Application of rice disease-resistant gene OsCaML2 in rice blast resistance
Through knockout or overexpression of the OsCaML2 gene of rice, the problem of rapid loss of resistance to rice blast is solved, and efficient rice blast resistance and stable rice breeding is achieved.
Patent Information
- Application Number
- CN202510572913.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-05-06
- Publication Date
- 2025-08-05
AI Technical Summary
The resistance of existing rice varieties to rice blast disease is rapidly lost with the changes of rice blast species, and the lack of broad-spectrum disease resistance genes leads to reduced grain yields.
Gene editing was performed by using rice OsCaML2 gene, and the resistance of rice to blast bacteria was regulated by knocking out or overexpressing the OsCaML2 gene, and efficient disease-resistant breeding was achieved in rice using recombinant expression vectors and Agrobacterium transformation technology.
It improves the resistance of rice to rice blast bacteria, while maintaining or increasing yield, providing a genetic resource for new rice varieties that are resistant to disease and stable yield.
Smart Images

Figure CN120424945A_ABST
Abstract
Description
Technical Field
[0001] The invention belongs to the field of genetic engineering, and particularly relates to application of a rice disease-resistant gene OsCaML2 in rice blast resistance. Background Art
[0002] Rice is one of the world's most important food crops, providing food for 50% of the world's population. However, rice is susceptible to various pathogens during its growth process, leading to the development of diseases and severe yield reductions. Rice blast is the most devastating disease in rice production. With the continuous evolution of blast races, existing rice varieties are rapidly losing resistance. Discovering disease-resistance genes and cultivating and deploying new, broad-spectrum resistant rice varieties are currently the most economical and effective means of controlling rice blast.
[0003] Therefore, the present invention discovers new broad-spectrum disease-resistant genes in rice and reveals the regulatory mechanism of rice disease resistance at the molecular level, accumulating valuable gene resources for the breeding of new rice varieties resistant to rice blast. Summary of the Invention
[0004] In response to the deficiencies in the prior art, the first object of the present invention is to provide a rice OsCaML2 gene. Research in the present invention has found that the rice OsCaML2 gene is related to the immune response of rice to rice blast. After knocking out the OsCaML2 gene, rice increases its susceptibility to rice blast fungus; and overexpressing the OsCaML2 gene can improve rice's resistance to rice blast fungus. The second object of the present invention is to provide an application of the aforementioned rice OsCaML2 gene.
[0005] The present invention solves the technical problem by adopting the following technical solutions:
[0006] The first object of the present invention is to provide a rice OsCaML2 gene, wherein the OsCaML2 gene is selected from any one of the following (A1) to (A3):
[0007] (A1) The coding region sequence is shown in SEQ ID NO. 1;
[0008] (A2) the nucleotide sequence shown in SEQ ID NO. 1 is substituted, deleted and / or added with one or more nucleotides;
[0009] (A3) A nucleotide sequence that hybridizes under stringent conditions to the DNA sequence defined in 1).
[0010] SEQ ID NO.1:
[0011] ATGTCGCAGTTTGTGGCGACGTTCGAGTACTGCAGCCTGGCCGTGTCGGTGTCGTCTCTCCTGATCAGGTTCGTCCTCCACCCGCTCGTCAGGGACGCCATCATCCTCGTCATGTCCAGAGCTGGCGCGAGCTCCCTCTCCTGCGCCCTCCTCGGCCTCC TCGCGCACGACGACAGCGCCCTCTTCGGCCGCCGACGATCGCTGCGCCGGCGCCGTAGCCGTCGTCGAGCCACCGCCTCCGCTGAGGCGGGAATGCGAGCTGTGCGCTCGTAGGGGCGGCGCCGGGCTGTCGCGCCACGACGTCGCGGCGGTCGTGGCGAGC CTCGGCATGGTCGCCGCCGGCGAAGATGACGACGACGACGACGAGGCGTGCGGCGTGTGCGAGGCGGTGGCGGCGGTGGAGGAGATGGCGGAGGGGAAGGTGGCCGGGGAGGGCGAGCTGCGGGAGGCGTTCTACGTGTTCGATCGCGACGAGGACGGGT ACGTGAGCGCGGCGGAGCTGTGGAACGTGATGCGGAGGCTGGGCATTGAGGAGGGCGCGCGGTACGGCGACTGCGTCAGGATGATCGCGGCGTACGACGGCGACGGCGATGGCCGGATCAGCTTCCAGGAGTTCAGAGCCATGATGGAGAACGCGGTTTAG
[0012] The second object of the present invention is to provide the protein encoded by the aforementioned rice OsCaML2 gene.
