New rice susceptible gene OsBSG2 capable of efficiently utilizing resources

Abstract

The invention discloses a novel rice susceptible gene mutant OsBSG2, a function identification method thereof and application of the novel rice susceptible gene mutant OsBSG2 in cultivation of a novel broad-spectrum disease-resistant, high-quality and high-yield rice variety. The OsBSG1 gene is cloned according to rice genome annotation information. The CDS sequence length of the gene is 2580bp, and the gene encodes a protein with the length of 859 amino acids. According to the present invention, the rice blast resistance identification is performed on the CRISPR / Cas9 mutant of the OsBSG1 gene, and the broad-spectrum high rice blast resistance of the mutant OsBSG2 is found; the thousand seed weight of the grains is increased, and the quality is better. Exploration of the new susceptible gene OsBSG1 provides precious gene resources and theoretical guidance for breeding of new varieties of broad-spectrum rice blast-resistant, high-yield and high-quality rice.

Description

[0001] This application is a divisional application of "A new rice disease susceptibility gene OsBSG1 for efficient resource utilization". The application date of the original application is July 22, 2024, the application number is: 202410980061.2, and the name of the invention is: A new rice disease susceptibility gene OsBSG1 for efficient resource utilization. Technical Field

[0002] The present invention relates to the technical field of plant disease resistance, and in particular to a method for functional identification of a new rice disease-susceptible gene mutant OsBSG2 and its application in breeding new rice varieties with broad-spectrum disease resistance, high quality and high yield. Background Art

[0003] Rice (Oryza sativa L.) is one of the world's most important food crops, relying on it as a staple food for over half the world's population (Elert 2014). Rice fungal diseases pose a serious threat to rice production safety, leading to reduced yields and increased cultivation costs (Azizi et al., 2016). Among them, rice blast, caused by the blast fungus Magnaporthe grisea, is known as the "cancer of rice," resulting in yield reductions and, in severe cases, even total crop failure (Pennisi, 2010). Even with widespread planting of disease-resistant varieties, rice blast still accounts for 10%-30% of the world's annual rice production losses (Kim et al., 2013). Therefore, improving and enhancing rice blast resistance and cultivating new varieties with broad blast resistance are of great significance to my country's rice production safety and national food security.

[0004] Breeding and deploying new broadly disease-resistant rice varieties is the most economical, safest, and most effective means of controlling rice blast (Hulbert et al., 2003). Genetic studies have mapped over 100 blast-resistance loci in the rice genome, yet only 35 blast-resistance genes have been cloned (Wang et al., 2017). The genetic complexity and diversity of the rice blast fungus results in significant differences in the pathogenicity of different rice blast races to rice. Most resistance genes confer resistance to only a single rice blast race. Furthermore, the rapid mutation of rice blast strains often results in reduced or even loss of resistance in resistant varieties bred based on a single resistance (R) gene (Kou and Wang, 2012). Inactivation of susceptible genes is an effective way to confer broad-spectrum resistance in plants. Therefore, identifying rice susceptibility genes provides valuable genetic resources for the development of new rice cultivars with broad-spectrum resistance. Summary of the Invention

[0005] The purpose of the present invention is to make up for the shortage of existing rice blast-resistant gene resources and provide a new rice blast-susceptible gene OsBSG1.

[0006] Another object of the present invention is to provide a new rice disease-susceptible gene mutant OsBSG2, a method for identifying its function, and its application in breeding new rice varieties with broad-spectrum disease resistance, high quality, and high yield, especially the gene mutant has broad-spectrum and high resistance to rice blast, and the grain thousand-grain weight is increased and the quality is better.

[0007] The present invention discloses a new rice disease-susceptible gene mutant OsBSG2. The mutant OsBSG2 is a Cas9 gene knockout mutant of OsBSG1, and the nucleotide sequence of the OsBSG1 gene is shown in SEQ ID NO.1. The OsBSG2 is a deletion of 1071bp to 1075bp of the OsBSG1 gene, and the base T is inserted between 1149bp and 1150bp of the OsBSG1 gene. The nucleotide sequence of the OsBSG2 is shown in SEQ ID NO.2.

