coded by the HvNRT3-V is SEQ ID NO. 2 The gene is from Haynaldia villosa., an overexpression vector pLGY: HvNRT2-6V. 3 is transformed into an acceptor material Fielder by using an agrobacterium transgenic technology, and the obtained transgenic plant shows that the nitrogen assimilation ability of wheat can be effectively enhanced, so that the yield potential and the nitrogen utilization efficiency of the wheat are remarkably improved. The invention provides a new way for cultivating crops with high nitrogen fertilizer utilization efficiency.

Description

Technical Field

[0001] The invention belongs to the technical field of plant genetic engineering, and particularly relates to a nitrate transporter gene HvNRT2-6V.3 derived from Haynaldiavillosa and its application in improving nitrogen utilization efficiency of crops. Background Art

[0002] Nitrogen is a key nutrient that influences crop yield and quality. The nitrogen use efficiency (NUE) of major crops, such as wheat, is generally below 40%, severely restricting sustainable agricultural development. Therefore, scientists have proposed a sustainable development path to synergistically improve nitrogen use efficiency and yield levels in crops—a new breeding strategy of "reduced fertilization, no yield reduction, and increased yield." Breeding new wheat varieties that combine high yield and nitrogen efficiency has become a major strategic need for ensuring food and ecological security.

[0003] Distant wheat species are tolerant to infertility and rich in diversity. Discovering and utilizing nitrogen-efficient genes in these distantly related species is an urgent need to broaden wheat's genetic base. Haynaldia villosa (2n=14, VV), an annual herb and a key member of the wheat tertiary gene pool, exhibits excellent traits such as numerous tillers, large grains, high protein content, short stalks, a well-developed root system, and high light efficiency, making it a valuable germplasm resource for genetic improvement of nitrogen-efficient wheat. Nannong 9918 (containing 6VS chromosomes) is a disease-resistant, high-yield, high-quality wheat variety bred by Nanjing Agricultural University using a combination of modern biotechnology and conventional breeding techniques, using a hybrid of Yangmai 158 / 92R137 / / Yangmai 158. This variety exhibits nitrogen-efficient phenotypes such as dark leaf color, thick stems, large ears, and high 1000-grain weight, providing an ideal candidate for discovering nitrogen-efficient genes.

[0004] The plant nitrate transport system is the core mechanism for regulating nitrogen absorption and utilization. Under dry farming conditions, nitrate nitrogen (NO3 - ) accounts for more than 70% of the nitrogen source absorbed by wheat, and its transmembrane transport and redistribution are mainly responsible for nitrate transporters (NRTs), among which the NPF (NRT1 / PTR) gene family is responsible for low-affinity NO3 - Transport, NRT2 / NAR2 (NAR2 is an auxiliary protein of NRT2) gene family is responsible for high affinity NO3 - Existing studies have shown that the expression response of TaNRT2 family members in common wheat to nitrogen deficiency stress is weak, which may be a major factor in their low nitrogen uptake efficiency. Therefore, the discovery of NRT2 genes with strong constitutive expression characteristics is of great value for wheat nitrogen-efficient breeding.

[0005] The present invention cloned a nitrate transporter gene HvNRT2-6V.3 from Nannong 9918. HvNRT2-6V.3 is expected to be used in genetic engineering breeding to construct the transgenic vector PLGY-OE3:HvNRT2-6V.3 and use Agrobacterium transformation to create transgenic plants, thereby improving the nitrogen utilization efficiency of wheat. Summary of the Invention

[0006] The present invention addresses the problems of low nitrogen absorption efficiency of crops and limited improvement effects of traditional breeding methods in the existing technology. The present invention isolates the HvNRT2-6V.3 gene with efficient nitrogen transport function from the wheat-triticum translocation line Nannong 9918, and provides its molecular breeding application scheme.

[0007] The purpose of the present invention is to provide a novel nitrate transporter gene HvNRT2-6V.3 derived from 6VS chromosome and application thereof.