[0013] Furthermore, the protein is selected from any one of the following (B1)-(B3):
[0014] (B1) amino acid sequence as shown in SEQ ID NO. 2;
[0015] (B2) a protein derived from (B1) with one or more amino acids substituted, deleted, and / or added to the amino acid sequence shown in SEQ ID NO. 2;
[0016] (B3) A fusion protein obtained by linking a protein tag to the N-terminus and / or C-terminus of (B1) or (B2).
[0017] SEQ ID NO:2
[0018] MSQFVATFEYCSLAVSVSSLLIRFVLHPLVRDAIILVMSRAGASSLSCALLGLLAHDDSALFAADDRCAGAVAVVEPPPPLRRECELCARRGGAGLSRHDVAAVVASLGMVAAGEDDDDDDEACGVCEAVAAVEEMAEGKVAGEGELREAFYVFDRDEDGYVSAAELWNVMRRLGIEEGARYGDCVRMIAAYDGDGDGRISFQEFRAMMENAV*
[0019] The third object of the present invention is to provide primers for amplifying the protein encoded by the rice OsCaML2 gene.
[0020] Furthermore, the primer is
[0021] OsCaML2-F: CAGGTCGACTCTAGAGGATCCATGTCGCAGTTTGTGGCGA (SEQ ID NO. 3); OsCaML2-R: tccaagggcgaattgggtaccAACCGCGTTCTCCATCATG (SEQ ID NO. 4).
[0022] The fourth object of the present invention is to provide a recombinant expression vector, expression cassette, transgenic cell line or genetically engineered bacteria containing the aforementioned rice OsCaML2 gene.
[0023] Furthermore, the recombinant expression vector is obtained by connecting the OsCaML2 gene sequence shown in SEQ ID NO. 1 into the BamHI and KpnI restriction sites of the PUN1301-pUbi-FLAG vector.
[0024] A fifth object of the present invention is to provide a use of the aforementioned rice OsCaML2 gene, the aforementioned protein, or the aforementioned primers, or the aforementioned recombinant expression vector, expression cassette, transgenic cell line, or genetically engineered bacteria, wherein the use is selected from at least one of (C1) to (C5):
[0025] (C1) Application in regulating rice resistance to rice blast fungus;
[0026] (C2) Use in the preparation of products for regulating rice resistance to rice blast fungus;
[0027] (C3) Application in breeding rice with high resistance to rice blast;
[0028] (C4) Use in the preparation of products for cultivating rice with high blast resistance;
[0029] (C5) Application in breeding rice with high resistance to rice blast.
[0030] Furthermore, the regulation is selected from the following (D1) or (D2):
[0031] (D1) upregulating the expression of the OsCaML2 gene, or upregulating the content of the protein encoded by the OsCaML2 gene, or transferring the recombinant expression vector, expression cassette, transgenic cell line or genetically engineered bacteria into rice can improve the resistance of rice to rice blast fungus;
[0032] (D2) Knocking out or inhibiting the expression of the OsCaML2 gene, or knocking out or inhibiting the content of the protein encoded by the OsCaML2 gene, can reduce the resistance of rice to rice blast fungus.
[0033] More specifically, overexpressing the OsCaML2 gene in rice enhances resistance to the rice blast fungus. Knocking out the OsCaML2 gene in rice reduces resistance to the fungus, potentially facilitating research related to rice blast. This could include applications in rice gene editing and functional validation, screening for resistance genes and mechanisms, studying the pathogenic mechanisms of rice blast-related pathogens, pesticide resistance mechanisms, and research into disease transmission and ecological impacts.
[0034] In a specific embodiment, the invention is used in the breeding of rice with high resistance to rice blast, and rice lines resistant to rice blast fungus are obtained by screening rice plants with high expression of rice OsCaML2 gene or high OsCaML2 protein content.
