Maize salt-tolerant gene ZmGLK44 and application thereof

Abstract

The invention discloses a corn salt-tolerant gene ZmGLK44 and application thereof. The nucleotide sequence of CDS of the gene ZmGLK44 is as shown in SEQ ID NO: 1. The gene ZmGLK44 is connected to the downstream of an expression vector promoter to construct a recombinant expression vector capable of expressing the protein, and then the expression vector can be introduced into various hosts through a genetic transformation method to obtain a transformant of the transformed ZmGLK44 gene. According to the invention, the corn salt-tolerant gene ZmGLK44 is introduced into the corn strain C01, so that the drought-resistant phenotype and the drought-resistant physiological index of the transgenic plant are obviously improved. The ZmGLK44 gene participates in crop salt stress response and can be used for improving crop salt tolerance.

Description

Technical Field

[0001] The present invention relates to the technical field of corn genetic engineering, and in particular to a corn salt-tolerant gene ZmGLK44 and an application thereof. Background Art

[0002] Maize (Zea may L.) is a cross-pollinated, annual grass plant. It is an important food crop, feed, and industrial raw material. my country faces a significant supply gap, and the lack of arable land is a major constraint on corn production. Combining plant genetic engineering with traditional breeding can accelerate the selection of salt-tolerant varieties, unlock the production potential of saline-alkali land, and expand usable arable land. This has significant implications for ensuring national food security.

[0003] The Golden 2-like (GLK) transcription factor family belongs to the GARP superfamily and is a class of plant-specific transcription factors first identified in maize. GLK transcription factors regulate chloroplast development. In Arabidopsis, the glk1glk2 double mutant is pale green and lacks photosynthetic organogenesis. Overexpression of GLK1 and GLK2 enhances the expression of chlorophyll biosynthesis genes and improves light absorption. GLK transcription factors participate in stress responses. Existing studies have shown that GLKs regulate the production of the key stress-responsive hormones abscisic acid (ABA), salicylic acid (SA), and jasmonic acid (JA). GLK transcription factors have the potential to increase yield. Overexpression of the maize-derived GLK genes ZmGLK1 and ZmGLK2 in rice increased rice yield by 30% to 40%. Given the dual role of GLK transcription factors in yield and stress tolerance, the identification and cloning of maize GLK transcription factors is of great significance for both theoretical and practical research on crop stress tolerance. Summary of the Invention

[0004] The present invention aims to overcome the deficiencies of the prior art and provides a maize salt-tolerance gene ZmGLK44 and its applications. The gene belongs to the GLK transcription factor family and also relates to various applications of the ZmGLK44 gene in improving plant salt tolerance.

[0005] To achieve the above-mentioned purpose, the technical route designed by the present invention is as follows:

[0006] ZmGLK44 gene amplification → ZmGLK44 inducible expression vector construction to obtain transgenic plants → stress resistance phenotype and physiological analysis of transgenic plants. Details are as follows:

[0007] The present invention provides a corn salt-tolerance gene ZmGLK44. The nucleotide sequence of the CDS of the gene ZmGLK44 is shown in SEQ ID NO: 1, and the gene ZmGLK44 is 1024 bp in length.

[0008] The present invention also provides a salt-tolerant protein ZmGLK44 encoded by the gene ZmGLK44. The amino acid sequence of the salt-tolerant protein ZmGLK44 is shown in SEQ ID NO: 2. The protein has a total of 338 amino acids.

[0009] It should be understood that those skilled in the art can, based on the amino acid sequence disclosed herein, substitute, modify, and / or add one or more amino acids to the amino acid sequence disclosed herein without affecting the activity of the protein, thereby obtaining mutant sequences of the protein with at least 90% homology upon protein sequence alignment. Therefore, the present invention also includes derivative proteins with high homology and activity obtained by substituting, modifying, and / or adding one or more amino acids to the amino acid sequence of SEQ ID No. 2.

[0010] The present invention includes nucleotide sequences encoding the above-mentioned proteins.

[0011] In addition, it should be understood that, in view of the codon degeneracy and species-specific codon preferences, those skilled in the art can use codons suitable for expression in a specific species as needed.

[0012] The gene and protein of the present invention can be cloned or isolated from the corn variety B73, or obtained by sequence chemical synthesis.