[0008] Furthermore, the present invention discloses the use of the above gene knockout mutant in improving the broad-spectrum resistance of rice to rice blast, increasing the thousand-grain weight of rice, and improving the quality of rice.

[0009] Furthermore, the present invention provides a method for functional identification of the gene OsBSG1, which is specifically implemented according to the following steps:

[0010] S1. Clone the OsBSG1 gene into the pYLCRISPR / Cas9Pubi-H vector;

[0011] S2. Infect rice with Agrobacterium tumefaciens to obtain the OsBSG1 gene knockout mutant plant OsBSG2;

[0012] S3. Field identification of the blast-resistant mutant OsBSG2;

[0013] S4. Indoor identification of rice blast resistance of the gene mutant OsBSG2.

[0014] The technical solution of the present invention is:

[0015] The method for functional identification of the novel rice disease susceptibility gene OsBSG1 is specifically implemented according to the following steps:

[0016] Step 1: Preparation of materials

[0017] Rice varieties C105TTP-4L-23 and CO39, Cas9 knockout vector: pUbi-Cas9-H, sgRNA cloning vectors: pYLgRNA-OsU6a / LacZ and pYLgRNA-OsU6b, Agrobacterium tumefaciens EHA105.

[0018] Step 2: Construction and transformation of pUbi-Cas9-OsBSG1 vector

[0019] With reference to the sequence of OsBSG1, the knockout target was predicted using CRISPR-P (http: / / cbi.hzau.edu.cn / cgi-bin / CRISPR) online analysis software, and the target primers OsBSG1-T1-F, OsBSG1-T1-R and OsBSG1-T2-F, OsBSG1-T2-R were designed. Then, the target linker was ligated with the sgRNA cloning vectors (pYLgRNA-OsU6a / LacZ and pYLgRNA-OsU6b) digested with Bsa I-HF to construct the sgRNA expression cassette by two rounds of PCR. Finally, the two expression cassettes were ligated with Bsa The pYLCRISPR / Cas9Pubi-H vector, digested with I-HF, was subjected to an infusion ligation reaction to construct pUbi-Cas9-OsBSG1, which was then transformed into Escherichia coli DH5α. The constructed vector was then transformed into rice C105TTP-4L-23 via Agrobacterium tumefaciens EHA105. DNA from the transformed plants was extracted, and hygromycin primers hygF (CCGGAAGTGCTTGACATTGG) and hygR (GCCGAATTAATTCGGGG) were designed to amplify the hygromycin gene in the transgenic plants. Positive plants were identified when a 1035bp fragment was amplified. T0 positive transgenic plant seeds were collected, and after sowing, young leaves were taken to extract DNA for target site mutation detection. Primers OsBSG1-TC-F (CTCTCACAGCTAGAGGAG) and OsBSG1-TC-R (GCTCAACCAAGATGGCG) containing the target site fragment PCR were designed, and the target fragment containing the target site was amplified for sequencing analysis. Plants with frameshift mutations as sequenced were homozygous knockout plants, and their offspring were homozygous OsBSG2.

[0020] Step 3: Identification of blast resistance in rice OsBSG1 gene knockout mutants

[0021] Rice OsBSG1 gene knockout mutants were tested for resistance to rice blast in both the field and laboratory. The field test was conducted at the National Southern Rice Blast Resistance Testing Base in Chadi Township, Shanghang County, Longyan City, Fujian Province, where disease development was observed in seedlings. Laboratory testing for rice blast resistance was conducted at the Institute of Plant Protection, Fujian Academy of Agricultural Sciences. Thirty-two single-spore strains of the blast fungus were used to infect test materials at the three-leaf, one-heart stage. Seven days later, the resistance rates were assessed, and comprehensive resistance evaluation was conducted.