[0035] In a sixth aspect, the present invention provides a method for regulating rice resistance to rice blast fungus. Knocking out the OsCaML2 gene in rice will reduce the resistance of rice to rice blast fungus; overexpressing the OsCaML2 gene in rice will increase the resistance of rice to rice blast fungus.
[0036] In a seventh aspect, the present invention provides a method for constructing transgenic rice resistant to rice blast fungus, wherein the rice OsCaML2 gene is transferred into rice plants to obtain transgenic rice that highly expresses the rice OsCaML2 gene.
[0037] Specifically, the coding sequence of the rice OsCaML2 gene is cloned into a vector, first transferred into Agrobacterium, and then transferred into rice cells through callus transformation to obtain transgenic rice that highly expresses the rice OsCaML2 gene.
[0038] Preferably, the vector is a PUN1301-pUbi-FLAG vector.
[0039] Beneficial effects
[0040] Research has found that the rice gene OsCaML2 plays an important role in rice blast resistance. Overexpression of the OsCaML2 gene can improve rice resistance to the blast fungus without affecting yield. Therefore, the rice OsCaML2 gene can be used to improve rice resistance to the blast fungus and stabilize yield. BRIEF DESCRIPTION OF THE DRAWINGS
[0041] Figure 1 The results of the rice blast resistance identification of Oscaml2 knockout mutants (including two transgenic lines, Oscaml2-1 and Oscaml2-7) and overexpression materials (including two transgenic lines, OsCaML2-6 and OsCaML2-11) are shown.
[0042] A: Lesion image of 2-month-old transgenic material 7 days after inoculation, scale is 1 cm;
[0043] B: Description of the mutation site of the Oscaml2 knockout mutant.
[0044] Figure 2 Figure 2 shows OsCaML2 gene expression in rice materials induced by pathogens. RNA was extracted from leaves of rice NIP materials spray-inoculated with rice blast race TH12 at 0, 12, 24, 36, 48, 60, and 72 hours after inoculation. OsCaML2 expression levels were determined by qRT-PCR. Rice OsActin1 was used as an internal control for analysis. Values are mean ± standard deviation (n = 3). Different letters indicate significant differences between samples (P < 0.05) as determined by Tukey's HSD test.
[0045] Figure 3 Analysis of OsCaML2 protein expression in rice plants induced by pathogens. Protein extraction from leaf samples of OsCaML2-11-overexpressing rice plants 0, 12, 24, 36, 48, 60, and 72 hours after spray inoculation with rice blast race TH12 was performed. Western blot analysis was performed to identify OsCaML2 protein expression levels.
[0046] Figure 4 The yield measurements of rice NIP, Oscaml2-1, and Oscaml2-7 mutant lines and OsCaML2-6 and OsCaML2-11 overexpressing lines are shown. Different letters indicate significant differences between samples (P < 0.05) as determined by Tukey's HSD test. DETAILED DESCRIPTION
[0047] The present invention is further explained below with reference to the following examples, but the examples do not limit the present invention in any form.
[0048] To make the purpose, technical solutions and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention are described clearly and completely below. Where specific conditions are not specified in the embodiments, conventional conditions or conditions recommended by the manufacturer are used. Where the manufacturer of the reagents or instruments is not specified, all are conventional products that can be purchased commercially.
[0049] The present invention provides a rice disease resistance gene, OsCaML2. The coding region sequence of the rice disease resistance gene OsCaML2 is shown in SEQ ID NO: 1. Sequencing revealed that the CDS of the OsCaML2 gene is 642 base pairs long and encodes a protein of 213 amino acids. The inventors have discovered through research that this gene can enhance rice resistance to blast disease caused by the blast fungus Pyricularia oryzae.
[0050] Furthermore, in a preferred embodiment of the present invention, the amino acid sequence encoded by the rice disease resistance gene OsCaML2 is shown in SEQ ID NO: 2.
[0051] The present invention provides a recombinant vector containing the rice disease-resistant gene.
[0052] Furthermore, in a preferred embodiment of the present invention, the vector is PUN1301-pUbi-FLAG.
