Biological preparation method and application of group of taxane compounds

Abstract

The invention discloses a biological preparation method and application of a group of taxane compounds. Specifically, the preparation of a group of novel taxane compounds is realized and the biological activity of the taxane compounds is determined by utilizing an established whole-cell or in-vitro catalysis technology. In addition, it is found for the first time that in the presence of one or more specific enzymes selected from cytochrome P450 enzyme, benzoyltransferase and acetyltransferase, substrates are catalyzed to generate respective corresponding products.

Description

Technical Field

[0001] The present invention belongs to the fields of medicine and biotechnology engineering, and in particular relates to a biological preparation method and application of a group of taxane compounds. Background Art

[0002] Taxanes are a class of diterpenoid compounds with diverse biological activities, primarily derived from Taxus plants. Paclitaxel, the renowned anticancer drug, is the most prominent representative of these taxanes. Currently, taxanes are primarily isolated and purified from Taxus plants. However, the long growth cycle, low taxane content, and complex taxonomic diversity of Taxus plants pose significant challenges in their extraction and purification, significantly limiting their drug development and industrial application. In recent years, the emerging field of natural product synthetic biology has provided new avenues for the biosynthesis of taxanes.

[0003] Therefore, there is an urgent need in the art to develop a new method for preparing taxane compounds by heterologously expressing enzymes involved in taxane synthesis in microorganisms and using the expression products (various enzyme proteins) or constructed microorganisms for de novo synthesis, whole-cell catalysis, and in vitro enzymatic catalysis. Summary of the Invention

[0004] The purpose of the present invention is to provide a novel method for preparing taxane compounds by heterologously expressing enzymes involved in taxane synthesis in microorganisms and utilizing the expression products (various enzyme proteins) or constructed microorganisms for de novo synthesis, whole-cell catalysis, and in vitro enzyme catalysis.

[0005] The first aspect of the present invention provides a taxane compound or a pharmaceutically acceptable salt thereof having the structure shown below:

[0006]

[0007]

[0008] The present invention provides a composition comprising: (a) the taxane compound or a pharmaceutically acceptable salt thereof according to the first aspect of the present invention.

[0009] In another preferred embodiment, the content of component (a) in the pharmaceutical composition is 0.0001-99 wt%, preferably 0.01-95 wt%, and more preferably 0.1-90 wt%.

[0010] In another preferred embodiment, the composition further comprises other drugs having tumor treatment, cancer treatment, anti-platelet aggregation and antibacterial activities, as well as drugs for treating autoimmune diseases and nervous system diseases.

[0011] In another preferred embodiment, the other drugs having anti-tumor, anti-cancer, anti-platelet aggregation and antibacterial activities, and drugs for treating autoimmune diseases and nervous system diseases are selected from the following group: paclitaxel, docetaxel, derivatives having a taxane skeleton structure, or a combination thereof.

[0012] In another preferred embodiment, the composition comprises a pharmaceutical composition.

[0013] In another preferred embodiment, the pharmaceutical composition comprises (a) the composition according to the second aspect of the present invention; and (b) a pharmaceutically acceptable carrier.

[0014] In another preferred embodiment, the component (a) accounts for 10-99.9 wt %, preferably 20-99 wt %, and more preferably 50-90 wt % of the total weight of the pharmaceutical composition.

[0015] In another preferred embodiment, the composition includes solid, liquid, and semi-solid compositions.

[0016] In another preferred embodiment, the composition includes a solid dosage form or a liquid dosage form.

[0017] In another preferred embodiment, the composition includes: an oral preparation and a parenteral preparation.

[0018] In another preferred embodiment, the preparation includes: powder, granules, capsules, injections, tinctures, oral liquids, tablets or lozenges.

[0019] In another preferred embodiment, the composition (eg, pharmaceutical composition) is administered to a mammal by the following means: oral administration, intravenous injection, or local injection.

[0020] In another preferred embodiment, the mammal includes a human or a non-human mammal.

[0021] In another preferred embodiment, the non-human mammal includes a rodent, such as a mouse, a rat, or a primate, such as a monkey.

[0022] The third aspect of the present invention provides a use of a taxane compound or a pharmaceutically acceptable salt thereof according to the first aspect of the present invention for preparing a composition or preparation, wherein the composition or preparation is used for one or more uses selected from the group consisting of:

[0023] (a) Treatment of tumors;

[0024] (b) treatment of cancer;

[0025] (c) antibacterial;

[0026] (d) antiplatelet aggregation;

[0027] (e) treatment of autoimmune diseases;

[0028] (f) Nervous system diseases.

[0029] In another preferred embodiment, the autoimmune disease includes rheumatoid arthritis.

[0030] In another preferred embodiment, the nervous system diseases include Alzheimer's disease and Parkinson's disease.

[0031] In another preferred embodiment, the tumor includes Kaposi's sarcoma and solid tumors.

[0032] In another preferred embodiment, the cancer includes non-small cell lung cancer, head and neck cancer, ovarian cancer, cervical cancer, gastric cancer, breast cancer, pancreatic cancer, and colorectal cancer.

[0033] In another preferred embodiment, the antibacterial agent includes plant pathogens such as Gibberella, Cladosporium, Fusarium oxysporum, Cucumis sativus, and Oomycetes.

[0034] The fourth aspect of the present invention provides a method for preparing a taxane compound or a pharmaceutically acceptable salt thereof according to the first aspect of the present invention, comprising the steps of:

[0035] (a) in a reaction system, using the compound of formula I as a substrate, performing an acetylation reaction in the presence of an acetyltransferase to produce a compound of formula II, wherein the amino acid sequence of the acetyltransferase is shown in SEQ ID NO.2;

[0036] or

[0037] (b) in a reaction system, using the compound of formula II as a substrate, and conducting a hydroxylation reaction in the presence of a cytochrome P450 enzyme to produce a compound of formula III, wherein the amino acid sequence of the cytochrome P450 enzyme is shown in SEQ ID NO. 4 or 8;

[0038] or

[0039] (c) in a reaction system, using the compound of formula IV as a substrate, and conducting a hydroxylation reaction in the presence of a cytochrome P450 enzyme to produce a compound of formula V, wherein the amino acid sequence of the cytochrome P450 enzyme is shown in SEQ ID NO. 4 or 8;

[0040] or

[0041] (d) in a reaction system, using the compound of formula VI as a substrate, performing benzoylation and acetylation reactions in the presence of a benzoyltransferase and an acetyltransferase, thereby producing a compound of formula VII, wherein the amino acid sequence of the benzoyltransferase is shown in SEQ ID NO. 10, and the amino acid sequence of the acetyltransferase is shown in SEQ ID NO. 12;

[0042] or

[0043] (e) in a reaction system, using the compound of formula VII as a substrate, conducting an epoxidation reaction in the presence of a cytochrome P450 enzyme to produce a compound of formula VII, wherein the amino acid sequence of the cytochrome P450 enzyme is shown in SEQ ID NO. 14;

[0044]

[0045] and

[0046] (f) optionally isolating the compound of formula II, III, V, VII or VIII from the reaction system after the reaction of steps (a) to (e).

[0047] In another preferred embodiment, in steps (a)-(e), the reaction time is 1-80 hours, preferably 5-50 hours, more preferably 10-30 hours, and even more preferably 20-30 hours.

[0048] In another preferred embodiment, in steps (a)-(e), the reaction temperature is 10°C-50°C, preferably 20°C-40°C, and more preferably 25°C-35°C.

[0049] In another preferred embodiment, in the reaction system, the cytochrome P450 enzyme, benzoyl transferase and acetyl transferase are free enzymes, immobilized enzymes, or bacterial enzymes.

[0050] In another preferred embodiment, in step (f), the separation comprises: adding an extraction solvent, such as tert-methyl ether, dichloromethane, toluene, ethyl acetate, n-hexane, etc., then centrifuging to obtain an organic layer, drying, filtering, and concentrating the organic layer to obtain the product.

[0051] In another preferred embodiment, the method further comprises the step of separating and purifying the product by amplifying the catalytic system.

[0052] In another preferred embodiment, in each reaction system of steps (a) to (e), the concentration of the substrate (compound of Formula I, II, IV, VI, VII) is independently 5-5000 mM, preferably 10-1000 mM, and more preferably 20-500 mM.

[0053] In another preferred embodiment, in step (d), the reaction system further contains benzoyl-CoA and acetyl-CoA.

[0054] In another preferred embodiment, the concentration of benzoyl-CoA is 5-5000 mM, preferably 10-1000 mM, and more preferably 20-500 mM.