[0013] The present invention also provides a primer pair for obtaining the CDS sequence of the above-mentioned gene ZmGLK44, wherein the primer pair is:

[0014] ZmGLK44-CDS-KZ-F: ATGGGGCTGGACGTCGGCGG,

[0015] ZmGK44-CDS-KZ-R:TTACACGTATTTCCGGCTGT.

[0016] The present invention also provides a method for obtaining the CDS of the gene ZmGLK44, using maize cDNA having the gene ZmGLK44 as a template and using the following primer pair:

[0017] ZmGLK44-CDS-KZ-F: ATGGGGCTGGACGTCGGCGG,

[0018] ZmGK44-CDS-KZ-R:TTACACGTATTTCCGGCTGT;

[0019] PCR amplification was performed to obtain the CDS of the gene ZmGLK44.

[0020] The present invention also provides an overexpression vector ZZ0153-RD101p-ZmGLK44-3HA, which contains the expression vector of the gene ZmGLK44.

[0021] Furthermore, the expression vector is ZZ0153-RD101p-3HA.

[0022] Use of any one of the following for improving drought resistance of plants, wherein:

[0023] (1) the aforementioned gene ZmGLK44;

[0024] (2) the aforementioned salt-tolerance protein ZmGLK44;

[0025] (3) The above-mentioned overexpression vector ZZ0153-RD101p-ZmGLK44-3HA.

[0026] Furthermore, the plant is corn.

[0027] Use of any of the following in breeding new corn varieties, wherein:

[0028] (1) the aforementioned gene ZmGLK44;

[0029] (2) the aforementioned salt-tolerance protein ZmGLK44;

[0030] (3) The above-mentioned overexpression vector ZZ0153-RD101p-ZmGLK44-3HA.

[0031] Beneficial effects of the present invention:

[0032] The gene ZmGLK44 of the present invention is connected to the downstream of the expression vector promoter to construct a recombinant expression vector capable of expressing the protein, and then the expression vector can be introduced into various hosts through genetic transformation to obtain a transformant carrying the ZmGLK44 gene.

[0033] The present invention introduces the maize salt-tolerance gene ZmGLK44 into the maize line C01, and the drought-resistance phenotype and drought-resistance physiological indicators of the transgenic plants are significantly improved, indicating that the ZmGLK44 gene is involved in crop salt stress response and can be used to improve crop salt tolerance. BRIEF DESCRIPTION OF THE DRAWINGS

[0034] Figure 1 Schematic diagram of the construction of maize stress-inducible vector ZZ0153-RD101P-ZmGLK44-3HA (universal vector map, no Chinese annotations);

[0035] In the figure, a is a vector map of vector ZZ0153-RD101P-3HA;

[0036] b is a vector map of vector ZZ0153-RD101P-ZmGLK44-3HA;

[0037] Figure 2 This is the identification diagram of ZmGLK44 expression in transgenic plants under salt stress;

[0038] In the figure, (a) is a diagram illustrating the vector structure and the positions of primers used for expression level detection;

[0039] (b) is the expression level identification diagram of ZmGLK44 overexpression materials under salt stress;

[0040] Figure 3 This is a diagram of the salt tolerance phenotype analysis of ZmGLK44 transgenic and mutant plants;

[0041] In the figure, (a) is a photograph of the phenotype of the ZmGLK44 overexpression family and its negative control under salt stress;

[0042] (b) is a graph showing the changes in fresh weight of the ZmGLK44 overexpressing line and its negative control under salt stress;

[0043] (c) is a graph showing the dry weight changes of ZmGLK44 overexpressing lines and their negative controls under salt stress;

[0044] (d) is a graph showing the changes in survival rate of ZmGLK44 overexpressing lines and their negative controls under salt stress. DETAILED DESCRIPTION

[0045] The present invention is further described in detail below with reference to specific embodiments so that those skilled in the art can understand.

[0046] Example 1 Cloning of the Maize Salt Tolerance Gene ZmGLK44

[0047] Collect samples of maize variety B73 and extract transcriptome; design primers:

[0048] ZmGLK44-CDS-KZ-F: ATGGGGCTGGACGTCGGCGG, as shown in SEQ ID NO: 3;

[0049] ZmGLK44-CDS-KZ-R: TTACACGTATTTCCGGCTGT, as shown in SEQ ID NO: 4.