[0053] The present invention provides a recombinant engineering bacterium containing the rice disease-resistant gene OsCaML2.
[0054] The present invention also proposes the application of the rice disease-resistant gene OsCaML2 in improving the blast resistance of rice.
[0055] Furthermore, in a preferred embodiment of the present invention, the application as described above includes the following steps:
[0056] S1. Cloning the rice disease resistance gene OsCaML2 into the PUN1301-pUbi-FLAG vector to obtain an expression vector;
[0057] S2. After the expression vector is transformed into Agrobacterium, the transformed Agrobacterium is used to infect and transform rice to obtain transgenic plants.
[0058] Furthermore, in a preferred embodiment of the present invention, the variety of rice is Nipponbare.
[0059] Of course, it should be noted that the OsCaML2 gene of the present invention can also be used to transform other varieties of rice to obtain transgenic plants with rice blast resistance, and the present invention does not make any specific limitation.
[0060] The present invention uses Agrobacterium transformation to transform the Nipponbare variety to obtain transgenic plants. Studies of the disease resistance of transgenic plants and wild-type Nipponbare indicate that the OsCaML2 gene can improve rice disease resistance, particularly resistance to rice blast. Its application has significant economic value and potential for improving rice disease resistance and stable yield.
[0061] The features and properties of the present invention are further described in detail below with reference to the following examples. In the following examples, the rice disease resistance gene OsCaML2 is referred to as OsCaML2.
[0062] Example 1 Obtaining the rice OsCaML2 gene knockout mutant Oscaml2 material.
[0063] The amino acid sequence of the rice OsCaML2 protein is shown in SEQ ID No: 2, and the gene sequence (CDS sequence) of the rice OsCaML2 gene is shown in SEQ ID No: 1. We used Crispr / Cas9 technology to perform targeted knockout of the target gene to obtain a knockout mutant of the OsCaML2 gene.
[0064] The steps for constructing the knockout vector are as follows:
[0065] (1) First, according to the gene number of OsCaML2, download its reference sequence in Nipponbare
[0066] "https: / / rice.uga.edu / cgi-bin / sequence_display.cgi?orf=LOC_Os03g59770.1", determine the target site and design the adapter primer OsCaML2-cas9-F / R. The primer sequences are as follows:
[0067] OsCaML2-cas9-F: ggcaCGTGAGCGCGGCGGAGCTG (SEQ ID NO.5);
[0068] OsCaML2-cas9-R: aaacCAGCTCCGCCGCGCTCACG (SEQ ID NO. 6);
[0069] (2) Preparation of target linkers: Dissolve the linker primers into a 100 μM stock solution, take 1 μL of each and add them to 98 μL of ddH2O to dilute to 1 μM. After the mixture is treated at 90°C for 30 seconds, move it to room temperature and cool it to complete annealing;
[0070] (3) gRNA expression cassette ligation reaction: The digested pYL gRNA-U3 vector was ligated with the corresponding target linker. The PCR reaction system was as follows:
[0071]
[0072] PCR reaction conditions are:
[0073] 37°C, 5 min; 20°C, 5 min, for a total of 5 cycles.
[0074] (4) gRNA expression cassette amplification (two rounds of nested PCR amplification):
[0075] The product obtained by ligation in (3) was used for the first round of amplification. The PCR reaction system was as follows:
[0076]
[0077] The sequence of the first-round PCR amplification primer UF / gDNA-R is:
[0078] UF: 5-CTCCGTTTTACCTGTGGAATCG-3 (SEQ ID NO.7);
[0079] gRNA-R: 5-CGGAGGAAAATTCCATCCAC-3 (SEQ ID NO. 8).
[0080] The reaction conditions for the first round of PCR amplification are as follows:
[0081] 95℃1min; 95℃15s, 60℃15s, 68℃30s, 22 cycles; 16℃1min.
[0082] After amplification, 3 μL of the amplified product was taken for electrophoresis examination.
[0083] 10 μL of the product obtained from the first round of amplification was used as a template for the second round of amplification.