[0055] In another preferred embodiment, the concentration of acetyl-CoA is 5-5000 mM, preferably 10-1000 mM, more preferably 20-500 mM.

[0056] In another preferred embodiment, the acetyltransferase encoding gene sequence is selected from the following group:

[0057] (a) the sequence shown in any one of SEQ ID NO. 1 or 11;

[0058] (b) a polynucleotide complementary to the sequence defined in (a); or

[0059] (c) any polynucleotide or complementary sequence having at least 70% (preferably at least 75%, 80%, 85%, 90%, more preferably at least 95%, 96%, 97%, 98%, 99%) sequence identity with the sequence defined in (a).

[0060] In another preferred embodiment, the coding gene sequence of the cytochrome P450 enzyme is selected from the following group:

[0061] (a) the sequence shown in any one of SEQ ID NO. 3, 7 or 13;

[0062] (b) a polynucleotide complementary to the sequence defined in (a); or

[0063] (c) any polynucleotide or complementary sequence having at least 70% (preferably at least 75%, 80%, 85%, 90%, more preferably at least 95%, 96%, 97%, 98%, 99%) sequence identity with the sequence defined in (a).

[0064] In another preferred embodiment, the coding gene sequence of the benzoyl transferase is selected from the following group:

[0065] (a) the sequence shown in SEQ ID NO. 9;

[0066] (b) a polynucleotide complementary to the sequence defined in (a); or

[0067] (c) any polynucleotide or complementary sequence having at least 70% (preferably at least 75%, 80%, 85%, 90%, more preferably at least 95%, 96%, 97%, 98%, 99%) sequence identity with the sequence defined in (a).

[0068] In another preferred embodiment, the acetyltransferase, cytochrome P450 enzyme, and formyltransferase genes are constructed on the genome or expression vector, respectively.

[0069] It should be understood that within the scope of the present invention, the above-mentioned technical features of the present invention and the technical features described in detail below (such as in the embodiments) can be combined with each other to form new or preferred technical solutions. Due to space limitations, they will not be listed here one by one. BRIEF DESCRIPTION OF THE DRAWINGS

[0070] Figure 1 GC-FID analysis of the synthesis of 5α-acetoxytaxadiene-13α-ol catalyzed by ZT5AT is shown. Control represents the synthesis of 5α-acetoxytaxadiene-13α-diol by whole cells of the control strain ZTB80, and ZT5AT represents the synthesis of 5α-acetoxytaxadiene-13α-diol by whole cells of the strain ZT5AT.

[0071] Figure 2 GC-FID analysis of the synthesis of 5α-acetoxytaxadiene-10β,13α-diol catalyzed by ZT10OH. Control represents the synthesis of 5α-acetoxytaxadiene-13α-ol catalyzed by whole cells of the control strain ZTB80, and ZT10OH represents the synthesis of 5α-acetoxytaxadiene-13α-ol catalyzed by whole cells of the strain ZT10OH.

[0072] Figure 3 GC-FID analysis of the synthesis of 5α-acetoxytaxadiene-10β,13α-diol catalyzed by ZTCYP01 is shown. Control represents the synthesis of 5α-acetoxytaxadiene-13α-ol catalyzed by whole cells of the control strain ZTCPR, and ZTCYP01 represents the synthesis of 5α-acetoxytaxadiene-13α-ol catalyzed by whole cells of the strain ZTCYP01.

[0073] Figure 4 HPLC analysis of the synthesis of 5α,13α-diacetoxytaxadiene-10β-ol catalyzed by ZT10OH. Control represents the synthesis of 5α,13α-diacetoxytaxadiene by whole cells of the control strain ZTB80, and ZT10OH represents the synthesis of 5α,13α-diacetoxytaxadiene by whole cells of the strain ZT10OH.

[0074] Figure 5LC-MS analysis of the synthesis of 5α,13α-diacetoxytaxadiene-10β-ol catalyzed by ZTCYP01 is shown. Control represents the synthesis of 5α,13α-diacetoxytaxadiene by whole cells of the control strain ZTCPR, and ZTCYP01 represents the synthesis of 5α,13α-diacetoxytaxadiene by whole cells of the strain ZTCYP01.

[0075] Figure 6 HPLC analysis of the in vitro synthesis of 2α-benzoyl-7β-oxyacetyltaxol by the combined enzymes of ZT2BT and ZAT5 is shown. ZT2BT represents the synthesis of 2α,7β-diacetyltaxol using crude enzymes from ZT2BT, while ZT2BT+ZAT5 represents the synthesis of 2α,7β-diacetyltaxol using crude enzymes from ZT2BT and ZAT5.

[0076] Figure 7 HPLC analysis of ZTCYP02-catalyzed synthesis of 2α-benzoyl-baccatin I is shown. Control represents the catalysis of the substrate 2α-benzoyl-7β-oxyacetyltaxol by whole cells of the control strain ZTCPR, and ZTCYP02 represents the catalysis of the substrate 2α-benzoyl-7β-oxyacetyltaxol by whole cells of the strain ZTCYP02. DETAILED DESCRIPTION

[0077] After extensive and in-depth research, the present inventors have, for the first time, utilized established whole-cell or in vitro catalytic techniques to prepare a new group of taxane compounds and determine their biological activity. Specifically, the present inventors discovered for the first time that, in the presence of one or more specific enzymes selected from cytochrome P450 enzymes, benzoyltransferases, and acetyltransferases, substrates (compounds of Formulas I, II, IV, VI, and VII) are catalyzed to produce their respective products (compounds of Formulas II, III, V, VII, or VIII), with compounds of Formulas II and VII serving as both substrates and products. This foundation led to the completion of the present invention.

[0078] Cytochrome P450 enzymes

[0079] In the present invention, "cytochrome P450 enzyme" is a type of heme protein with biological activities such as hydroxylation, epoxidation, and dehydrogenation.

[0080] In the present invention, the cytochrome P450 enzyme can be wild-type or mutant, isolated or recombinant.

[0081] The amino acid sequence of a typical cytochrome P450 enzyme is shown in SEQ ID No. 4, 8 or 14, and the encoding gene thereof is shown in SEQ ID No. 3, 7 or 13.

[0082] Due to codon degeneracy, the base sequence encoding the amino acid sequence set forth in SEQ ID NOs. 4, 8, or 14 is not limited to SEQ ID NOs. 3, 7, or 13. Those skilled in the art can obtain homologs of the base sequence by appropriately introducing substitutions, deletions, alterations, insertions, or additions, and the present invention encompasses such homologs, as long as the recombinant enzyme expressed thereby maintains catalytic activity toward the substrates Compound II, Compound IV, or Compound VII. Homologs of the polynucleotides of the present invention can be obtained by substituting, deleting, or adding one or more bases of the base sequence of SEQ ID NOs. 3, 7, or 13 while maintaining enzyme activity.

[0083] The cytochrome P450 enzyme of the present invention also includes the amino acid sequence obtained by replacing, deleting, changing, inserting or adding one or more amino acids in the amino acid sequence shown in SEQ ID NO. 4, 8 or 14 while maintaining the enzyme activity.

[0084] According to common knowledge in the art, the reaction system can use the above-mentioned cytochrome P450 enzyme-constructed recombinant enzyme resting cells, wet bacteria, crude enzyme solution, pure enzyme or crude enzyme powder, etc. In order to obtain higher conversion efficiency, crude enzyme solution is preferably used.

[0085] Acetyltransferase

[0086] In the present invention, "acetyltransferase" is an enzyme that transfers an acetyl group in donor acetyl-CoA to an acceptor to acetylate the acceptor.

[0087] In the present invention, the acetyltransferase may be wild-type or mutant, isolated or recombinant.

[0088] The amino acid sequence of a typical acetyltransferase is shown in SEQ ID No. 2 or 12, and the encoding gene thereof is shown in SEQ ID No. 1 or 11.

[0089] Due to codon degeneracy, the base sequence encoding the amino acid sequence set forth in SEQ ID NO. 2 or 12 is not limited to SEQ ID NO. 1 or 11. Those skilled in the art can obtain homologs of the base sequence by appropriately introducing substitutions, deletions, alterations, insertions, or additions, and the present invention encompasses such homologs, as long as the recombinant enzyme expressed thereby maintains catalytic activity toward the substrate Compound I or Compound VI. Homologs of the polynucleotides of the present invention can be obtained by substituting, deleting, or adding one or more bases of the base sequence of SEQ ID NO. 1 or 11 while maintaining enzyme activity.

