Method for improving soybean yield per unit area by expressing xanthine dehydrogenase gene, vector and application

Abstract

The invention discloses a method for increasing soybean per unit yield by expressing a xanthine dehydrogenase gene, a vector and application, the application is the application of a GmXDH1a gene in regulating and controlling soybean branch number and pod number and increasing yield, the nucleotide sequence of the soybean GmXDH1a gene is shown as SEQ ID NO: 1, the vector comprises a plant expression skeleton vector and a GmXDH1a gene coding sequence, and the GmXDH1a gene coding sequence is shown as SEQ ID NO: 2. The method comprises the following steps: transforming the carrier into a soybean explant and obtaining an overexpressed GmXDH1a transgenic seedling. Research finds that by constructing the overexpression vector and introducing the overexpression vector into a receptor soybean plant, the obtained transgenic soybean plant can significantly increase the branch number and pod number of the soybean, thereby effectively improving the per unit area yield of the soybean.

Description

Technical Field

[0001] The present invention relates to the field of genetic engineering, and in particular to a method, a vector and an application for increasing soybean yield by expressing a xanthine dehydrogenase gene. Background Art

[0002] Soybeans are an important oil and protein crop worldwide, boasting high nutritional value and a wide range of uses. They also have a high nitrogen demand, primarily supplied by three pathways: soil nitrogen, nitrogen from fertilizers, and symbiotic nitrogen fixation via rhizobia. Symbiotic nitrogen fixation between soybeans and rhizobia is one of nature's most efficient biological nitrogen fixation systems, providing 50% to 60% of soybeans' nitrogen needs. Therefore, symbiotic nitrogen fixation is a key factor in high soybean yields.

[0003] However, the nitrogen obtained by soybeans through symbiotic nitrogen fixation can be transported in the form of ureides, products of purine metabolism, catalyzed by multiple enzymes. Xanthine dehydrogenase (XDH) is a key enzyme in the ureide biosynthesis pathway, catalyzing the oxidation of xanthine to uric acid. In Arabidopsis, RNA interference (RNAi) targeting AtXDH significantly reduces total XDH protein levels, leading to xanthine accumulation, growth retardation, abnormal fruit development, and seed sterility. However, the effects of XDH and UOX on soybean yield have not been reported.

[0004] Therefore, providing a method that can significantly increase the number of branches and pods of soybeans, thereby effectively improving the soybean yield, is an urgent problem that needs to be solved by those skilled in the art. Summary of the Invention

[0005] In view of this, the present invention provides a method, vector and application for increasing soybean yield by expressing a xanthine dehydrogenase gene.

[0006] In order to solve the above technical problems, the present invention adopts the following technical solutions:

[0007] An application of increasing soybean yield by expressing a xanthine dehydrogenase gene, wherein the application is the application of the GmXDH1a gene in increasing the number of soybean branches and pods or in soybean high-yield breeding. The nucleotide sequence of the soybean GmXDH1a gene is shown in SEQ ID NO: 1.

[0008] Preferably, the gene number of the GmXDH1a gene is Glyma.13G340300, and it also includes a homologous gene Glyma.15G034000 with a homology higher than 90%.

[0009] A vector for increasing soybean yield by expressing a xanthine dehydrogenase gene, the vector comprising a plant expression skeleton vector and the GmXDH1a gene coding sequence.

[0010] Preferably, the backbone carrier is PTF101-3.