[0022] Step 4. Grain Observation of Rice OsBSG1 Gene Knockout Mutants

[0023] The OsBSG1 gene knockout mutant and wild type of rice were planted in the experimental fields of Baitang Town, Hanjiang District, Putian City. The mature rice was harvested, dried and the thousand-grain weight, grain length and chalky grain rate were measured to analyze the grain quality of the mutant.

[0024] Compared with the prior art, the present invention has the following beneficial effects:

[0025] This study, published in the journal Nature Communications, discovered a novel disease-susceptibility gene, OsBSG1, in rice. The CDS is 2580 base pairs long and encodes an 859-amino acid protein. Comparison of the tolerance of mutants and wild-type rice to the blast fungus revealed that the OsBSG1 mutant exhibits broad-spectrum resistance to rice blast, with improved 1000-grain weight and superior grain quality. This finding suggests widespread application in genetic engineering, with significant economic value and promising prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Figure 1 Construction of the pUbi-Cas9-OsBSG1 vector of the present invention;

[0027] Figure 2 The mutant genotype of the OsBSG1 gene of the present invention;

[0028] Figure 3 The phenotype of the OsBSG1 gene mutant of the present invention at the national rice blast identification base;

[0029] Figure 4 The results of third-party laboratory identification of the OsBSG1 gene mutant of the present invention against rice blast fungus.

[0030] Figure 5 Comparison of grain shape between the OsBSG1 gene mutant of the present invention and the wild type;

[0031] Figure 6 The grain quality of the OsBSG1 gene mutant of the present invention is compared with that of the wild type. DETAILED DESCRIPTION

[0032] The present invention will be described in detail below with reference to the accompanying drawings and specific embodiments. The experimental methods used in the following examples are conventional methods unless otherwise specified, and the materials and reagents used are commercially available reagents and materials unless otherwise specified.

[0033] Example 1 Cloning of a new rice disease susceptibility gene OsBSG1

[0034] Step 1: Preparation of materials

[0035] Rice variety C105TTP-4L-23 was used for RNA extraction, Escherichia coli DH5α, etc.

[0036] Step 2: Cloning of the rice gene OsBSG1

[0037] Based on the annotation information of OsBSG1 (NCBI Reference Sequence: XM_015764352.2), its CDS is 2580 bp long and encodes 859 amino acids. A pair of specific primers was designed using Primer 5.0. Total RNA was extracted from rice seedlings C105TTP-4L-23 at the three-leaf stage using Trizol reagent, and reverse transcribed into cDNA as a PCR reaction template. The PCR reaction system for amplifying the OsBSG1 gene was: 5× PrimeSTAR Buffer (MgCl2) 2+ The total volume was 50 μL. The PCR reaction was performed using 10 μL of 5% dNTP Plus (10 μM each), 4 μL of dNTP Mixture (2.5 mM each), 1.25 μL of OsBSG1-F (10 μM), 1.25 μL of OsBSG1-R (10 μM), 1 μL of cDNA template, and 31.5 μL of sterilized H₂O. The PCR reaction procedure was: 98°C for 2 min → (98°C for 10 s → 58°C for 15 s → 72°C for 3 min) for 30 cycles → 72°C for 10 min → storage at 4°C. The PCR product was detected and purified by 1% agarose gel electrophoresis and treated with the DNAA-Tailing Kit (Takara 6109) for TA cloning using the pMD18-T vector. Three positive clones were selected for sequencing. The CDS of the rice OsBSG1 gene is 2580 bp long and encodes a protein of 859 amino acids. The structure of OsBSG1 protein was analyzed using the CDD tool of NCBI. The protein contains NB-ARC domain and multiple conserved leucine-rich motif (LRR) domains.

[0038] Example 2 Functional identification of a new rice disease susceptibility gene OsBSG1

[0039] Step 1: Preparation of materials

[0040] Rice varieties C105TTP-4L-23 and CO39 (as a disease control for inoculation with rice blast fungus), Cas9 knockout vector: pUbi-Cas9-H, sgRNA cloning vectors: pYLgRNA-OsU6a / LacZ and pYLgRNA-OsU6b, Agrobacterium tumefaciens EHA105.