[0008] Another object of the present invention is to provide a redo expression vector containing the gene and its application.

[0009] The purpose of the present invention can be achieved through the following technical solutions:

[0010] A Haynaldi avidinosa nitrate transporter gene HvNRT2-6V.3 is from Haynaldi avidinosa., and the nucleotide sequence is SEQ ID NO.1.

[0011] The amino acid sequence of the protein encoded by the HvNRT2-6V.3 nitrate transporter gene of the Triticum vulgare has the form SEQ ID NO.2.

[0012] The application of the Triticum vulgare nitrate transporter gene HvNRT2-6V.3 in breeding nitrogen-efficient wheat varieties.

[0013] The application of the Triticum vulgare nitrate transporter gene HvNRT2-6V.3 in improving wheat yield and / or improving wheat nitrogen utilization efficiency.

[0014] The described Triticum villosa nitrate transporter gene HvNRT2-6V.3 is preferably used in increasing wheat single plant yield, plant height, and effective tiller number.

[0015] A recombinant expression vector containing the HvNRT2-6V.3 nitrate transporter gene of the wheat cultivar.

[0016] The recombinant expression vector is used in breeding nitrogen-efficient wheat varieties.

[0017] The recombinant expression vector is used to increase wheat yield and / or improve wheat nitrogen utilization efficiency.

[0018] The recombinant expression vector is preferably used to increase wheat yield per plant, plant height, and number of effective tillers.

[0019] The present invention is achieved through the following technical paths:

[0020] Gene cloning: The HvNRT2-6V.3 gene was isolated from chromosome 6VS of the wheat-Hylotrichum villosa translocation line Nannong 9918. The nucleotide sequence was verified by sequencing and is shown in SEQ ID NO. 1.

[0021] Protein expression: The gene encodes a transmembrane transporter protein containing 357 amino acids (SEQ ID NO. 2). Phylogenetic analysis showed that it is highly conserved with the nitrate transporter family of Poaceae.

[0022] Vector construction: The HvNRT2-6V.3 gene was inserted into the downstream of the CaMV35S promoter of the plant expression vector pLGY-OE3 to construct a recombinant expression vector;

[0023] Genetic transformation: The recombinant vector was introduced into the wheat recipient variety through the Agrobacterium-mediated method, and the overexpression strain was obtained through molecular identification.

[0024] Beneficial effects

[0025] This study cloned a nitrate transporter, HvNRT2-6V.3, from the wheat-Triticum villosa translocation line, Nannong 9918. HvNRT2-6V.3 can be used in genetic engineering breeding to construct the transgenic vector PLGY-OE3:HvNRT2-6V.3, which can then be transformed with Agrobacterium to create transgenic plants, significantly improving their yield potential and nitrogen use efficiency. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Figure 1 Nitrate transporter HvNRT2-6V.3

[0027] Figure 2 HvNRT2-6V.3 gene overexpression vector pLGY-OE3: HvNRT2-6V.3 structure diagram

[0028] Figure 3 PCR Identification of HvNRT2-6V.3 Transgenic Fragment in T1 Overexpressing Plants

[0029] Figure 4 Comparison of yield per plant, tiller number and plant height of T1 generation positive and negative plants derived from HvNRT2-6V.3 overexpression lines (T0-16, T0-18 and T0-20) DETAILED DESCRIPTION

[0030] Example 1: Cloning of the nitrate transporter gene HvNRT2-6V.3 from Nannong 9918. PCR amplification and cloning of the gene HvNRT2-6V.3