[0084] The second round of PCR amplification reaction system is as follows:
[0085]
[0086] The second round PCR primer sequences are:
[0087] Uctcg-B1': 5'-TTCAGAggtctcTctcgCACTGGAATCGGCAGCAAAGG-3' (SEQ ID NO. 9); gRcggt-BL: 5'-AGCGTGggtctcGaccgGGTCCATCCACTCCAAGCTC-3' (SEQ ID NO. 10).
[0088] The reaction conditions for the second round of PCR amplification are as follows:
[0089] 95℃1min; 95℃15s, 60℃15s, 68℃30s, 24 cycles; 16℃1min.
[0090] After amplification, 3 μL of the amplified product was taken for electrophoresis. The second round amplified product was purified and its concentration was determined.
[0091] (5) Cutting and ligating (two-round nested PCR amplification):
[0092] Take about 20 ng of the purified product in step (4), add about 50 ng of uncut pYLCRISPR / Cas9-MH plasmid, add 1 μL 10×T4 ligase buffer and 35U T4 ligase, 1.5 μL Cutsmart BF and 1 μL BsaI to the system, and add sterile distilled water to make up to 15 μL reaction system.
[0093] After enzyme digestion, the PCR reaction system is as follows:
[0094] 37℃ for 5 min, 10℃ for 5 min, 20℃ for 5 min, for 10-15 cycles.
[0095] The ligated plasmid was transformed into E. coli using the heat shock method, and positive clones were selected for testing. After correct sequencing, the plasmid was sent to Wuhan Boyuan Biotechnology Co., Ltd. for callus transformation. Using the Nipponbare strain as the background, the rice OsCaML2 gene knockout mutants, Oscaml2-1 and Oscaml2-7, were obtained.
[0096] Example 2 Cloning method of rice OsCaML2 gene
[0097] This embodiment provides a method for cloning the rice disease resistance gene OsCaML2, comprising the following steps:
[0098] (1) Design a pair of specific primers OsCaML2-F based on the annotation information of OsCaML2:
[0099] CAGGTCGACTCTAGAGGATCCATGTCGCAGTTTGTGGCGA (SEQ ID NO. 3) and OsCaML2-R: tccaagggcgaattgggtaccAACCGCGTTCTCCATCATG (SEQ ID NO. 4).
[0100] (2) Total RNA was extracted from rice Nipponbare leaves, reverse transcribed into cDNA, used as a PCR reaction template, PCR amplified with the above primers, and the PCR product was cloned and sequenced, specifically comprising the following steps:
[0101] Total RNA was extracted from two-week-old Nipponbare rice leaves using the Trizol (Invitrogen) extraction protocol. RNA was then reverse-transcribed into cDNA using a reverse transcription kit (TOYOBO). PCR was performed using primers OsCaML2-F and OsCaML2-R and cDNA as a template according to the system in Table 1. The reaction procedure was as follows: 95°C pre-denaturation for 5 min → (95°C denaturation for 30 s → 56°C annealing for 30 s → 68°C extension for 1 min 10 s) for 35 cycles → 68°C for 5 min → 16°C for 1 min. The PCR product was then sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing.
[0102] Table 1 PCR reaction system for amplifying OsCaML2 gene
[0103]
[0104]
[0105] Sequencing results showed that the CDS of the rice OsCaML2 gene was 642 bp long and encoded a protein of 213 amino acids.
[0106] Example 3 Obtaining Rice OsCaML2 Gene Overexpression Material
[0107] This example provides a method for constructing a rice material resistant to rice blast. Agrobacterium EHA105 can be purchased from Shanghai Weidi Biotechnology Co., Ltd. The method includes the following steps:
[0108] (1) The OsCaML2 gene obtained in Example 2 was ligated into the PUN1301-pUbi-FLAG vector (the construction of the PUN1301-pUbi-FLAG vector is described in Zhai, K., Liang, D., Li, H. et al. NLRs guard metabolism to coordinate pattern-and effector-triggered immunity. Nature 601, 245-251 (2022).
[0109] https: / / doi.org / 10.1038 / s41586-021-04219-2), specifically including the following steps:
[0110] The sequences cloned by OsCaML2-F and OsCaML2-R primers were connected to the PUN1301-pUbi-FLAG vector backbone after double digestion with BamHI and KpnI using the Novozymes recombination kit to obtain the overexpression vector.