[0011] Preferably, the vector construction method comprises the following steps:

[0012] (1) Primer design:

[0013] The primer sequence XDH1a-PTF101-3-F used for amplification of the target fragment is shown in SEQ ID NO: 2;

[0014] XDH1a-PTF101-3-R is shown in SEQ ID NO: 3;

[0015] The primer sequence PTF101-3-F used to identify positive recombinant clones is shown in SEQ ID NO: 4;

[0016] XDH1a-R is shown in SEQ ID NO: 5;

[0017] The primer sequence Bar-F used for detecting and identifying transgenic plants is shown in SEQ ID NO: 6;

[0018] Bar-R is shown in SEQ ID NO: 7;

[0019] The primer sequence GmXDH1a-F used for reverse transcription and quantitative detection is shown in SEQ ID NO: 8;

[0020] GmXDH1a-R is shown in SEQ ID NO: 9;

[0021] (2) Target fragment amplification:

[0022] Perform an amplification reaction using the plasmid containing the gene fragment as a template, and determine the amplification reaction system and amplification reaction procedure;

[0023] Prepare a 0.5% to 2% agarose-TAE solution, melt it in a microwave oven, cool it slightly, add 1% EB staining solution, shake well, and pour it into a mold to make an agarose gel. After the gel solidifies, spot 5 μL of the PCR product, perform electrophoresis at 200V for 10-15 minutes, and then detect the amplified bands using a UV-illuminator.

[0024] (3) Recovery of amplified products:

[0025] 5 μL of PCR product was added to 1 μL of 6× DNA loading buffer, mixed thoroughly, and then subjected to agarose gel electrophoresis. The electrophoresis results showed that the product was correct. Subsequently, the remaining 45 μL of PCR product was recovered and purified using a product recovery kit produced by Shanghai Sangon.

[0026] (4) Homologous recombination connection:

[0027] Homologous recombination uses full-length gold Use the Cloning and Assembly Kit to determine the reaction system; mix the PCR product and vector digestion product in proportion, add the homologous recombinase, and react at 50°C for 30 minutes to transform the competent cells of the large intestine;

[0028] (5) Transform the ligation product into E. coli DH5α competent cells:

[0029] 1) Take 50 μL of frozen DH5α competent cells, add 10 μL of ligation product, gently stir with a pipette tip to mix, and place on ice for 30 minutes;

[0030] 2) Heat shock at 42°C for 1 min 30 sec, cool on ice for 2 min, add 800 μL of antibiotic-free LB liquid medium, and incubate at 37°C with shaking at 150 rpm for 50 min;

[0031] 3) Collect the cells by centrifugation at 4000 rpm for 5 min, resuspend the cells, and evenly spread them on LB solid medium plates containing 100 μg / mL spectinomycin. Incubate the plates in an inverted manner at 37°C overnight.

[0032] (6) Screening of recombinant clones:

[0033] Single colonies grown on the plate were identified by colony PCR using vector primer PTF101-F and intermediate primer XDH1a-R. The reaction system was determined. Plaques were picked up with a pipette tip and mixed into the system before PCR reaction. The reaction procedure was determined. After the PCR reaction was completed, the products were identified by electrophoresis. Positive clones should obtain a PCR product of about 1000 bp.

[0034] A host microorganism transformed with the co-expression vector according to claims 3-5, wherein the host is Agrobacterium tumefaciens EHA101.

[0035] Preferably, the method for transforming the recombinant plasmid into Agrobacterium tumefaciens EHA101 competent cells comprises the following steps:

[0036] 1) Take out 50 μL of frozen Agrobacterium competent cells from the -80°C freezer, thaw on ice, add 10 μL of the constructed recombinant plasmid, mix gently, and place on ice for 30 minutes;

[0037] 2) Incubate in liquid nitrogen for 5 min, heat shock at 37°C in a metal bath for 5 min, then add 800 μL of LB-free liquid medium and incubate at 28°C in a shaker at 150 rpm for 3-4 h;

[0038] 3) Centrifuge at 4,000 rpm for 10 minutes, discard the supernatant, add 100 μL of LB liquid medium, suspend the bacteria, and spread them on LB solid plates containing antibiotics corresponding to the plasmid to be transformed. Place the plates in a 28°C incubator for about 2 days until single colonies grow;

[0039] 4) Colony PCR was used to verify that the plasmid was successfully transformed into Agrobacterium tumefaciens EHA101, and the reaction system and procedure were determined. The PCR results were then analyzed by electrophoresis.