[0041] Step 2: Construction of pUbi-Cas9-OsBSG1 vector ( Figure 1 )

[0042] Target primers were designed using CRISPR-P (http: / / cbi.hzau.edu.cn / cgi-bin / CRISPR) with reference to the sequenced OsBSG1.

[0043] OsBSG1-T1-F(GCCGCTTGTCAGCGGTCCGAGGAA);

[0044] OsBSG1-T1-R(AAACTTCCTCGGACCGCTGACAAG);

[0045] OsBSG1-T2-F(GTTGGTCACCCGGACTTACGAAA);

[0046] OsBSG1-T2-R(AAACTTTCGTAAGTCCGGGTGAC);

[0047] The target linker ligation reaction was then performed at 95°C for 3 minutes, followed by natural cooling to room temperature. The sgRNA (pYLgRNA-OsU6a / LacZ and pYLgRNA-OsU6b) cloning vectors and the pUbi-Cas9-H expression vector were digested with Bsa I-HF at 37°C for 30 minutes, and the expression vector backbone was purified by gel excision. The target linker was then ligated to the corresponding digested sgRNA at 23°C for 18 minutes. The reaction system was as follows:

[0048]

[0049]

[0050] sgRNA expression cassette construction: Using the above ligation reaction solution as a template, the sgRNA expression cassette was cloned by two rounds of PCR. The first round of PCR reaction conditions were: 94℃30s→(94℃10s→60℃15s→68℃20s)27 cycles→store at 4℃. Each target site corresponds to two first round PCR reactions, using primer pairs

[0051] UF (CTCCGTTTTACCTGTGGAATCG), OsBSG1-T1-R and OsBSG1-T1-F, gR-R (CGGAGGAAAATTCCATCCAC). 1 μL of the two first-round PCR reaction products of the same target site were taken and mixed evenly with 18 μL of sterile water. The mixture was used as the template for the second-round PCR reaction. The PCR reaction primer pairs corresponding to expression cassettes T1 and T2 were: infusion-F (GGCGCGCCGTAGTGCTCGACTAGTATGGAATCGGCAGC);

[0052] infusion-R1(TCAGGGTCCATCCACTCC);

[0053] infusion-F1(GGAGTGGATGGACCCTGACACTGGAATCGGCAGC);

[0054] infusion-R (GGCGCGCCAATGATACCGACCGACGCGTATCCATCCAC); a second round of PCR was performed under the following reaction conditions: 94°C 30s → (94°C 10s → 58°C 15s → 68°C 20s) 20 cycles → 4°C storage, followed by agarose electrophoresis gel recovery of the PCR reaction products. The U6a / Lac-T1-sgRNA and U6b-T2-sgRNA expression cassettes were approximately 800 bp and 500 bp in length, respectively.

[0055] The two sgRNA expression cassettes obtained from the above cloning were ligated with the digested expression vector fragment by infusion to construct pUbi-Cas9-OsBSG1. The ligation reaction conditions were 50°C for 15 minutes. The ligation solution was transformed into competent E. coli DH5α cells, and the culture was selected for sequencing. The plasmid of the sequenced culture was extracted and transformed into Agrobacterium tumefaciens EHA105. Positive clones were selected and stored at -80°C for future use.