[0111] PUN1301-pUbi-OsCaML2-FLAG, after screening on kanamycin plates, was identified by colony PCR and sent for sequencing of positive clones. This part was commissioned to Sangon Biotech (Shanghai) Co., Ltd. After the plasmid was correct, it was extracted and transformed into Agrobacterium EHA105.
[0112] (2) The positive vector PUN1301-pUbi-OsCaML2-FLAG was transformed into Japanese eye using Agrobacterium-mediated method to obtain the transgenic plant OsCaML2-OE stably expressing. The specific steps are as follows:
[0113] After shelling, mature rice seeds were rinsed with 75% ethanol once, then soaked and disinfected with 30% sodium hypochlorite for 30 minutes, washed with sterile water 5 times, and then inoculated into callus induction medium and cultured at 28°C under light for 7 days.
[0114] Immerse the rice callus tissue in the correctly identified Agrobacterium culture solution for 10 minutes, then use sterile filter paper to absorb the surface culture solution and inoculate it into the co-cultivation medium; immerse the infected callus tissue in 500 mg / L carbenicillin solution for 15 minutes, repeat twice, use filter paper to absorb the surface moisture of the callus tissue, and inoculate it into the screening medium.
[0115] The newly grown resistant callus tissue blocks were subcultured to a bud induction medium and cultured under light at 28°C until adventitious buds grew; the adventitious buds were then subcultured to a rooting medium and cultured under light at 28°C until most of the seedlings grew adventitious roots; finally, the rooted seedlings were removed, the culture medium was washed, the roots of the seedlings were immersed in sterile water for 3-7 days, and then transplanted into the field or greenhouse to obtain the rice OsCaML2 gene overexpression lines OsCaML2-6 and OsCaML2-11.
[0116] Example 4
[0117] This example provides identification of rice blast resistance in wild-type Nipponbare and transgenic Nipponbare rice, comprising the following steps:
[0118] Transgenic overexpression and knockout (two lines each) Nipponbare seeds and wild-type Nipponbare seeds were taken and immersed in water for 2-3 days to germinate. They were then sown in small pots. The rice seedlings were cultured in a greenhouse at 28°C with a light intensity of 10,000 Lx, a photoperiod of 14 h light / 10 h dark, and a light temperature of 140 °C until the rice had three leaves and one heart. 5 ~2.0×10 5 A spore suspension of TH12 (Pyricularia oryzae) at 100 μg / mL was evenly sprayed onto rice leaves using a high-pressure atomizer. The inoculated seedlings were incubated in the dark at 28°C in an inoculation room with a humidity above 90% for 24 hours, followed by a photoperiod of 12 hours light / 12 hours dark for 7 consecutive days.
[0119] like Figure 1 Shown in the figure is a comparison of leaves from wild-type Nipponbare and transgenic overexpressing and knockout rice lines seven days after inoculation with the rice blast fungus. Seven days after inoculation, the leaves of the rice overexpressing OsCaML2 had significantly fewer lesions than those of the wild-type Nipponbare, while the leaves of the OsCaML2 knockout rice were more susceptible to the disease than those of the wild-type.
[0120] Example 5
[0121] Analysis of OsCaML2 gene expression and downstream defense gene expression in rice materials induced by pathogens. The figure shows RNA extracted from leaves of rice NIP materials 0, 12, 24, 36, 48, 60, and 72 hours after spray inoculation with rice blast race TH12, and the expression level of OsCaML2 was determined by qRT-PCR.
[0122] The primer sequences used for real-time PCR are as follows:
[0123] OsActin1-F: TGTATGCCAGTGGTCGTACCA (SEQ ID NO. 11);
[0124] OsActin1-R: CCAGCAAGGTCGAGACGAA (SEQ ID NO. 12);
[0125] OsCaML2-RT-F:GCTGCGGGAGGCGTTCTA (SEQ ID NO. 13);
[0126] OsCaML2-RT-R: GATCATCCTGACGCAGTCGC (SEQ ID NO. 14);
[0127] The results showed that the expression of OsCaML2 gene was significantly up-regulated after 12h of induction by rice blast fungus, reaching the highest level after 60h. Figure 2 ).