[0090] The acetyltransferase of the present invention also includes an amino acid sequence obtained by replacing, deleting, changing, inserting or adding one or more amino acids in the amino acid sequence shown in SEQ ID NO. 2 or 12 while maintaining the enzyme activity.

[0091] According to common knowledge in the art, the reaction system can use the above-mentioned acetyltransferase constructed recombinant enzyme resting cells, wet bacteria, crude enzyme solution, pure enzyme or crude enzyme powder, etc. In order to obtain higher conversion efficiency, crude enzyme solution is preferably used.

[0092] Benzoyltransferase

[0093] In the present invention, "formyltransferase" is an enzyme that transfers a benzoyl group in donor benzoyl-CoA to an acceptor, thereby benzoylating the acceptor.

[0094] In the present invention, the formyl transferase may be wild-type or mutant, and may be isolated or recombinant.

[0095] The amino acid sequence of a typical formyltransferase is shown in SEQ ID No. 10, and the encoding gene thereof is shown in SEQ ID No. 9.

[0096] Due to codon degeneracy, the base sequence encoding the amino acid sequence set forth in SEQ ID NO. 10 is not limited to SEQ ID NO. 9. Those skilled in the art can obtain homologs of this base sequence by introducing appropriate substitutions, deletions, alterations, insertions, or additions, and the present invention encompasses such homologs, as long as the recombinant enzyme expressed thereby maintains catalytic activity toward the substrate Compound VI. Homologs of the polynucleotides of the present invention can be obtained by substituting, deleting, or adding one or more bases of the base sequence of SEQ ID NO. 9 while maintaining enzyme activity.

[0097] The benzoyltransferase of the present invention also includes an amino acid sequence obtained by replacing, deleting, changing, inserting or adding one or more amino acids in the amino acid sequence shown in SEQ ID NO. 10 while maintaining the enzyme activity.

[0098] According to common knowledge in the art, the reaction system can use the above-mentioned benzoyltransferase constructed recombinant enzyme resting cells, wet bacteria, crude enzyme solution, pure enzyme or crude enzyme powder, etc. In order to obtain higher conversion efficiency, crude enzyme solution is preferably used.

[0099] Active ingredient

[0100] As used herein, the terms "active ingredient of the present invention," "compound of the present invention," and "taxane compound of the present invention" are used interchangeably to refer to compounds having the structure of Formula II, III, V, VII, or VIII:

[0101]

[0102]

[0103] It should be understood that the term also includes various crystalline forms, pharmaceutically acceptable salts, hydrates or solvates of the compounds of the present invention.

[0104] As used herein, the term "pharmaceutically acceptable salt" refers to a salt formed by a compound of the present invention with an acid or base that is suitable for use as a pharmaceutical. Pharmaceutically acceptable salts include inorganic salts and organic salts. A preferred class of salts is a salt formed by a compound of the present invention with an acid. Salts can be formed by cations and charged groups (e.g., amino groups) on the compound of the present invention. Suitable cations include hydrogen ions, sodium ions, potassium ions, magnesium ions, calcium ions, and ammonium ions. Bases suitable for forming salts include, but are not limited to, hydroxides of alkali metals and alkaline earth metals (e.g., NaOH, KOH), oxides of alkali metals and alkaline earth metals, carbonates of alkali metals and alkaline earth metals (e.g., Na2CO3), ammonia, and the like.

[0105] The present invention has confirmed through experiments that the taxane compound of the present invention has anti-tumor, anti-cancer, anti-platelet aggregation and antibacterial activities, and is significantly superior to known taxane compounds.

[0106] In addition, the taxane compounds of the present invention are also used to treat rheumatoid arthritis and other autoimmune diseases due to their anti-inflammatory and immunomodulatory effects. Furthermore, some studies have shown that taxane compounds may have certain therapeutic effects on neurological diseases, such as Alzheimer's disease and Parkinson's disease.

[0107] Preparation of active ingredients

[0108] The present invention also provides a method for preparing a taxane compound or a pharmaceutically acceptable salt thereof, comprising the steps of:

[0109] (a) in a reaction system, using the compound of formula I as a substrate, performing an acetylation reaction in the presence of an acetyltransferase to produce a compound of formula II, wherein the amino acid sequence of the acetyltransferase is shown in SEQ ID NO.2;

[0110] or

[0111] (b) in a reaction system, using the compound of formula II as a substrate, and conducting a hydroxylation reaction in the presence of a cytochrome P450 enzyme to produce a compound of formula III, wherein the amino acid sequence of the cytochrome P450 enzyme is shown in SEQ ID NO. 4 or 8;

[0112] or

[0113] (c) in a reaction system, using the compound of formula IV as a substrate, and conducting a hydroxylation reaction in the presence of a cytochrome P450 enzyme to produce a compound of formula V, wherein the amino acid sequence of the cytochrome P450 enzyme is shown in SEQ ID NO. 4 or 8;

[0114] or

[0115] (d) in a reaction system, using the compound of formula VI as a substrate, performing benzoylation and acetylation reactions in the presence of a benzoyltransferase and an acetyltransferase, thereby producing a compound of formula VII, wherein the amino acid sequence of the benzoyltransferase is shown in SEQ ID NO. 10, and the amino acid sequence of the acetyltransferase is shown in SEQ ID NO. 12;

[0116] or

[0117] (e) in a reaction system, using the compound of formula VII as a substrate, conducting an epoxidation reaction in the presence of a cytochrome P450 enzyme to produce a compound of formula VII, wherein the amino acid sequence of the cytochrome P450 enzyme is shown in SEQ ID NO. 14;

[0118]

[0119] and

[0120] (f) optionally isolating the compound of formula II, III, V, VII or VIII from the reaction system after the reaction of steps (a) to (e).

[0121] The reaction system of the present invention can also be carried out in cells, or the enzyme of the present invention can be used as an immobilized enzyme to catalyze the reaction.

[0122] Pharmaceutical compositions and methods of administration

[0123] The compounds of the present invention have excellent anti-tumor, anti-cancer, anti-platelet aggregation and antibacterial activities.

[0124] The compounds of the present invention can be administered to mammals (e.g., humans) by oral, rectal, parenteral (intravenous, intramuscular, or subcutaneous), topical, or other routes. The compounds can be administered alone or in combination with other pharmaceutically acceptable compounds. It should be noted that the compounds of the present invention can be administered in combination.

[0125] Solid dosage forms for oral administration include capsules, tablets, pills, powders, and granules. In these solid dosage forms, the active compound is mixed with at least one conventional inert excipient (or carrier), such as sodium citrate or dicalcium phosphate, or with the following ingredients: (a) fillers or extenders, for example, starches, lactose, sucrose, glucose, mannitol, and silicic acid; (b) binders, for example, hydroxymethylcellulose, alginates, gelatin, polyvinyl pyrrolidone, sucrose, and acacia; (c) humectants, for example, glycerol; (d) disintegrants, for example, agar, calcium carbonate, potato or tapioca starch, alginic acid, certain complex silicates, and sodium carbonate; (e) solubilizers, for example, paraffin; (f) absorption accelerators, for example, quaternary ammonium compounds; (g) wetting agents, for example, cetyl alcohol and glyceryl monostearate; (h) adsorbents, for example, kaolin; and (i) lubricants, for example, talc, calcium stearate, magnesium stearate, solid polyethylene glycols, sodium lauryl sulfate, or mixtures thereof. In the case of capsules, tablets and pills, the dosage forms may also comprise buffering agents.

[0126] Solid dosage forms such as tablets, dragees, capsules, pills, and granules can be prepared using coatings and shell materials, such as enteric coatings and other materials known in the art. They may contain opacifying agents, and the release of the active compound or compounds in such compositions can be delayed in a certain portion of the digestive tract. Examples of useful encapsulating components are polymeric substances and waxes. If desired, the active compound can also be microencapsulated with one or more of the above-mentioned excipients.

[0127] Liquid dosage forms for oral administration include pharmaceutically acceptable emulsions, solutions, suspensions, syrups or tinctures. In addition to the active compound, the liquid dosage form may contain an inert diluent conventionally used in the art, such as water or other solvents, solubilizers and emulsifiers, for example, ethanol, isopropyl alcohol, ethyl carbonate, ethyl acetate, propylene glycol, 1,3-butylene glycol, dimethylformamide, and oils, particularly cottonseed oil, peanut oil, corn germ oil, olive oil, castor oil and sesame oil, or mixtures thereof.

[0128] Besides such inert diluents, the composition may also include adjuvants such as wetting agents, emulsifying and suspending agents, sweetening agents, and flavoring agents.