[0040] 5) Select positive colonies and inoculate them into 5 mL of LB liquid medium containing the corresponding antibiotics. Cultivate the culture at 28°C and 200 rpm overnight. Add an equal volume of 30% glycerol to the culture medium and freeze it at -80°C for hairy root transformation.

[0041] The co-expression vector or the host microorganism is used to increase the number of soybean branches, pods or breeding.

[0042] A method for increasing soybean yield by expressing a xanthine dehydrogenase gene comprises the following steps: transforming a soybean explant with the vector and obtaining a transgenic seedling over-expressing GmXDH1a.

[0043] Preferably, the number of branches and pods is significantly higher than that of the wild-type control.

[0044] Compared with the prior art, the present invention has achieved the following technical effects:

[0045] (1) The present study found that, compared with the wild-type control, the GmXDH1a overexpression line can significantly increase the number of soybean branches and pods;

[0046] (2) This invention demonstrates for the first time that overexpression of GmXDH1a can significantly increase soybean yield. BRIEF DESCRIPTION OF THE DRAWINGS

[0047] Figure 1 The GmXDH1a vector map of the present invention was used to insert the target gene with a length of 4077 bp into the multiple cloning sites XbaI and BamHI of the PTF101:GFP-3 vector;

[0048] Figure 2 The figure shows the yield indicators of the GmXDH1a overexpression line of the present invention and wild-type soybean. (a) is W82; (b) is GmXDH1a OE-2; (c) is GmXDH1a OE-4; (A) is the relative expression level of W82 and GmXDH1a genes; (B) is the number of soybean branches; and (C) is the number of soybean pods. DETAILED DESCRIPTION

[0049] The following will clearly and completely describe the technical solutions in the embodiments of the present invention in conjunction with the accompanying drawings. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative efforts are within the scope of protection of the present invention.

[0050] The present invention discloses an application for increasing soybean yield by expressing a xanthine dehydrogenase gene, wherein the application is an application of the GmXDH1a gene for increasing the number of soybean branches and pods or in soybean high-yield breeding. The nucleotide sequence of the soybean GmXDH1a gene is shown in SEQ ID NO: 1, the gene number of the GmXDH1a gene is Glyma.13G340300, and the gene number of the GmXDH1a gene is Glyma.15G034000, which also includes a homologous gene Glyma.15G034000 with a homology higher than 90%.

[0051] The present invention also discloses a vector for increasing soybean yield by expressing a xanthine dehydrogenase gene. The vector comprises a plant expression skeleton vector and the GmXDH1a gene coding sequence, and the skeleton vector is PTF101-3.

[0052] The invention also discloses a host microorganism transformed with a co-expression vector, wherein the host is Agrobacterium tumefaciens EHA101.

[0053] The invention also discloses the use of the co-expression vector or the host microorganism in increasing the number of soybean branches and pods or in breeding.

[0054] The present invention also discloses a method for increasing soybean yield by expressing xanthine dehydrogenase gene, wherein the vector is transformed into soybean explants to obtain transgenic seedlings over-expressing GmXDH1a.

[0055] The number of branches and pods was significantly higher than that of the wild type control.

[0056] Example 1: Vector construction

[0057] The nucleotide sequence of soybean GmXDH1a gene is shown in SEQ ID NO: 1.