[0128] Example 6
[0129] Analysis of OsCaML2 protein expression in rice plants following pathogen induction. The figure shows protein extraction from leaf samples of rice NIP and OsCaML2-OE-11 plants 0, 12, 24, 36, 48, 60, and 72 hours after spray inoculation with rice blast race TH12. Western blot analysis was performed to determine OsCaML2 protein expression. Ponceau red staining was used as a control for protein loading.
[0130] Extraction of total plant protein
[0131] Rice samples were ground with liquid nitrogen and extracted with 5% SDS (200 μL per 0.1 g of material). After vortex mixing, the extract was rotated at 4°C for 10 min and then at 12,000 rpm at 4°C for 10 min. The supernatant was transferred to a new centrifuge tube, and an equal volume of 2× SDS loading buffer (50 mM Tris-Cl, pH 8.0; 20% (v / v) glycerol; 4.6% SDS; 0.02% bromophenol blue; 0.2 M DTT was added before use) was added.
[0132] Western blot hybridization
[0133] (1) Protein electrophoresis
[0134] Load the precast gel and use the Tanon protein electrophoresis system. Add an appropriate amount of precast gel running buffer. Load approximately 16 μl of protein extract per well and run the gel at 90 V for 1 hour, stopping the run at the desired band position.
[0135] (2) Transfer
[0136] First, activate the PVDF membrane by soaking it in methanol for 10 seconds, rinsing it in deionized water for 5 minutes, and then soaking it in transfer buffer (3.03g / L Tris base, 14.4g / L Glycine, 200mL / L methanol) for at least 10 minutes. After protein electrophoresis, remove the PAGE gel and soak it in transfer buffer for at least 10 minutes. Transfer the membrane using the wet transfer method. Assemble the membrane in the correct order: sponge-filter paper-PVDF membrane-gel-filter paper-sponge, with the black electrode as the negative terminal and the white electrode as the positive terminal. Transfer the membrane in an ice-water bath at a constant current of 180mA for 2 hours.
[0137] (3) Closed
[0138] After transfer, the membrane was placed in blocking buffer (5% skim milk powder dissolved in TBST) and incubated with shaking for 2 h. TBST (20 mM Tris-HCl, pH 7.5; 150 mM NaCl; 0.05% (v / v) Tween 20).
[0139] (4) Primary antibody incubation
[0140] Dilute the corresponding antibody in a certain ratio using Solution I (Toyobo, primary antibody enhancer). Rinse the blocked membrane in TBST for 2 minutes, place the membrane in a sealing bag, add the primary antibody, and incubate with low-speed rotation for 1 hour or at 4°C overnight.
[0141] (5) Primary antibody rinse
[0142] The membrane was rinsed 5 times in TBST for 10 min each time.
[0143] (6) Secondary antibody incubation
[0144] The corresponding secondary antibody was diluted in a certain ratio using Solution II (Toyobo, secondary antibody enhancer), the membrane was placed in a sealed bag, the secondary antibody was added, and the membrane was incubated at 37°C with low-speed shaking for 1 h.
[0145] (7) Secondary antibody washing
[0146] The membrane was rinsed 5 times in TBST for 10 min each time.
[0147] (8) Development
[0148] Mix ECL Plus Solution A and Solution B in a 1:1 ratio (Tanon). Approximately 200 μL of developer solution is required per membrane. Place the membrane in a sealed bag, add developer solution, remove all bubbles, and photograph using a CCD scanner.
[0149] The results showed that the protein expression level of OsCaML2 induced by rice blast was consistent with the gene expression level, and it began to increase significantly at 12h and reached the highest level at 60h. Figure 3 ).
[0150] Example 7
[0151] All the indicators were tested with more than 10 repetitions.
[0152] Plant height: Use a ruler with a scale to directly measure the height from the base of the plant to the top of the highest ear in the field;
[0153] Ear length: Measure the length from the top of the ear to the first node using a ruler with a scale;
[0154] Effective tiller number: After the plant is fully mature, count the number of normal tillers per plant in the field;
[0155] Number of grains per spike: all spikelets on the main stem spike were threshed and then counted;
[0156] Yield per plant: All ears of each plant were threshed and weighed;
[0157] Thousand-grain weight: Count the number of full grains in each main ear and weigh them to obtain the average grain weight, then multiply by 1000 to get the thousand-grain weight.