[0129] Suspensions, in addition to the active compounds, may contain suspending agents such as, for example, ethoxylated isostearyl alcohol, polyoxyethylene sorbitol and sorbitan esters, microcrystalline cellulose, aluminum methoxide and agar, or mixtures of these substances.

[0130] Compositions for parenteral injection may comprise physiologically acceptable sterile aqueous or anhydrous solutions, dispersions, suspensions or emulsions, and sterile powders for reconstitution into sterile injectable solutions or dispersions. Suitable aqueous and non-aqueous carriers, diluents, solvents or excipients include water, ethanol, polyols and suitable mixtures thereof.

[0131] Dosage forms for topical administration of the compounds of this invention include ointments, powders, patches, sprays and inhalants. The active ingredient is mixed under sterile conditions with a physiologically acceptable carrier and any preservatives, buffers, or propellants that may be required.

[0132] The compounds of the present invention may be administered alone or in combination with other active ingredients such as antibiotics.

[0133] When using a pharmaceutical composition, a safe and effective amount of the compound of the present invention is administered to a mammal (e.g., a human) in need of treatment, wherein the dosage is a pharmaceutically effective dosage. For a 60 kg individual, the daily dosage is generally 1 to 1000 mg, preferably 20 to 500 mg. Of course, the specific dosage will also take into account factors such as the route of administration and the individual's health status, all of which are within the skill of a skilled physician.

[0134] The main advantages of the present invention include:

[0135] (1) Provided is a novel taxane compound having a structure of Formula II, III, V, VII or VIII, which has advantages such as higher activity.

[0136] (2) The present invention has established a microbial whole-cell or in vitro catalytic preparation technology for a variety of taxane compounds, obtained a number of new taxane compounds that have never been reported before and determined their biological activities, and provided substrates or raw materials for the de novo synthesis, enzymatic synthesis, whole-cell catalytic synthesis and chemical synthesis of other taxanes.

[0137] (3) The present invention solves the problem of functional expression of plant-derived genes in microorganisms to construct microbial cells that express the desired proteins, and utilizes established whole-cell or in vitro catalytic expression and detection methods to achieve the preparation of new taxane compounds and determine their biological activity.

[0138] (4) The present invention utilizes this group of taxane compounds to synthesize and prepare other taxane compounds by means of de novo synthesis, in vitro enzymatic synthesis, whole-cell catalytic synthesis, and chemical synthesis, and further studies the application of this group of taxane compounds and other taxane compounds obtained based on this group of taxane compounds.

[0139] (5) The present invention establishes multiple new methods for preparing taxane compounds, which can stably, efficiently and rapidly prepare the corresponding compounds and their biological activities, and provide strategies, substrates or raw materials for the synthesis and preparation of other taxane compounds.

[0140] The present invention will be further described below in conjunction with specific examples. It should be understood that these examples are intended to illustrate the present invention only and are not intended to limit the scope of the invention. The experimental methods in the following examples, for which specific conditions are not specified, are generally based on conventional conditions, such as those described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or according to the conditions recommended by the manufacturer. Unless otherwise stated, percentages and parts are weight percentages and parts by weight.

[0141] Unless otherwise specified, the reagents and materials in the examples of the present invention are all commercially available products.

[0142] Unless otherwise defined, all technical and scientific terms used herein have the same meanings as those familiar to those skilled in the art. Furthermore, any methods and materials similar or equivalent to those described herein can be applied to the present invention. The preferred embodiments and materials described herein are for illustrative purposes only and are not intended to limit the scope of the present invention.

[0143] Example 1 Gene cloning and strain construction

[0144] Six primers were synthesized from Shanghai Boshang Biotechnology Co., Ltd. and had the nucleotide sequences of SEQ ID NO: 15 to SEQ ID NO: 20 in the sequence listing.

[0145] Total RNA from yew leaves was extracted using a polysaccharide and polyphenol plant total RNA extraction kit (purchased from Tiangen) and RNA was extracted using a reverse transcription kit (purchased from Takara). After removing genomic DNA, reverse transcription was performed to obtain the cDNA of yew. PCR amplification was performed using the cDNA as a template, and the above-mentioned three pairs of primers SEQ ID NO: 15 / 16, SEQ ID NO: 17 / 18 and SEQ ID NO: 19 / 20 were used for PCR amplification respectively. The DNA polymerase used was the high-fidelity PrimeSTAR DNA polymerase from Bao Bioengineering Co., Ltd. The PCR product was detected by agarose gel electrophoresis. The target DNA band was cut out after irradiation under ultraviolet light. The DNA was then recovered from the agarose gel using a small amount of gel DNA recovery kit (Shanghai Chengyan Biotechnology Co., Ltd.) to obtain the amplified DNA fragment. This DNA fragment was ligated with the pMD18T vector from AXYGEN. The ligation product was transformed into Top10 competent cells (purchased from Beijing Quanshijin Biotechnology). The transformed E. coli culture was plated on LB plates supplemented with 50 μg / mL ampicillin. Recombinant clones were further verified by PCR. Sequencing was performed to obtain the corresponding acetyltransferase and P450 genes, which were named peasy-AT5, peasy-TCYP01, and peasy-TCYP02, respectively.

[0146] The acetyltransferase gene AT5 (peasy-AT5) has the nucleotide sequence of SEQ ID NO:11 in the sequence listing. Nucleotides 1-1329 from the 5' end of SEQ ID NO:11 constitute the AT5 open reading frame, nucleotides 1-3 from the 5' end of SEQ ID NO:11 constitute the AT5 gene's start codon, ATG, and nucleotides 1327-1329 from the 5' end of SEQ ID NO:11 constitute the AT5 gene's stop codon, TGA. The acetyltransferase gene AT5 encodes a protein containing 442 amino acids, AT5, having the amino acid residue sequence of SEQ ID NO:12. Software predicts that the protein has a theoretical molecular weight of 49.55 kDa and an isoelectric point, pI, of 5.51.

[0147] The cytochrome P450 TCYP01 gene (peasy-TCYP01) has the nucleotide sequence of SEQ ID NO:7 in the sequence listing. Nucleotides 1-1461 from the 5' end of SEQ ID NO:7 represent the open reading frame of TCYP01, nucleotides 1-3 from the 5' end of SEQ ID NO:7 represent the start codon ATG of the TCYP01 gene, and nucleotides 1459-1461 from the 5' end of SEQ ID NO:7 represent the stop codon TAA of the TCYP01 gene. The cytochrome P450 TCYP01 gene encodes a protein containing 486 amino acids, TCYP01, with the amino acid residue sequence of SEQ ID NO:8. Software predicts that the protein has a theoretical molecular weight of 55.22 kDa and an isoelectric point (pI) of 6.6. Amino acids 425-434 from the amino terminus of SEQ ID NO:8 represent the conserved cytochrome P450 domain.

[0148] The cytochrome P450 TCYP02 gene (peasy-TCYP02) has the nucleotide sequence of SEQ ID NO:13 in the sequence listing. Nucleotides 1-1524 from the 5' end of SEQ ID NO:13 represent the open reading frame of TCYP02, nucleotides 1-3 from the 5' end of SEQ ID NO:13 represent the start codon ATG of the TCYP02 gene, and nucleotides 1521-1524 from the 5' end of SEQ ID NO:13 represent the stop codon TAA of the TCYP02 gene. The cytochrome P450 TCYP02 gene encodes a protein containing 507 amino acids, TCYP02, with the amino acid residue sequence of SEQ ID NO:14. Software predicted that the protein has a theoretical molecular weight of 57.24 kDa and an isoelectric point (pI) of 9.52. Amino acids 446-455 from the amino terminus of SEQ ID NO:14 represent the conserved cytochrome P450 domain.

[0149] Six primers were synthesized from Shanghai Boshang Biotechnology Co., Ltd., each having the nucleotide sequences of SEQ ID NO:21-SEQ ID NO:26 in the sequence listing. Using the genome of Saccharomyces cerevisiae BY4742 (purchased from Euroscarf) as a template, primers NO:21 / 22 and SEQ ID NO:25 / 26 were used to amplify DNA fragments GAL80-1 and GAL80-3. Using primer pair SEQ ID NO:23 / 24, plasmid pUG72 was used as a template to amplify the URA selection marker fragment GAL80-2. The PCR product was recovered from the agarose gel using a gel DNA mini-recovery kit (Shanghai Chengyan Biotechnology Co., Ltd.). DNA fragments GAL80-1, GAL80-2, and GAL80-3 were transformed into Saccharomyces cerevisiae BY4742 (purchased from Euroscarf) and homologous recombination was performed in vivo. A galactose promoter-driven constitutive expression platform cell, ZTB80, was constructed for gene expression.