[0050] PCR was performed using the genome of corn variety B73 as a template to obtain a PCR product, which was then subjected to electrophoresis and detection. The PCR product was gene ZmGLK44, the nucleotide sequence of its CDS was shown in SEQ ID NO: 1, and its length was 1024 bp; the amino acid sequence of the salt-tolerant protein ZmGLK44 encoded by gene ZmGLK44 was shown in SEQ ID NO: 2, and the protein had a total of 338 amino acids.

[0051] Example 2 Construction of plant drought-induced overexpression vector

[0052] Based on the ZZ0153-RD101p-3HA vector, the cDNA fragment of ZmGLK44 was inserted into the downstream of the RD101 promoter and between the 3HA tag by homologous recombination, and expressed by the RD101 promoter (see Figure 1 Electrophoresis and sequencing analysis showed that we successfully obtained the ZZ0153-RD101p-ZmGLK44-3HA plant overexpression vector, laying the foundation for subsequent transgenic research. The specific steps are as follows:

[0053] 1. ZmGLK44 gene amplification. Based on the CDS sequence of ZmGLK44, a pair of homologous recombination primers were designed for PCR amplification; the primer sequences are as follows:

[0054] ZmGLK44-OE-F:

[0055] 5'-GCACTAGTATCCCGGGAAGGCGCGCCATGGGGCTGGACGTCGG-3', ZmGLK44-OE-R:

[0056] 5'-CGTCGTATGGGTACATGGCCACGTATTTCCGGCTGTAGCC-3';

[0057] Vazyme Phanta Max Super-Fidelity DNA polymerase was used for gene amplification. The reaction system was as follows:

[0058] 2x phanta Buffer 10ul dNTP 0.4ul ZmGLK44-OE-F 0.8ul ZmGLK44-OE-R 0.8ul Phanta max 0.4ul cDNA 0.5ul <![CDATA[ddH2O]]> 7.1ul

[0059] The reaction program was: 95°C for 3 min; 95°C for 15 s; 60°C for 15 s; 72°C for 60 s; 72°C for 5 min; and 35 cycles.

[0060] 2. Preparation of linearized vector:

[0061] The ZZ0153-RD101p-3HA vector was digested with the restriction endonuclease ASCI to linearize the circular vector.

[0062] 3. Detection and recovery of gene PCR products and vector enzyme digestion products:

[0063] PCR products and vector digestion products were detected by agarose gel electrophoresis, and the target fragments were recovered using the Omega Bio-tek GelExtraction Kit.

[0064] 4. Recombination of rubber recovery products:

[0065] Homologous recombination was performed using the Vazyme ClonExpress II One Step Cloning Kit; the reaction system was as follows:

[0066] Linearized vector 0.03 pmol Insert 0.06 pmol 5x CE II buffer 4ul Exnase II 2ul <![CDATA[Add ddH2O to]]> 20ul

[0067] Use a pipette to gently pipette to mix, collect the reaction solution into the bottom of a 0.2ul centrifuge tube after a brief centrifugation; react at 37℃ for 30min in a PCR instrument, and then cool to 4℃.

[0068] 5. Transformation of recombinant products:

[0069] The recombinant product was transformed into DH5α competent cells according to the Molecular Cloning Experiment Guide (Huang Peitang 2002).

[0070] 6. Recombinant plasmid extraction:

[0071] Refer to the Molecular Cloning Laboratory Guide (Huang Peitang 2002).

[0072] 7. Sequencing and identification of recombinant plasmids:

[0073] Colony PCR, plasmid PCR, and sequencing analysis showed that the ZZ0153-RD101p-ZmGLK44-3HA overexpression vector was obtained. The PCR and sequencing primers were:

[0074] RD101p-F: 5'-TCAAATCTGTCCGAATGCC-3',

[0075] RD101p-R: 5'-TCTGGAACGTCGTATGGG-3'.

[0076] Example 3 Obtaining transgenic corn lines

[0077] The vector obtained in Example 2 was sent to Jiangsu Weimi Biotechnology Co., Ltd. for transformation, and the transformation background was maize inbred line C01. The T0 generation transgenic seeds obtained from the company were cultivated to obtain the T1 generation. T1 positive plants were screened by applying herbicides and the seeds were harvested and cultivated to obtain the T2 generation. PCR detection was continued on the T2 generation plants to confirm that no genetic segregation loss of the target gene occurred. Finally, two positive homozygous transgenic maize families containing ZmGLK44 with stable inheritance (i.e., ZmGLK44 transgenic maize plants) and corresponding negative segregation materials were obtained. PCR detection primers were the same as 1.9 ( Figure 2 ).