[0031] Based on the 6VS chromosome sorting and sequencing data previously established by our team (reference: Liping Xing, Lu Yuan, Zengshuai Lv, Qiang Wang, Chunhong Yin, Zhenpu Huang, Jiaqian Liu, Shuqi Cao, Ruiqi Zhang, Peidu Chen, Miroslava Karafiatova, Jan Vrana, Jan Bartos, Jaroslav Dolezel and Aizhong Cao (2021), Long-range assembly of sequences helps to unravel the genome structure and small variation of the wheat-Haynaldiavillosa translocated chromosome 6VS.6AL), specific primers P1 (GCAACAGCCACCATTAGCTGC, SEQ ID NO. 3) and P2 (CTGTACGCTCTTCAAAGGTG, SEQ ID NO. 4) were designed targeting the open reading frame of the HvNRT2-6V.3 gene. The full-length HvNRT2-6V.3 gene was amplified by PCR using DNA from leaf tissue of Nannong 9918 as a template. The PCR amplification reaction system was as follows: 5 μl DNA template (100 ng / ul), 1 μl 5' primer (10 μM), 1 μl 3' primer (10 μM), 25 μl Phanta Mix (Vazyme, China), and water was added to make up the volume to 50 μl. The PCR reaction procedure was: 95°C pre-denaturation for 3 min; 95°C denaturation for 15 s, 57°C annealing for 30 s, 72°C derivatization for 110 s, 35 cycles; 72°C extension for 5 min. The amplified product was analyzed by 1% (w / v) agarose gel electrophoresis, and the results showed a specific band of approximately 2 kb (see attached). Figure 1 ), which is consistent with the expected target fragment size. The specific amplification product purified by electrophoresis was The Blunt cloning kit (Vazyme, China) was used for directional ligation into the pTOPO-Blunt vector and transformed into DH5α chemically competent cells (Escherichia coli) using the heat shock method. Positive clones were screened using LB solid medium containing ampicillin (100 μg / mL), and 10 single colonies were randomly selected for colony PCR verification (using the M13 universal primer). Recombinant plasmids with the correct insert length were sent to General Bio for bidirectional Sanger sequencing. Sequence assembly and BLAST analysis revealed a full-length 1,800-bp clone sequence (its open reading frame (ORF) predicted to contain a complete coding region of 1,524 bp (SEQ ID NO. 1), encoding a 507-amino acid transmembrane protein (predicted molecular weight 56.8 kDa, SEQ ID NO. 2). Multiple sequence alignment confirmed that the gene shared 99.7% identity with the H. villosa 6VS chromosome reference sequence (Xing et al., 2021), and it was formally designated HvNRT2-6V.3.

[0032] Example 2 Construction of HvNRT2-6V.3 gene expression vector

[0033] The Topo plasmid carrying the full-length gene of HvNRT2-6V.3 was used as a template. Primers P5 (CCCTAGGCCTACTAGGGATCCATGGAGGTCGAGGCGGG CGC, SEQ ID NO. 5) and P6 (ACGAACGAAAGCTCTGAGCTCAGCATGCTGGGG CGTGTTGTTG, SEQ ID NO. 6) were designed according to the forward sequence of the HvNRT2-6V.3 gene for PCR amplification. The PCR amplification system was as follows: 5 μl of plasmid template (100 ng / ul), 1 μl of 5' primer (10 μM), 1 μl of 3' primer (10 μM), and 1 μl of 5' primer (10 μM). ’ Primers, 25μl Phanta Mix (Vazyme), add water to 50μl. The PCR reaction program is: 95℃ pre-denaturation for 3min; 95℃ denaturation for 15s, 58℃ annealing for 30s, 72℃ extension for 100s, 35 cycles; 72℃ extension for another 5min. The PCR products were detected by 1% agarose gel electrophoresis to detect the specificity and size of the amplified bands. The 5' end of the HvNRT2-6V.3 amplified fragment carries a StuI restriction site, and the 3' end of HvNRT2-6V.3 carries a BamHI restriction site. The vector pLGY-OE3 was double-digested with Bam HI and StuⅠ, and the linearized vector was recovered. The HvNRT2-6V.3 gene was recombined into the vector using the homologous recombination method (ClonExpress MultiS One Step Cloning Kit, Vazyme) (attached Figure 2 ).