[0150] Twelve primers with the nucleotide sequences SEQ ID NO:27 to SEQ ID NO:38 in the sequence listing were synthesized from Shanghai Boshang Biotechnology Co., Ltd. Using the genome of Saccharomyces cerevisiae BY4742 (purchased from Euroscarf) as a template, DNA fragments T5AT-1, T5AT-2, T5AT-4, and T5AT-6 were amplified using primers SEQ ID NO:27 / 28, SEQ ID NO:29 / 30, SEQ ID NO:33 / 34, and SEQ ID NO:37 / 38. The T5AT gene fragment T5AT-3 was amplified using primer pair SEQ ID NO:31 / 32 with the Saccharomyces cerevisiae codon-optimized synT5AT (nucleic acid sequence: SEQ ID NO:1, amino acid sequence: SEQ ID NO:2) as a template. The His selection marker fragment T5AT-5 was amplified using primer pair SEQ ID NO:35 / 36 with the plasmid pESC-His as a template. The PCR products were recovered from the agarose gel using a gel DNA mini-recovery kit (Shanghai Chengyan Biotechnology Co., Ltd.). The three fragments were fused using primer pair SEQ ID NO:27 / 32 with DNA fragments T5AT-1, T5AT-2, and T5AT-3 as templates to obtain DNA fragment T5AT-13. Similarly, the three fragments were fused using primer pair SEQ ID NO:33 / 38 with DNA fragments T5AT-4, T5AT-5, and T5AT-6 as templates to obtain DNA fragment T5AT-46. DNA fragments T5AT-13 and T5AT-46 were co-transfected into ZTB80 cells for in vivo homologous recombination. Yeast cells expressing the Taxus chinensis-derived acetyltransferase T5AT were constructed. Four primers, each with the nucleotide sequences SEQ ID NO:39-SEQ ID NO:42, were synthesized from Shanghai Boshang Biotechnology Co., Ltd. Yeast cells expressing the Taxus chinensis-derived benzoyltransferase synT2BT (nucleic acid sequence: SEQ ID NO:9, amino acid sequence: SEQ ID NO:10) were constructed using the same in vivo homologous recombination method in Saccharomyces cerevisiae.

[0151] Sixteen primers were synthesized from Shanghai Boshang Biotechnology Co., Ltd., each having the nucleotide sequences SEQ ID NO:43 to SEQ ID NO:58 in the sequence listing. Using the genome of Saccharomyces cerevisiae BY4742 (purchased from Euroscarf) as a template, DNA fragments T10OH-1, T10OH-2, T10OH-4, T5AT-6, and T10OH-8 were amplified using primers SEQ ID NO:43 / 44, SEQ ID NO:45 / 46, SEQ ID NO:49 / 50, SEQ ID NO:53 / 54, and SEQ ID NO:57 / 58. The TCPR gene fragment T10OH-3 was amplified using primer pair SEQ ID NO:47 / 48 with Saccharomyces cerevisiae codon-optimized synTCPR (nucleic acid sequence: SEQ ID NO:5, amino acid sequence: SEQ ID NO:6). The T10OH gene fragment T10OH-5 was amplified using primer pair SEQ ID NO:51 / 52 with Saccharomyces cerevisiae codon-optimized synT10OH (nucleic acid sequence: SEQ ID NO:3, amino acid sequence: SEQ ID NO:4). The His selection marker fragment T10OH-7 was amplified using primer pair SEQ ID NO:55 / 56 with plasmid pESC-His as a template. The PCR products were recovered from agarose gels using a gel DNA mini-purification kit (Shanghai Chengyan Biotechnology Co., Ltd.). The three fragments were fused using primer pair SEQ ID NO:43 / 48 with DNA fragments T10OH-1, T10OH-2, and T10OH-3 as templates to obtain DNA fragment T10OH-13. Similarly, using primer pair SEQ ID NO:49 / 54 and DNA fragments T10OH-4, T10OH-5, and T10OH-6 as templates, the three fragments were fused to obtain DNA fragment T10OH-46. Using primer pair SEQ ID NO:55 / 58 and DNA fragments T10OH-7 and T10OH-8 as templates, the three fragments were fused to obtain DNA fragment T10OH-78. DNA fragments T10OH-13, T5AT-46, and T10OH-78 were co-transfected into ZTB80 cells for homologous recombination in vivo. Yeast cells ZT10OH were constructed to express Taxus chinensis-derived cytochrome P450 T10OH (nucleic acid sequence: SEQ ID NO:3, amino acid sequence: SEQ ID NO:4).

[0152] Twelve primers were synthesized from Shanghai Boshang Biotechnology Co., Ltd., each with the nucleotide sequences of SEQ ID NO:59-SEQ ID NO:70 in the sequence listing. Using the genome of Saccharomyces cerevisiae BY4742 (purchased from Euroscarf) as a template, primers NO:59 / 60, SEQ ID NO:61 / 62, SEQ ID NO:65 / 66, and SEQ ID NO:69 / 70 were used to amplify DNA fragments TCPR-1, TCPR-2, TCPR-4, and TCPR-6. Primer pair SEQ ID NO:63 / 64 was used to amplify the TCPR gene fragment TCPR-3 using a Saccharomyces cerevisiae codon-optimized Taxus chinensis-derived cytochrome P450 reductase TCPR (SEQ ID NO:5) as a template. Primer pair SEQ ID NO:67 / 68 was used to amplify the Leu selection marker fragment TCPR-5 using plasmid pCM217 as a template. PCR products were recovered from agarose gels using a gel DNA miniprep kit (Shanghai Chengyan Biotechnology Co., Ltd.). Using primer pair SEQ ID NO:59 / 64 and DNA fragments TCPR-1, TCPR-2, and TCPR-3 as templates, the three fragments were fused to obtain DNA fragment TCPR-13. Similarly, using primer pair SEQ ID NO:65 / 70 and DNA fragments TCPR-4, TCPR-5, and TCPR-6 as templates, the three fragments were fused to obtain DNA fragment TCPR-46. DNA fragments TCPR-13 and TCPR-46 were transferred into ZTB80 cells for homologous recombination in vivo. A chassis cell ZTCPR was constructed for expressing Taxus chinensis-derived cytochrome P450 reductase (nucleic acid sequence: SEQ ID NO:5, amino acid sequence: SEQ ID NO:6).

[0153] Ten primers were synthesized from Shanghai Boshang Biotechnology Co., Ltd., each with the nucleotide sequences SEQ ID NO:70-SEQ ID NO:80 in the sequence listing. Using the genome of Saccharomyces cerevisiae BY4742 (purchased from Euroscarf) as a template, primers SEQ ID NO:71 / 72, SEQ ID NO:73 / 74, SEQ ID NO:75 / 76, and SEQ ID NO:79 / 80 were used to amplify DNA fragments YTCYP-1, YTCYP-2, YTCYP-3, and YTCYP-5. The His selection marker fragment YTCYP-4 was amplified using primer pair SEQ ID NO:77 / 78 from the plasmid pESC-His as a template. DNA fragment TCYP-12 was obtained by fusion of DNA fragments YTCYP-1 and YTCYP-2 using primer pair SEQ ID NO:71 / 74. Using primer pair SEQ ID NO: 75 / 80 and DNA fragments YTCYP-3, YTCYP-4 and YTCYP-5 as templates, the three fragments were fused to obtain DNA fragment YTCYP-35.

[0154] Four primers were synthesized from Shanghai Boshang Biotechnology Co., Ltd., each with the nucleotide sequences SEQ ID NO:81-SEQ ID NO:84 in the sequence listing. Using the cloned peasy-TCYP01 sequence as a template, the open reading frame fragment ZTCYP01 (i.e., TCYP01, containing sequences homologous to TCYP2 and TCYP3 at both its 5' and 3' ends) was amplified using primer pairs SEQ ID NO:81 and SEQ ID NO:82. The PCR product was recovered from an agarose gel using the AxyPrep DNA Gel Extraction Kit from AXYGEN. DNA fragments ZTCYP01, YTCYP-12, and YTCYP-35 were transformed into Saccharomyces cerevisiae ZTCPR for in vivo homologous recombination. Positive transformants were verified by colony PCR, and the Saccharomyces cerevisiae strain ZTCYP01 expressing the corresponding P450 TCYP01 (nucleic acid sequence: SEQ ID NO:7, amino acid sequence: SEQ ID NO:8) was constructed. The same method was used to construct a Saccharomyces cerevisiae strain ZTCYP02 expressing the corresponding P450 TCYP02 (nucleic acid sequence: SEQ ID NO: 13, amino acid sequence: SEQ ID NO: 14).