[0058] SEQ ID No.1:

[0059]

[0060] (1) Primer design:

[0061] In the present invention, the primer sequences used for amplification of the target fragment are as follows (the underlined sequences are homology arms and corresponding restriction enzyme cutting sites):

[0062] XDH1a-PTF101-3-F:

[0063] TGTTGACTCGACAGTCTAGA ATGGGATCGTTGAAGACGG (SEQ ID NO: 2)

[0064] XDH1a-PTF101-3-R:

[0065] CCCTTGCTCACCATGGATCC AACACTAAGTTTGGGATGGAA (SEQ ID NO: 3)

[0066] In the present invention, the primer sequences used to identify positive recombinant clones are as follows:

[0067] PTF101-3-F:GCTCAGATCTGTTAGCAACTG (SEQ ID NO: 4)

[0068] XDH1a-R:GGTTTGCTGGAACACAGAT (SEQ ID NO: 5)

[0069] In the present invention, the primer sequences used to detect and identify transgenic plants are as follows:

[0070] Bar-F: AAGGATAGTGGGATTGTGCG (SEQ ID NO: 6)

[0071] Bar-R: AGTCGGGAAACCTGTCGTG (SEQ ID NO: 7)

[0072] In the present invention, the primer sequences used for reverse transcription and quantitative detection are as follows:

[0073] GmXDH1a-F:CAATATTTGATGCATTCCGGGT (SEQ ID NO: 8)

[0074] GmXDH1a-R:TATCCATTATCACCACCTACGC (SEQ ID NO: 9)

[0075] (2) Target fragment amplification:

[0076] The amplification reaction was performed using the plasmid containing the gene fragment as a template. The amplification reaction system is shown in Table 1, the amplification reaction procedure is shown in Table 2, the amplification primer sequences are shown in SEQ ID No. 2 and SEQ ID No. 3, and the amplification product sequence is shown in SEQ ID No. 1.

[0077] Table 1: Reaction system

[0078]

[0079] Table 2: Reaction Procedure

[0080]

[0081] In the second step, the annealing temperature (55°C) is determined based on the primer Tm values, and the extension time (4 min) is determined based on the target fragment length, typically 1 kb / min. Prepare a 0.5% to 2% agarose-TAE solution. Melt it in a microwave oven, cool it slightly, add 1% EB staining solution, shake well, and pour it into a mold to create an agarose gel. After the gel solidifies, apply 5 μL of the PCR product and perform electrophoresis at 200V for 10-15 minutes. Amplified bands are then detected using a UV-illuminator.

[0082] (3) Recovery of amplified products:

[0083] 5 μL of PCR product was added to 1 μL of 6× DNA loading buffer, mixed thoroughly, and then subjected to agarose gel electrophoresis. The electrophoresis results showed correct results. Subsequently, the remaining 45 μL of PCR product was recovered and purified using a product recovery kit produced by Shanghai Sangon.

[0084] (4) Homologous recombination connection:

[0085] Homologous recombination uses full-length gold Cloning and Assembly Kit, reaction system is as follows:

[0086] Table 3: Reaction system

[0087]

[0088] The PCR product and the vector digestion product were mixed in proportion and added with homologous recombinase, and then reacted at 50°C for 30 minutes to transform the competent cells of large intestine.

[0089] (5) Transform the ligation product into E. coli DH5α competent cells:

[0090] 1) Take 50 μL of frozen DH5α competent cells, add 10 μL of ligation product, gently stir with a pipette tip to mix, and place on ice for 30 minutes;

[0091] 2) Heat shock at 42°C for 1 min 30 sec, cool on ice for 2 min, add 800 μL of antibiotic-free LB liquid medium, and incubate at 37°C with shaking at 150 rpm for 50 min;

[0092] 3) The cells were collected by centrifugation at 4000 rpm for 5 min, resuspended, and evenly spread on LB solid medium plates containing 100 μg / mL spectinomycin, and incubated in an inverted manner at 37°C overnight.

[0093] (6) Screening of recombinant clones:

[0094] Single colonies grown on the above plates were identified by colony PCR using the vector primer PTF101-F (sequence shown in SEQ ID No. 4) and the intermediate primer XDH1a-R (sequence shown in SEQ ID No. 5). The reaction system is shown in Table 4. Plaques were picked with a pipette tip and mixed into the system before PCR reaction. The reaction procedure is shown in Table 5. After the PCR reaction, the products were identified by electrophoresis. Positive clones should produce a PCR product of approximately 1000 bp.