[0034] Example 3 Construction of HvNRT2-6V.3 transgenic plants and screening of positive seedlings

[0035] The wheat variety "Fielder" was used as the recipient, and the overexpression vector was the vector pLG Y-OE3:HvNRT2-6V.3 constructed in Example 2. The immature embryos of Fielder were transformed by Agrobacterium infection. The specific transformation operation was completed by Li Genying's team from Shandong Academy of Agricultural Sciences. A total of 23 T0 generation positive transgenic wheat plants were obtained, and all of them were planted in the greenhouse to generate T1 generation transgenic wheat plants for molecular and agronomic trait identification.

[0036] Fourteen T0-generation plants with a high seed yield were selected and cultivated to form 371 T1-generation plants. Standardized cultivation and management were carried out in a controlled-environment greenhouse (Baima Experimental Base), and leaf samples were collected for DNA extraction during the jointing stage of wheat. Based on the sequence characteristics of the target gene, a specific primer pair, OENRT3-VF13 (forward primer: 5'-ACTGATGCATATACATGATGGC-3', SEQ ID NO. 7) and OENR T3-VR13 (reverse primer: 5'-CCACGATTTGACACATTTTTACTC-3', SEQ ID NO. 8), was designed in this experiment. The expected amplification product length was 2157 bp. Molecular identification of the T1-generation plants was performed using a PCR amplification system (Taq DNA polymerase, 0.2 mM dNTPs, 0.5 μM of each primer). The results showed that the recombinant plasmid positive control showed specific amplification bands, while the negative control (wild-type Filder variety) and the blank control (ddH2O) did not show the target bands (see attached). Figure 3 Agarose gel electrophoresis analysis showed that the positive plant detection rate reached 83.15%.

[0037] Example 4 Effect of Overexpression of HvNRT2-6V.3 on Wheat Nitrogen Utilization Efficiency (NUE)-Related Traits

[0038] All the T1 generation positive plants mentioned above were phenotypic tracked throughout their growth period. Agronomic trait determinations at maturity showed that, compared with the control plants that were negative for molecular detection and derived from the same T0 generation plants, the HvNRT2-6V.3 overexpressing positive plants showed significant phenotypic improvement under conventional fertilization conditions (nitrogen fertilizer application rate of 314 kg / ha). Specifically, the average yield per plant increased by 34.65% (2.5±0.69 g, p<0.05), the average plant height increased by 7.26% (6.17±2.59 cm, p<0.05), and the average number of effective tillers increased by 29.95% (2.3±0.38, p<0.05). The above differences all reached statistically significant levels (see attached data). Figure 4 These data indicate that overexpression of the HvNRT2-6V.3 gene can effectively enhance the nitrogen assimilation capacity of wheat, thereby significantly improving its yield potential and nitrogen use efficiency.

Claims

1. A Haynaldia villosa nitrate transporter gene HvNRT2-6V.3 from Haynaldia villosa., characterized in that The nucleotide sequence is SEQ ID NO.

1.

2. The protein encoded by the nitrate transporter gene HvNRT2-6V.3 of the Triticum villosa according to claim 1, characterized in that The amino acid sequence is SEQ ID NO.

2.

3. Use of the Triticum villosa nitrate transporter gene HvNRT2-6V.3 according to claim 1 in breeding nitrogen-efficient wheat varieties. 4 . Use of the Triticum villosa nitrate transporter gene HvNRT2-6V.3 according to claim 1 in increasing wheat yield and / or improving nitrogen utilization efficiency of wheat.

5. The use according to claim 4, characterized in that The application of the Triticum villosa nitrate transporter gene HvNRT2-6V.3 in improving wheat single plant yield, plant height and effective tiller number. 6 . A recombinant expression vector containing the HvNRT2-6V.3 nitrate transporter gene from Triticum villosa according to claim 1 .

7. Use of the recombinant expression vector according to claim 6 in breeding nitrogen-efficient wheat varieties.

8. Use of the recombinant expression vector according to claim 6 in increasing wheat yield and / or improving nitrogen utilization efficiency of wheat.

9. The use according to claim 8, characterized in that The recombinant expression vector is used to increase wheat yield per plant, plant height and effective tiller number.

Images