[0155] Two primers were synthesized from Shanghai Boshang Biotechnology Co., Ltd., each with the nucleotide sequences SEQ ID NO:85-SEQ ID NO:86 in the sequence listing. The cloned peasy-AT5 sequence was used as a template to amplify the acyltransferase AT5 fragment. The pET28A plasmid was digested with EcoI and XhoI, and the AT5 fragment and pET28A (purchased from Invitrogen) were then recombined in vitro using an in vitro recombination kit (Shanghai Jinan Biotechnology Co., Ltd.). The fragment was then transferred to TOP10 for sequencing. The sequenced plasmid was then introduced into commercially available Escherichia coli BL21 competent cells to construct the E. coli strain ZAT5 expressing AT5 (nucleotide sequence: SEQ ID NO:11, amino acid sequence: SEQ ID NO:12).

[0156] Example 2

[0157] Biosynthesis of 5α-acetoxytaxadiene-13α-ol (corresponding to the compound of formula II)

[0158] Prepare YPD medium: 1% (w / v) yeast extract, 2% (w / v) bacterial peptone, 2% (w / v) glucose. Pick single colonies of the ZT5AT strain and the control strain ZTB80 without gene expression and inoculate them into a test tube containing 1 ml of YPD medium and culture at 30°C 250rpm for 24 hours. Add 5ul of 100mM substrate taxadiene-5α,13α-diol to the culture medium and culture at 30°C 250rpm for 24 hours. Extract with 1ml of ethyl acetate overnight, centrifuge at 12000rpm for 1min, take the upper organic layer, vacuum concentrate and resuspend in 50ul of chromatographic ethyl acetate, sonicate for 5min, centrifuge at 12000rpm for 1min, and take the supernatant for gas chromatography-flame ionization detector (GC-FID) analysis ( Figure 1 The results showed that T5AT catalyzed the production of a new peak from taxadiene-5α,13α-diol (Formula I). Further isolation and purification of the product peak by amplifying the catalytic system and nuclear magnetic resonance (NMR) analysis revealed the product to be 5α-acetoxytaxadiene-13α-ol. This demonstrates that whole-cell catalysis has enabled the production of 5α-acetoxytaxadiene-13α-ol.

[0159] Example 3

[0160] Biosynthesis of 5α-acetoxytaxadiene-10β,13α-diol (corresponding to the compound of formula III)

[0161] YPD medium was prepared: 1% (w / v) yeast extract, 2% (w / v) bacto-peptone, and 2% (w / v) glucose. Single colonies of strains ZT10OH or ZTCYP01, as well as the non-expressing control strain ZTB80, were inoculated into a test tube containing 1 ml of YPD medium and cultured at 30°C, 250 rpm, for 24 hours. 5 μl of 100 mM substrate 5α-acetoxytaxadiene-13α-ol was added to the medium and cultured at 30°C, 250 rpm, for 24 hours. Extraction was performed overnight with 1 ml of ethyl acetate, followed by centrifugation at 12,000 rpm for 1 minute. The upper organic layer was collected, concentrated under vacuum, and resuspended in 50 μl of ethyl acetate. Ultrasonication was performed for 5 minutes, followed by centrifugation at 12,000 rpm for 1 minute. The supernatant was analyzed by gas chromatography-flame ionization detection (GC-FID). The results showed that both T10OH and TCYP01 catalyzed the formation of a new peak ( Figure 2 and Figure 3 Further isolation and purification of the product peak by amplifying the catalytic system and nuclear magnetic resonance analysis revealed the product to be 5α-acetoxytaxadiene-10β,13α-diol. This demonstrates that we have achieved whole-cell catalytic production of 5α-acetoxytaxadiene-10β,13α-diol.

[0162] Example 4

[0163] Biosynthesis of 5α,13α-diacetoxytaxadiene-10β-ol (corresponding to the compound of formula V)

[0164] Prepare YPD medium: 1% (w / v) yeast extract, 2% (w / v) bacto-peptone, and 2% (w / v) glucose. Single colonies of strains ZT10OH or ZTCYP01, or the non-expressing control strain ZTB80, were inoculated into 1 ml of YPD medium in a test tube and cultured at 30°C, 250 rpm, for 24 hours. Add 5 μl of 100 mM substrate 5α,13α-diacetoxytaxadiene to the culture medium and incubate at 30°C, 250 rpm, for 24 hours. Extract with 1 ml of ethyl acetate overnight, centrifuge at 12,000 rpm for 1 minute, remove the upper organic layer, concentrate under vacuum, and resuspend in 50 μl of ethyl acetate. Sonicate for 5 minutes, centrifuge at 12,000 rpm for 1 minute, and collect the supernatant for high-performance liquid chromatography (HPLC) or mass spectrometry (LC-MS) analysis. The results showed that T10OH and TCYP01 could catalyze 5α,13α-diacetoxytaxadiene (Formula IV) to generate a new peak ( Figure 4 and Figure 5Further isolation and purification of the product peak by amplifying the catalytic system and nuclear magnetic resonance analysis revealed that the product was 5α,13α-diacetoxytaxadiene-10β-ol (compound V). This demonstrates that we have achieved whole-cell catalytic production of 5α,13α-diacetoxytaxadiene-10β-ol.

[0165] Example 5

[0166] Biosynthesis of 2α-benzoyl-7β-oxyacetyltaxol (corresponding to the compound of formula VII)

[0167] A single colony of the ZT2BT strain was inoculated into a 250-ml Erlenmeyer flask containing 50 ml of YPD medium and cultured at 30°C, 250 rpm, for 48 hours. The cells were harvested by centrifugation at 4000 g for 5 minutes at room temperature and resuspended in a 1-L Erlenmeyer flask containing 200 ml of YPD medium and cultured at 30°C, 250 rpm, for 24 hours. The cells were harvested by centrifugation at 4000 g for 5 minutes at 4°C and resuspended in a 1-L Erlenmeyer flask containing 200 ml of YPD medium and cultured at 16°C, 110 rpm, for 24 hours. The cells were harvested by centrifugation at 4000 g for 5 minutes at 4°C, ground with liquid nitrogen, and resuspended in 2 ml of 0.1 M phosphate buffer (pH 7.4). Cell debris was removed by centrifugation at 10,000 g for 15 minutes at 4°C, and the crude enzyme supernatant was retained for use in the catalytic reaction.

[0168] A single colony of the ZAT5 strain was inoculated into a glass test tube containing 4 ml of LB medium (containing 50 mg / L ampicillin) and cultured at 37°C, 200 rpm, for 10 hours. 0.5 ml of the bacterial suspension was transferred to a 250 ml Erlenmeyer flask containing 50 ml of LB medium (containing 50 mg / L ampicillin). The culture was cultured at 37°C, 200 rpm, for 2 hours. 1 mM IPTG was then added to the culture medium and induced at 16°C, 110 rpm, for 16 hours. The cells were harvested by centrifugation at 8000 g for 1 minute at 4°C, and the cells were disrupted by sonication. Cell debris was removed by centrifugation at 10000 g for 15 minutes, and the crude enzyme supernatant was retained for use in the catalytic reaction. 300ul of crude enzyme solution of ZT2BT and 300ul of crude enzyme solution of ZAT5 were mixed, and 1.5ul of 100mM 2α,7β-dihydroxytaxine, 6ul of 50mM benzoyl-CoA and 6ul of 50mM acetyl-CoA were added, and the mixture was mixed at 30°C overnight. An equal volume of ethyl acetate was added for extraction for 1h, centrifuged at 12000rpm for 1min, the upper organic layer was collected, vacuum concentrated and resuspended in 50ul of chromatographic ethyl acetate, ultrasonicated for 5min, centrifuged at 12000rpm for 1min, and the supernatant was collected for HPLC analysis. The results showed that T2BT and AT5 can jointly catalyze 2α,7β-diacetyltaxine (compound of formula VI) to generate multiple new peaks ( Figure 6Further separation and purification of the least polar product peak by amplifying the catalytic system and nuclear magnetic resonance analysis revealed the product to be 2α-benzoyl-7β-oxyacetyltaxol (Formula VII). This demonstrates that we have achieved in vitro enzymatic preparation of 2α-benzoyl-7β-oxyacetyltaxol.