[0056] Step 3: Agrobacterium-mediated genetic transformation of rice C105TTP-4L-23

[0057] Take 1000 mature rice seeds, peel off the husk, soak and disinfect in 2.5% sodium hypochlorite for 30 minutes, wash 5 times with sterile water, inoculate the disinfected seeds into callus induction medium, and culture under light at 28°C for 7 days; culture the activated Agrobacterium EHA105 containing the target vector (pUbi-Cas9-OsBSG1) in YEB (50 mg / mL Kan, 50 mg / mL Rif) medium until the OD 600 = 0.5, centrifuged at 4000 rpm for 10 min to collect the bacterial precipitate, and resuspended the bacterial cells in AAM (100 μM As) medium to prepare OD 600 = 0.2 engineering bacterial solution, placed on ice for 1 hour; immerse rice callus in the engineering bacterial solution for 10 minutes, dry the surface bacterial solution with sterile filter paper, inoculate on co-cultivation medium, and culture in the dark at 25°C for 3 days; immerse the infected callus in 500 mg / L carbenicillin solution for 15 minutes, repeat twice, dry the surface moisture of the callus with filter paper, inoculate on screening medium, and culture in the light at 28°C; subculture the newly grown resistant callus blocks on bud induction medium, and culture them in the light at 30°C for 1-2 weeks until adventitious buds grow; subculture the adventitious buds on rooting medium, and culture them in the light at 30°C for 1-2 weeks until most adventitious roots grow out of the seedlings; remove the rooted seedlings, wash the culture medium, immerse the roots of the seedlings in sterile water for 3-7 days to harden the seedlings, and then transplant them to the field or greenhouse.

[0058] DNA of the transformed plants was extracted for molecular identification. Hygromycin primers hygF (CCGGAAGTGCTTGACATTGG) and hygR (GCCGAATTAATTCGGGG) were designed to amplify a section of the hygromycin gene of the transgenic plants. Plants that could amplify a 1035 bp fragment were considered positive. T0 positive transgenic plant seeds were collected, and after sowing, DNA was extracted from young leaves for target site mutation detection. The primers for target site PCR were OsBSG1-TC-F (CTCTCACAGCTAGAGGAG) and OsBSG1-TC-R (GCTCAACCAAGATGGCG). A 517 bp fragment was amplified for sequencing analysis. The sequencing results showed a frameshift mutation (such as Figure 2 The plants (shown in the figure) are homozygous knockout plants, and the seeds of rice varieties M1 (72 bp deletion) and OsBRG2 (5 bp deletion in Target1 and 1 bp insertion in Target2) are homozygous knockout mutants of the OsBSG1 gene.

[0059] Step 4: Field identification of rice blast resistance of the rice gene mutant OsBRG2

[0060] The field test field for rice blast resistance of mutant BSG-2 was established in Chadi Township, Shanghang County, Longyan City, Fujian Province. The test varieties included BSG-2 and its wild type C105TTP-4L-23 (Pi4b), which were planted alternately with the induced varieties with two replicates. The induced varieties were mixed sowing and transplanting of the three most susceptible local varieties, early, mid, and late. The incidence of rice blast in the plants was investigated at the peak tillering stage ( Figure 3 ), while the osbsg2 mutant plants grew normally, with no obvious blast lesions on their leaves. Wild-type C105TTP-4L-23 (Pi4b) and induced rice varieties developed severe blast, with all leaves infected by the fungus. Leaf blast caused the entire plant to wilt, demonstrating that knocking out the OsBSG1 gene enhances field resistance to blast.

[0061] Step 5. Laboratory identification of rice blast resistance of the rice gene mutant OsBSG2