[0078] Example 4 Detection of expression levels in ZmGLK44 transgenic corn plants

[0079] ZmGLK44 transgenic maize plants (positive transgenic material) and negative segregant material were co-cultivated in 30 x 40 x 15 cm boxes. Under normal conditions, plants were grown to the three-leaf, one-heart stage and then watered with 200 mM NaCl solution. A control group was watered with an equal amount of water. RNA was extracted from the topmost expanded leaf on the eighth day after salt stress. RNA was digested with DNase I and reverse transcribed using Promega MLV reverse transcriptase. Expression levels were then measured using Vazyme SYBR Green Mix. The maize actin gene was used as a control.

[0080] The test results showed that the expression of ZmGLK44 gene was induced by salt stress in the positive transgenic materials ( Figure 2 ). The detection primers used are as follows:

[0081] qZmGLK44-F: 5'-ACGACAAGTCCGAAGGCTAC-3',

[0082] q3HA-R: 5'-TACTGAGCAGCGTAGTCTGG-3';

[0083] qActin-F: 5'-GCTGGATCTTGCTGGCCGTG-3',

[0084] qActin-R: 5'-AGGCGCCACGACCTTGATCT-3'.

[0085] Example 5: Detection of salt tolerance phenotype of ZmGLK44 transgenic corn plants

[0086] 0.1L pots were filled with equal amounts of substrate (peat:vermiculite = 7:3), and four overexpressing plants or corresponding negative isolates were planted in each pot. Plants were grown in a growth chamber at 22-26°C with a 16-h day / 8-h dark cycle. When the plants reached three leaves and one heart, 24 seedlings per pot were watered with 4L of 200mM NaCl solution. Biomass changes were measured after 16 days of treatment. Survival under salt stress: Materials were planted as described above, and survival was determined 21 days after salt stress.

[0087] Under salt stress, the biomass and survival rate of overexpressing plants were significantly higher than those of negative segregants, indicating that ZmGLK44 can be used to improve salt tolerance in maize ( Figure 3 ).

[0088] Although the above embodiments have been described in detail, they are only a part of the embodiments of the present invention, not all of them. People can also obtain other embodiments based on this embodiment without inventiveness, and these embodiments all fall within the scope of protection of the present invention.

Claims

1. A maize salt-tolerance gene ZmGLK44, characterized by: The nucleotide sequence of the CDS of the gene ZmGLK44 is shown in SEQ ID NO:

1.

2. A salt-tolerant protein ZmGLK44 encoded by the gene ZmGLK44 according to claim 1, characterized in that: The amino acid sequence of the salt-tolerant protein ZmGLK44 is shown in SEQ ID NO:

2.

3. A primer pair for obtaining the CDS sequence of the gene ZmGLK44 according to claim 1, characterized in that: The primer pairs are: ZmGLK44-CDS-KZ-F: ATGGGGCTGGACGTCGGCGG, ZmGK44-CDS-KZ-R:TTACACGTATTTCCGGCTGT.

4. A method for obtaining the CDS of the gene ZmGLK44 according to claim 1, characterized in that: The following primer pairs were used with maize cDNA containing gene ZmGLK44 as template: ZmGLK44-CDS-KZ-F: ATGGGGCTGGACGTCGGCGG, ZmGK44-CDS-KZ-R:TTACACGTATTTCCGGCTGT; PCR amplification was performed to obtain the CDS of the gene ZmGLK44.

5. An overexpression vector ZZ0153-RD101p-ZmGLK44-3HA, characterized by: The invention comprises an expression vector of the gene ZmGLK44 according to claim 1.

6. The overexpression vector pZZ0513-ZmMBF1-3HA according to claim 5, characterized in that: The expression vector is ZZ0153-RD101p-3HA.

7. Use of any one of the following for improving salt tolerance of plants, characterized in that: (1) The gene ZmGLK44 according to claim 1; (2) the salt-tolerant protein ZmGLK44 according to claim 2; (3) The overexpression vector ZZ0153-RD101p-ZmGLK44-3HA according to claim 5.

8. The use according to claim 7, characterized in that: The plant is corn.

9. Use of any one of the following in breeding new salt-tolerant corn varieties, characterized in that: (1) The gene ZmGLK44 according to claim 1; (2) the salt-tolerant protein ZmGLK44 according to claim 2; (3) The overexpression vector ZZ0153-RD101p-ZmGLK44-3HA according to claim 5.

Images