[0095] Table 4: Reaction system

[0096]

[0097] Table 5: Reaction Procedure

[0098]

[0099] The positive clone plasmids were extracted and sequenced as follows:

[0100] (1) Pick a single positive clone and culture it in LB liquid medium containing 100 μg / mL spectinomycin, shake at 37°C and 200 rpm overnight;

[0101] 2) Take 4 mL of bacterial solution and centrifuge at 8000 rpm for 2 min to collect the bacteria;

[0102] 3) Discard the supernatant, add 250 μL of Buffer P1 to the bacterial pellet, and resuspend the cells by pipetting.

[0103] 4) Add 250 μL of Buffer P2, mix gently by inversion 8 times, and let stand at room temperature for 3 min;

[0104] 5) Add 350 μL of Buffer P3, gently invert to mix, and centrifuge at 12,000 rpm for 10 min;

[0105] 6) Use a pipette to transfer the supernatant to the adsorption column, centrifuge at 12,000 rpm for 30 seconds, discard the liquid in the collection tube, and replace the adsorption column;

[0106] 7) Add 500 μL of Buffer DW1 to the adsorption column, centrifuge at 9000 rpm for 30 seconds, discard the liquid in the collection tube, and replace the adsorption column;

[0107] 8) Add 500 μL of Wash Solution to the adsorption column, centrifuge at 9000 rpm for 30 seconds, discard the liquid in the collection tube, and replace the adsorption column;

[0108] 9) Repeat step 8) once;

[0109] 10) Place the empty adsorption column and collection tube into a centrifuge and centrifuge at 9000 rpm for 1 min.

[0110] 11) After the residual alcohol on the adsorption column membrane evaporates, add 35 μL of Elution Buffer to the center of the membrane, let it stand for 2 minutes, and centrifuge at 9000 rpm for 1 minute to collect the plasmid;

[0111] 12) Take 5 μL of the obtained plasmid for sequencing. The sequencing primers are vector primers PTF101-3-F and GmXDH1a-PTF101-3-R. The plasmid with correct sequencing is used for subsequent experiments.

[0112] Example 2: Creation of Stable Transgenic Plants

[0113] (1) Transformation of recombinant plasmid into competent Agrobacterium tumefaciens EHA101:

[0114] 1) Take out 50 μL of frozen Agrobacterium competent cells from the -80°C freezer, thaw on ice, add 10 μL of the constructed recombinant plasmid, mix gently, and place on ice for 30 minutes;

[0115] 2) Incubate in liquid nitrogen for 5 min, heat shock at 37°C in a metal bath for 5 min, then add 800 μL of LB-free liquid medium and incubate at 28°C in a shaker at 150 rpm for 3-4 h;

[0116] 3) Centrifuge at 4,000 rpm for 10 minutes, discard the supernatant, add 100 μL of LB liquid medium, suspend the bacteria, and spread them on LB solid plates containing antibiotics corresponding to the plasmid to be transformed. Place the plates in a 28°C incubator for about 2 days until single colonies grow;

[0117] 4) Colony PCR was used to detect whether the plasmid was successfully transformed into Agrobacterium tumefaciens EHA101. The reaction system and reaction procedure are shown in Tables 4 and 5, respectively. The primers are shown in SEQ ID NO: 6 and SEQ ID NO: 7. The PCR identification results were detected by electrophoresis.

[0118] 5) Select positive colonies and inoculate them into 5 mL of LB liquid medium containing the corresponding antibiotics. Cultivate the culture at 28°C and 200 rpm overnight. Add an equal volume of 30% glycerol to the culture medium and freeze it at -80°C for hairy root transformation.