[0062] Thirty-two strains of rice blast disease isolated and preserved by the Institute of Plant Protection, Fujian Academy of Agricultural Sciences, were cultured in rice bran medium at 25-30°C for 6-8 days until spores formed. The wild-type C105TTP-4L-23 (Pi4b), mutant, and susceptible control variety CO39 were germinated in a 30°C incubator for 3 days, then sown in separate plots in a nursery and cultured until they had three leaves and one heart. A high-pressure atomizer was used to spray the rice seedlings with 1.0×10 5 / mL of rice blast fungus spore suspension, control temperature and humidity to promote disease development, investigate the disease situation 7-10 days after inoculation, calculate the strain resistance rate, and conduct a comprehensive disease resistance evaluation. The classification standards are: disease-resistant (R): strain resistance rate greater than 80%; moderately resistant (MR): strain resistance rate greater than 60%, less than or equal to 80%; moderately susceptible (MS): strain resistance rate greater than 40%, less than or equal to 60%; susceptible (S): strain resistance rate greater than 5%, less than or equal to 40%; highly susceptible (HS): strain resistance rate less than or equal to 5%. The identification results are shown in Table 1. Figure 4 The control variety CO39 had a 0% resistance rate and was identified as highly susceptible (HS) in laboratory testing. The OsBSG1 mutants (H5 and H6) both showed resistance rates exceeding 80%, demonstrating broad-spectrum resistance and were identified as resistant (R) in laboratory testing. The wild-type C105TTP-4L-23 (Pi4b) had a resistance rate of 15.38% and was identified as susceptible (S). This indicates that the OsBSG1 gene promotes rice blast in C105TTP-4L-23, and knocking out this gene increased resistance and enhanced laboratory blast resistance. In summary, knocking out the OsBSG1 gene enhanced rice blast resistance both in the field and in the laboratory, indicating that OsBSG1 is a novel gene for rice blast susceptibility.

[0063] Table 1 Identification results of rice varieties resistant to rice blast at the seedling stage

[0064] Variety number Variety name Antibacterial rate (%) Comprehensive evaluation H4 Pi4b 15.38 S H5 OsBSG2 81.48 R H6 M1 96.43 R CK CO39 0 HS

[0065] Step 6. Analysis of grain traits of the rice gene knockout mutant OsBRG2

[0066] The wild-type and mutant rice were germinated and planted in an experimental field in Baitang Town, Hanjiang District, Putian City, Fujian Province. The rice was harvested at maturity and dried to measure the 1,000-grain weight, grain length, and chalky grain rate. The grain length of the OsBSG1 gene knockout mutant M-1 was significantly longer than that of the wild-type, while the grain length of the mutant osbsg2 was not significantly different from that of the wild-type ( Figure 5 The 1000-grain weight of the grains was measured and it was found that the 1000-grain weight of the mutant osbsg2 was higher than that of the wild type, indicating that the OsBRG1 gene can increase the 1000-grain weight of rice ( Figure 6 b). The rice grains were further shelled and analyzed for quality. The wild type rice had more chalky grains ( Figure 6 a), The results of the chalky grain rate test showed that the chalky grain rate of rice mutants M-1 and osbsg2 was significantly lower than that of the wild type ( Figure 6 c), indicating that the OsBRG1 gene can reduce chalky grains in rice and improve rice quality.

[0067] The above description is only a preferred embodiment of the present invention. All equivalent changes and modifications made according to the scope of the patent application of the present invention should fall within the scope of the present invention.

Claims

1. A new rice disease-susceptibility gene mutant OsBSG2, characterized in that: The mutant OsBSG2 is a Cas9 gene knockout mutant of OsBSG1, and the nucleotide sequence of the OsBSG1 gene is shown in SEQ ID NO.1; the OsBSG2 is a deletion of 1071bp to 1075bp of the OsBSG1 gene, and the base T is inserted between 1149bp and 1150bp of the OsBSG1 gene; the nucleotide sequence of the OsBSG2 is shown in SEQ ID NO.

2.

2. The use of the novel rice disease-susceptibility gene mutant OsBSG2 as claimed in claim 1 in improving the broad-spectrum resistance of rice to rice blast, characterized in that: The deletion of 1071bp to 1075bp of the OsBSG1 gene in rice and the insertion of base T between 1149bp and 1150bp of the OsBSG1 gene can improve the rice blast resistance.

3. Use of the novel rice disease-susceptibility gene mutant OsBSG2 according to claim 1 in improving the thousand-grain weight and quality of rice grains, characterized in that: The deletion of 1071bp to 1075bp of the OsBSG1 gene in rice and the insertion of base T between 1149bp and 1150bp of the OsBSG1 gene can improve the thousand-grain weight and quality of rice grains.

Images