[0169] Example 6

[0170] Biosynthesis of 2α-benzoyl-baccatin I (corresponding to the compound of formula VIII)

[0171] YPD medium was prepared: 1% (w / v) yeast extract, 2% (w / v) bacterial peptone, and 2% (w / v) glucose. Single colonies of the ZTCYP02 strain and the control strain ZTB80 without gene expression were inoculated into a test tube containing 1 ml of YPD medium and cultured at 30°C, 250 rpm, for 24 hours. 5 μl of 100 mM substrate 2α-benzoyl-7β-oxyacetyl taxol was added to the culture medium and cultured at 30°C, 250 rpm, for 24 hours. Extraction was performed overnight with 1 ml of ethyl acetate, followed by centrifugation at 12,000 rpm for 1 minute. The upper organic layer was collected, vacuum concentrated, and resuspended in 50 μl of chromatographic ethyl acetate. Ultrasonication was performed for 5 minutes, and centrifugation was performed at 12,000 rpm for 1 minute. The supernatant was collected for HPLC analysis. The results showed that TCYP02 could catalyze the formation of two new peaks ( Figure 7 Further isolation, purification, and nuclear magnetic resonance analysis of the product peaks by amplifying the catalytic system revealed that one of the products was 2α-benzoyl-baccatin I (compound of Formula VIII). This demonstrates that we have achieved whole-cell catalytic production of 2α-benzoyl-baccatin I.

[0172] Sequence information:

[0173] SEQ ID NO: 1 synT5AT nucleic acid sequence

[0174]

[0175] SEQ ID NO:2synT5AT protein sequence

[0176] MEKTDLHVNLIEKVMVGPSPPLPKTTLQLSSIDNLPGVRGSIFNALLIYNASPSPTMISADPAKPIREALAKILVYYPPFAGRLRETENGDLEVECTGEGAMFLEAMADNELSVLGDFDDSNPSFQQLLFSLPLDTNFCKDLSLLVVQVTRFTCGGFVVGVSFHHGVCDGRGAAQFLKGLAEMARGEVKLSLEPIWNRELVKLDDPKYLQFFHFEFLRAPSIVEKIVQTYFIIDFETINYIKQSVMEECKEFCSSFEVASAMTWIARTRAFQIPESEYVKILFGMDMRNSFNPPLPSGYYGNSIGTACAVDNVQDLLSGSLLRAIMIIKKSKVSLNDNFKSRAVVKPSELDVNMNHENVVAFADWSRLGFDEVDFGWGNAVSVSPVQQQSALAMQNYFLFLKPSKNKPDGIKILMFLPLSKMKSFKIEMEAMMKKYVAKV

[0177] SEQ ID NO:3synT10OH nucleic acid sequence

[0178]

[0179] SEQ ID NO: 4 synT10OH protein sequence

[0180] MDSFIFLRSIGTKFGQLESSPAILSLTLAPILAIILLLLFRYNHRSSVKLPPGKLGFPLIGETIQLLRTLRSETPQKFFDDRLKKFGPVYMTSLIGHPTVVLCGPAGNKLVLSNEDKLVEMEGPKSFMKLIGEDSIVAKRGEDHRILRTALARFLGAQALQNYLGRMSSEIGHHFNEKWKGKDEVKVLPLVRGLIFSIASTLFFDVNDGHQQKQLHHLLETILVGSLSVPLDFPGTRYRKGLQARLKLDEILSSLIKRRRRDLRSGIASDDQDLLSVLLTFRDEKGNSLTDQGILDNFSAMFHASYDTTVAPMALIFKLLYSNPEYHEKVFQEQLEIIGNKKEGEEISWKDLKSMKYTWQAVQESLRMYPPVFGIFRKAITDIHYDGYTIPKGWRVLCSPYTTHLREEYFPEPEEFRPSRFEDEGRHVTPYTYVPFGGGLRTCPGWEFSKIEILLFVHHFVKNFSSYIPVDPNEKVLSDPLPPLPANGFSIKLFPRS

[0181] SEQ ID NO: 5 synTCPR nucleic acid sequence

[0182]

[0183] SEQ ID NO: 6 synTCPR protein sequence

[0184] MQANSNTVEGASQGKSLLDISRLDHIFALLLNGKGGDLGAMTGSALILTENSQNLMILTTALAVLVACVFFFVWRRGGSDTQKPAVRPTPLVKEEDEEEEDDSAKKKVTIFFGTQTGTAEGFAKALAEEAKARYEKAVFKVVDLDNYAADDEQYEEKLKKEKLAFFMLATYGDGEPTDNAARFYKWFLEGKEREPWLSDLTYGVFGLGNRQYEHFNKVAKAVDEVLIEQGAKRLVPVGLGDDDQCIEDDFTAWREQVWPELDQLLRDEDDEPTSATPYTAAIPEYRVEIYDSVVSVYEETHALKQNGQAVYDIHHPCRSNVAVRRELHTPLSDRSCIHLEFDISDTGLIYETGDHVGVHTENSIETVEEAAKLLGYQLDTIFSVHGDKEDGTPLGGSSLPPPFPGPCTLRTALARYADLLNPPRKAAFLALAAHASDPAEAERLKFLSSPAGKDEYSQWVTASQRSLLEIMAEFPSAKPPLGVFFAAIAPRLQPRYYSISSSPRFAPSRIHVTCALVYGPSPTGRIHKGVCSNWMKNSLPSEETHDCSWAPVFVRQSNFKLPADSTTPIVMVGPGTGFAPFRGFLQERAKLQEAGEKLGPAVLFFGCRNRQMDYIYEDELKGYVEKGILTNLIVAFSREGATKEYVQHKMLEKASDTWSLIAQGGYLYVCGDAKGMARDVHRTLHTIVQEQESVDSSKAEFLVKKLQMDGRYLRDIW

[0185] SEQ ID NO: 7 TCYP01 nucleic acid sequence

[0186]

[0187] SEQ ID NO:8TCYP01 protein sequence

[0188] MNTFSFLEFIQLQSILFLTLLALLLCLFRYKTQSSAVKLPPGNLGFPFIGETIPFLRALHSETPQTFFDERMKKFGNVFVTSLIGQPIVVLCGPAGNRLLLSNEDKLVEMSPPKFSLKLIGQDSLLSKREDEHRTLRAALGRFLRPQALQSYMGIMSSEIEHHINEKWKGKDEVKMLPLIRGLIFSIATTLFFDINDEHLKDRLHLLETILVGTVSLPLDFPGTSFSKAVEARSKLDEILSSLIKSRRSDLHSGIASDGQDLLTVLLTFKDERGNSLADNEILDNFSLMLHASYETSVSPTVLMFKLLSSNPECYDKLVQEQLGILANKKEGEDISWKDVKAMKYTWQVVQETMRIFPPGFGSYRKAITDIDYDGYTIPKGWTTLWTPYTTHGKEQYFHDPEQFRPSRFEEGELVAPYTFLPFGAGARICPGWEFAKTEILLFVHHFVKNFSSYHVVDPKEKISGNFPPLPNNGFSLKVFPRS

[0189] SEQ ID NO:9synT2BT nucleic acid sequence

[0190]

[0191] SEQ ID NO: 10 synT2BT protein sequence

[0192] MGRFNVDMIERVIVAPCLQSPKNILHLSPIDNKTRGLTNILSVYNASQRVSVSADPAKTIREALSKVLVYYPPFAGRLRNTENGDLEVECTGEGAVFVEAMADNDLSVLQDFNEYDPSFQQLVFNLREDVNIEDLHLLTVQVTRFTCGGFVVGTRFHHSVSDGKGIGQLLKGMGEMARGEFKPSLEPIWNREMVKPEDIMYLQFDHFDFIHPPLNLEKSIQASMVISFERINYIKRCMMEECKEFFSAFEVVVALIWLARTKSFRIPPNEYVKIIFPIDMRNSFDSPLPKGYYGNAIGNACAMDNVKDLLNGSLLYALMLIKKSKFALNENFKSRILTKPSTLDANMKHENVVGCGDWRNLGFYEADFGWGNAVNVSPMQQQREHELAMQNYFLFLRSAKNMIDGIKILMFMPASMVKPFKIEMEVTINKYVAKICNSKL

[0193] SEQ ID NO: 11 AT5 nucleic acid sequence

[0194]