[0119] (2) Stable transformation of soybean cotyledonary nodes:

[0120] 1) Activation of strains: Streak the Agrobacterium strain containing the target gene on YEP solid medium supplemented with the corresponding antibiotics. After the colony grows, inoculate a single colony into 5 mL YEP liquid medium and culture at 28°C, 200 rpm until the OD 600 = around 1.0;

[0121] 2) Bean disinfection and sterilization: Select soybean seeds with intact and plump seed coats and treat them with chlorine disinfection for 12 hours;

[0122] 3) Germination of soybeans and bacterial plate application. Soak the sterilized soybeans in distilled water for 12 hours. Meanwhile, apply 1 mL of the activated bacterial solution to YEP solid medium containing the appropriate antibiotics and incubate in a 28°C bacterial incubator for approximately 16 hours.

[0123] 4. Explant Preparation and Infection: Using a #15 scalpel blade, cut the imbibed soybean seeds longitudinally along the hilum, separating the cotyledons and removing the seed coat. Trim the hypocotyl at the cotyledonary segment to approximately 3 mm, and remove any remaining buds attached to the cotyledonary segment. Thoroughly soak the explants in infection medium mixed with bacterial solution, shake at 80 rpm for 1 hour, and incubate at 24°C overnight.

[0124] 5) Explant co-cultivation: Place the infected seeds face up on sterile filter paper, remove excess bacterial solution, and transfer the explants to co-cultivation medium. Incubate at 24°C, 18:6 photoperiod for 3-5 days.

[0125] 6) Cluster Shoot Induction: Explants were briefly washed in Shoot Induction Washing Medium, drained with sterile filter paper, and then transferred to Shoot Induction Medium. Incubate at 24°C with an 18:6 photoperiod for 14 days. After 14 days, the explants were transferred to fresh Shoot Induction Medium.

[0126] 7) Cluster shoot elongation: After 4 weeks of culture on Shoot Induction medium, a fresh wound was made at the base of the adventitious bud of the explant and the explant was briefly washed in Shoot Induction Washing medium. The explant was then transferred to Shoot Elongation medium and cultured at 24°C under a photoperiod of 18:6. The explant was transferred to fresh Shoot Elongation medium every 2 weeks.

[0127] 8) Transfer to Rooting Medium: During the transfer to Shoot Elongation Medium, when seedlings begin to emerge and grow to more than 3 cm, they can be transferred to Rooting Medium for rooting. Incubate at 24°C, 18:6 light conditions for 1-2 weeks. After new roots grow, transfer the seedlings to vermiculite for further growth.

[0128] (3) CTAB method for extracting soybean leaf DNA:

[0129] 1) Grinding the stable transgenic positive seedling sample obtained in Example 2 into powder using a tissue grinder;

[0130] 2) Add 650 μL of CTAB DNA extraction buffer, shake to mix, and incubate at 65°C for 20 min;

[0131] 3) Add 0.5 times the volume of chloroform, shake vigorously to mix, and centrifuge at 12000 rpm for 10 min;

[0132] 4) Take the supernatant and place it in a new 1.5 mL centrifuge tube. Add 2 volumes of anhydrous ethanol and incubate at -20°C for 30 minutes.

[0133] 5) Centrifuge at 12000 rpm for 10 min, discard the supernatant, air dry at room temperature, dissolve in 50 μL ddH2O, and store at 4°C until use.

[0134] (4) Detection of plant bar genes:

[0135] The system using ddH2O and background plant W82 as templates was used as a negative control, and the system using a plasmid containing the Bar gene as a template was used as a positive control. The reaction system is shown in Table 7, the reaction procedure is shown in Table 8, and the detection primers are shown in SEQ ID NO: 6 and SEQ ID NO: 7.