[0158] Grain setting rate: Separate the empty grains from the full grains in the main ear and count them separately. The grain setting rate is calculated as the number of full grains / number of grains per ear.
[0159] The results showed that the plant height, panicle length, seed setting rate, 1000-grain weight and yield per plant of Oscaml2 knockout mutant materials were significantly decreased compared with the wild type, but there were no significant differences in the number of effective panicles and number of grains per panicle; while there were no significant differences in the above yield traits between Oscaml2 overexpression materials and the wild type. In summary, the yield of OsCaML2 overexpression plants was not significantly different from that of wild type materials, and it can improve rice blast resistance without affecting yield, while the yield of Oscaml2 knockout mutants was significantly decreased compared with wild type materials ( Figure 4 ).
[0160] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principles of the present invention. These improvements and modifications should also be regarded as within the scope of protection of the present invention.
Claims
1. A rice OsCaML2 gene, characterized in that The OsCaML2 gene is selected from any one of the following (A1)-(A3): (A1) The coding region sequence is shown in SEQ ID NO. 1; (A2) the nucleotide sequence shown in SEQ ID NO. 1 is substituted, deleted and / or added with one or more nucleotides; (A3) A nucleotide sequence that hybridizes under stringent conditions to the DNA sequence defined in 1).
2. The protein encoded by the rice OsCaML2 gene according to claim 1.
3. The protein according to claim 2, characterized in that The protein is selected from any one of the following (B1)-(B3): (B1) amino acid sequence as shown in SEQ ID NO. 2; (B2) a protein derived from (B1) with one or more amino acids substituted, deleted, and / or added to the amino acid sequence shown in SEQ ID NO. 2; (B3) A fusion protein obtained by linking a protein tag to the N-terminus and / or C-terminus of (B1) or (B2).
4. Primers for amplifying the protein encoded by the rice OsCaML2 gene according to claim 1.
5. The primer according to claim 4, characterized in that The primer is OsCaML2-F: CAGGTCGACTCTAGAGGATCCATGTCGCAGTTTGTGGCGA (SEQ ID NO. 3); and OsCaML2-R: tccaagggcgaattgggtaccAACCGCGTTCTCCATCATG (SEQ ID NO. 4).
6. A recombinant expression vector, expression cassette, transgenic cell line or genetically engineered bacteria containing the rice OsCaML2 gene according to claim 1.
7. The recombinant expression vector, expression cassette, transgenic cell line or genetically engineered bacteria according to claim 4, characterized in that: The recombinant expression vector is a vector that connects the OsCaML2 gene sequence shown in SEQ ID NO.1 into The pUN1301-pUbi-FLAG vector was obtained between the BamHI and KpnI restriction sites.
8. Use of the rice OsCaML2 gene according to claim 1, the protein according to claim 2 or 3, the primer according to claim 4 or 5, or the recombinant expression vector, expression cassette, transgenic cell line or genetically engineered bacteria according to claim 6 or 7, characterized in that: The application is at least one selected from (C1) to (C5): (C1) Application in regulating rice resistance to rice blast fungus; (C2) Use in the preparation of products for regulating rice resistance to rice blast fungus; (C3) Application in breeding rice with high resistance to rice blast; (C4) Use in the preparation of products for cultivating rice with high blast resistance; (C5) Application in breeding rice with high resistance to rice blast.
9. The use according to claim 8, characterized in that in, The regulation is selected from the following (D1) or (D2): (D1) upregulating the expression of the OsCaML2 gene, or upregulating the content of the protein encoded by the OsCaML2 gene, or transferring the recombinant expression vector, expression cassette, transgenic cell line or genetically engineered bacteria into rice can improve the resistance of rice to rice blast fungus; (D2) Knocking out or inhibiting the expression of the OsCaML2 gene, or knocking out or inhibiting the content of the protein encoded by the OsCaML2 gene, can reduce the resistance of rice to rice blast fungus.