[0136] Table 6: Reaction system

[0137]

[0138] Table 7: Reaction Procedure

[0139]

[0140]

[0141] (5) Reversal and quantitative detection:

[0142] The stable transgenic positive seedling samples obtained in Example 2 were used to extract RNA from the samples using TRIpure Reagent, and then reversed into cDNA using RNA reverse transcriptase. Finally, quantitative PCR was performed, and the quantitative detection primer sequences were as shown in SEQ ID NO: 8 and SEQ ID NO: 9.

[0143] Example 3: Regulation of soybean yield

[0144] Experimental materials: two overexpression strains GmXDH1aOE-2 and GmXDH1aOE-4 and Williams 82 (W82 was from the Agricultural Resources Research Center, Institute of Genetics and Developmental Biology, Chinese Academy of Sciences). Williams 82 (W82) was the control group, and the two GmXDH1a overexpression strains XDH1aOE-2 and GmXDH1aOE-4 were the experimental groups.

[0145] Experimental Methods: In mid-June 2024, a control (WT) group and two GmXDH1a overexpressing lines, XDH1aOE-2 and GmXDH1aOE-4, were transplanted at the Huazhong Agricultural University Transgenic Base in Wuhan, Hubei Province (30°27′56.6″N, 114°21′18.3″E). Planting density was uniform. Yield-related traits were evaluated at soybean maturity.

[0146] like Figure 1 This is the GmXDH1a vector map of the present invention. The target gene with a length of 4077 bp was inserted between the multiple cloning sites XbaI and BamHI of the PTF101:GFP-3 vector.

[0147] according to Figure 2 It can be seen that the number of branches of the GmXDH1a overexpression lines XDH1aOE-2 and XDH1aOE-4 was significantly more than that of the W82 group, and the number of pods per plant was also significantly higher than that of the W82 group.

[0148] The above description is merely a preferred embodiment of the present invention and does not limit the technical scope of the present invention. Therefore, any minor modifications, equivalent changes and modifications made to the above embodiments based on the technical essence of the present invention are still within the scope of the technical solution of the present invention.

Claims

1. An application for increasing soybean yield by expressing xanthine dehydrogenase gene, characterized in that: The application is the application of the GmXDH1a gene in increasing the number of soybean branches and pods or in soybean high-yield breeding. The nucleotide sequence of the soybean GmXDH1a gene is shown in SEQ ID NO:

1.

2. The use according to claim 1, characterized in that The gene number of the GmXDH1a gene is Glyma.13G340300, and it also includes a homologous gene Glyma.15G034000 with a homology higher than 90%.

3. A vector for increasing soybean yield by expressing a xanthine dehydrogenase gene, characterized in that: The vector comprises a plant expression backbone vector and the GmXDH1a gene coding sequence.

4. A vector for increasing soybean yield by expressing xanthine dehydrogenase gene according to claim 3, characterized in that: The backbone vector is PTF101-3.

5. The vector for increasing soybean yield by expressing xanthine dehydrogenase gene according to claim 3, characterized in that: The vector construction method comprises the following steps: (1) Primer design: The primer sequence XDH1a-PTF101-3-F used for amplification of the target fragment is shown in SEQ ID NO: 2; XDH1a-PTF101-3-R is shown in SEQ ID NO: 3; The primer sequence PTF101-3-F used to identify positive recombinant clones is shown in SEQ ID NO: 4; XDH1a-R is shown in SEQ ID NO: 5; The primer sequence Bar-F used for detecting and identifying transgenic plants is shown in SEQ ID NO: 6; Bar-R is shown in SEQ ID NO: 7; The primer sequence GmXDH1a-F used for reverse transcription and quantitative detection is shown in SEQ ID NO: 8; GmXDH1a-R is shown in SEQ ID NO: 9; (2) Target fragment amplification: Perform an amplification reaction using the plasmid containing the gene fragment as a template, and determine the amplification reaction system and amplification reaction procedure; Prepare a 0.5% to 2% agarose-TAE solution, melt it in a microwave oven, cool it slightly, add 1% EB staining solution, shake well, and pour it into a mold to make an agarose gel. After the gel solidifies, spot 5 μL of the PCR product, perform electrophoresis at 200V for 10-15 minutes, and then detect the amplified bands using a UV-illuminator. (3) Recovery of amplified products: 5 μL of PCR product was added to 1 μL of 6× DNA loading buffer, mixed thoroughly, and then subjected to agarose gel electrophoresis. The electrophoresis results showed that the product was correct. Subsequently, the remaining 45 μL of PCR product was recovered and purified using a product recovery kit produced by Shanghai Sangon. (4) Homologous recombination connection: Homologous recombination uses full-stranded gold -UniSeamless Cloning and Assembly Kit, determine the reaction system; mix the PCR product and vector digestion product in proportion, add the homologous recombinase, and react at 50℃ for 30 minutes to transform the competent cells of large intestine; (5) Transform the ligation product into E. coli DH5α competent cells: 1) Take 50 μL of frozen DH5α competent cells, add 10 μL of ligation product, gently stir with a pipette tip to mix, and place on ice for 30 minutes; 2) Heat shock at 42°C for 1 min 30 sec, cool on ice for 2 min, add 800 μL of antibiotic-free LB liquid medium, and incubate at 37°C with shaking at 150 rpm for 50 min; 3) Collect the cells by centrifugation at 4000 rpm for 5 min, resuspend the cells, and evenly spread them on LB solid medium plates containing 100 μg / mL spectinomycin. Incubate the plates in an inverted manner at 37°C overnight. (6) Screening of recombinant clones: Single colonies grown on the plate were identified by colony PCR using vector primer PTF101-F and intermediate primer XDH1a-R. The reaction system was determined. Plaques were picked up with a pipette tip and mixed into the system before PCR reaction. The reaction procedure was determined. After the PCR reaction was completed, the products were identified by electrophoresis. Positive clones should obtain a PCR product of about 1000 bp.

6. A host microorganism, characterized in that The co-expression vector according to claim 3-5 is transformed, and the host is Agrobacterium tumefaciens EHA101.

7. A host microorganism according to claim 6, characterized in that The method for transforming the recombinant plasmid into the competent Agrobacterium tumefaciens EHA101 comprises the following steps: 1) Take out 50 μL of frozen Agrobacterium competent cells from the -80°C freezer, thaw on ice, add 10 μL of the constructed recombinant plasmid, mix gently, and place on ice for 30 minutes; 2) Incubate in liquid nitrogen for 5 min, heat shock at 37°C in a metal bath for 5 min, then add 800 μL of LB-free liquid medium and incubate at 28°C in a shaker at 150 rpm for 3-4 h; 3) Centrifuge at 4,000 rpm for 10 minutes, discard the supernatant, add 100 μL of LB liquid medium, suspend the bacteria, and spread them on LB solid plates containing antibiotics corresponding to the plasmid to be transformed. Place the plates in a 28°C incubator for about 2 days until single colonies grow; 4) Colony PCR was used to verify that the plasmid was successfully transformed into Agrobacterium tumefaciens EHA101, and the reaction system and procedure were determined. The PCR results were then analyzed by electrophoresis. 5) Select positive colonies and inoculate them into 5 mL of LB liquid medium containing the corresponding antibiotics. Cultivate the culture at 28°C and 200 rpm overnight. Add an equal volume of 30% glycerol to the culture medium and freeze it at -80°C for hairy root transformation.

8. Use of the co-expression vector according to claims 3-5 or the host microorganism according to claims 6-7 in increasing the number of soybean branches, pods or breeding.

9. A method for increasing soybean yield by expressing a xanthine dehydrogenase gene, characterized in that: The vector was used to transform soybean explants and obtain transgenic seedlings overexpressing GmXDH1a.

10. The transgenic soybean plant obtained by the method according to claim 9, characterized in that The number of branches and pods was significantly higher than that of the wild type control.

Images