[0195] SEQ ID NO:12AT5 protein sequence

[0196] MENPSSTDFLVKKFDPVVVAPSLPLPKTTLQLSPIDNQIGFRGFFNSLSVYNAPDDISADPVKIIREALSKVLVHYFPLAGRFRNKENGELEVDCTGEGALFVEAMVEDNISVLRDFDDLNPSFQQLVFWPPMGANIEDLHLVVQVTRFTCGDITVGVTVCHSIFDGCGAAQFVTALADMARGEVKPLLEPIWNRELLKPEDPVQLQLYQFDSLCPPPILFEELGQASLIINSNTIKYMKQCIMEECKVFCSTFEVMAALVWVARTKAFQIPHTETVKLLFAMDMRRSFNPPFPNGYYGNAIGTAYAMDNVEDLLNGSLSRVVMIIKKSKVSLRDNYLRSNKVKDPYSLDVNKKDKNVLALSDWRRLGFHEANFGWGDPVNVTAPQLLGKGLPLLSYYLFLQPSKNQPDGIKILMSCMHPSAVKSIKMEMEAMINKFVTKS

[0197] SEQ ID NO:13TCYP02 nucleic acid sequence

[0198]

[0199] SEQ ID NO:14 TCYP02 protein sequence

[0200] MVHVLQVVKMDRVRQIFNGSSGSPAGIPHSVITAGVGAIIILLLSLLLLRRSSKRGDSSHPPGNSGLPFIGETLSFTKAFKSNTLAEFFEERVKKFGNVFKISIIGPPTVVMCGNEGNRFIFANEEKLMHLSWSGRYAKILGGESVSMKRGDDHRSVRAAFAGFLSPASLPVYISKMSAQIQDHINEKWKGKDVIAVVPLVKELVFNVSYNLFFSINDREELHRLHKIFETIVEGHVSMPIDLPGFTFRRALQGRAKLKKVFSSLIERRRSDLSSGLASANQDLISVLLTYKDDRGYTMTHDELLDNFLSLLESSYDSVNSPMACILKLLYANPECYEKVVQEQLGILSGKKEGQEISWKDLRSMKYTWQVLQETLRLYTQVAGIFRKAMTDIHYDGHTIPKGWQLLWATQTTHLNDKYFSEPEKFMPSRFDEEGNNVIPYSFVPFGGGRRMCPGWEFGKMEILLFVHHFVKTFSGFTPIDPNEKITGNPFPHLPANGFLIKPILRS

[0201] SEQ ID NO:15 AT5-F

[0202] ATGGAGAATCCAAGCTCA

[0203] SEQ ID NO:16 AT5-R

[0204] TCACGATTTAGTCACAAATTT

[0205] SEQ ID NO:17 TCYP01-F

[0206] ATGAATACCTTCAGTTTCCTG

[0207] SEQ ID NO:18 TCYP01-R

[0208] TTACGATCTGGGAAATACTTT

[0209] SEQ ID NO:19 TCYP02-F

[0210] AGATGAATGAGCGTGCAGAGT

[0211] SEQ ID NO:20TCYP02-R

[0212] TGAAACGTGAACAACAACGAGT

[0213] SEQ ID NO:21GAL80-UP-F

[0214] GAGATGGTGCTTATCCTCAT

[0215] SEQ ID NO:22 GAL80-UP-R

[0216] CTATCGAGATTGTATACGCT

[0217] SEQ ID NO:23 GAL80-URA-F

[0218] GCTGGTCCTTGCCGACCAGCGTATACAATCTCGATAGCAGCTGAAGCTTCGTACGCTGC

[0219] SEQ ID NO:24 GAL80-URA-R

[0220] TTTATAACGTTCGCTGCACTGGGGGCCAAGCACAGGCGCGTTGGCCGATTCATTAATGC

[0221] SEQ ID NO:25 GAL80-Down-F

[0222] GCCTGTGCTTGGCCCCCAGTGC

[0223] SEQ ID NO:26 GAL80-Down-R

[0224] TCATGAACCTGTTGGGAAGC

[0225] SEQ ID NO:27 ZPTAT-UP-F

[0226] atgagagtagcaaacgtaagtctaa

[0227] SEQ ID NO:28 ZPTAT-UP-R

[0228] AAAAAAGTAAGAATTTGAAAATTCAATATAACTCACTATTTTTTACTGCGGAAGCGG

[0229] SEQ ID NO:29 ZPTAT-GAL101-F

[0230] ttccgcttccgcttccgcagtaaaaatagtgagTTATATTGAATTTTCAAAAATTCT

[0231] SEQ ID NO:30 ZPTAT-GAL101-R

[0232] TCAATCAAGTTAACGTGCAAGTCAGTCTTTTCCATTATAGTTTTTTCTCCTTGACGTTA

[0233] SEQ ID NO:31 ZPTAT-synPTAT-F

[0234] tatacctctatactttaacgtcaaggagaaaaactataATGGAAAAGACTGACTTGCA

[0235] SEQ ID NO:32 ZPTAT-synPTAT-R

[0236] ATTCATTCTTCAGACTTAGTGATGATGGTGGTGATGAACTTTAGCAACATATTTTCA

[0237] SEQ ID NO:33 ZPTAT-GPM1t-F

[0238] atatgttgctaaagttcatcaccaccatcactaaGTCTGAAGAATGAATGATTTGA

[0239] SEQ ID NO:34 ZPTAT-GPM1t-R

[0240] GACTACCTTTCATCCTACATAAATAGACGCATATAAGTACGTATTCGAACTGCCCATTC

[0241] SEQ ID NO:35 ZPTAT-His-F

[0242] ttgcaaagggaaaagctgaatgggcagttcgaataCGTACTTATATGCGTCTATTTATG

[0243] SEQ ID NO:36 ZPTAT-his-R

[0244] TTTTTTTCCAAAGTGACAGGTGCCCCGGGTAACCCAGTTCCACTCAACCCTATCTCGGT

[0245] SEQ ID NO:37 ZPTAT-Down-F

[0246] aatcaaaagaatagaccgagatagggttgagtgGAACTGGGTTACCCGGGGCACCTGTC

[0247] SEQ ID NO:38 ZPTAT-Down-R

[0248] TTTCCTCTAATCAGGTTCCACC

[0249] SEQ ID NO:39 ZT2BT-GAL101-R

[0250] ACTCTTTCAATCATATCAACGTTGAATCTACCCATTAGTTTTTTCTCCTTGACGTTA

[0251] SEQ ID NO:40 ZT2BT-synT2BT-F

[0252] TATACCTCTATACTTTTAACGTCAAGGAGAAAAAACTATAATGGGTAGATTCAACGTTGA

[0253] SEQ ID NO:41 ZT2BT-synT2BT-R

[0254] ATTCATTCTTCAGACTTAGTGATGATGGTGGTGATGCAATTTAGAATCAAATTTTAG

[0255] SEQ ID NO:42 ZT2BT-GPM1t-F

[0256] TTGTAATTCTAAATTGCATCACCACCATCATCACTAAGTCTGAAGAATGAATGATTTGA

[0257] SEQ ID NO:43 T10OH-UP-F

[0258] ATGAGAGTAGCAAACGTAAGTCTAA

[0259] SEQ ID NO:44 T10OH-UP-R

[0260] ATATATCTAGATGCAGTAATATACACAGATTCCCTCACTATTTTTTACTGCGGAAGCGG

[0261] SEQ ID NO:45 T10OH-TDH3-F

[0262] TTTCCGCTTCCGCTTCCGCAGTAAAAAATAGTGAGGGAATCTGTGTATATTACTGCATC

[0263] SEQ ID NO:46 T10OH-TDH3-R

[0264] CAAATGGATGGTAGATATTTGAGAGATATTTGGTAAGTGAATTTACTTTAAATCTTGCA

[0265] SEQ ID NO:47 T10OH-TCPR-F

[0266] AATTTATTTAAATGCAAGATTTAAAGTAAATTCACTTACCAAATATCTCTCAAATATCT

[0267] SEQ ID NO:48 T10OH-TCPR-R

[0268] CAAAAAAAAAGTAAGAATTTTTGAAAATTCAATATAAATGCAAGCAAATTCTAATACTG

[0269] SEQ ID NO:49 T10OH-GAL-F

[0270] GAAGCACCTTCAACAGTATTAGAATTTGCTTGCATTTATATTGAATTTTCAAAAATTCT

[0271] SEQ ID NO:50 T10OH-GAL-R

[0272] GTACCAATAGATCTCAAAAAAATAAATGAATCCATTATAGTTTTTTCTCCTTGACGTTA

[0273] SEQ ID NO:51 T10OH-T10-F

[0274] TACCTCTATACTTTAACGTCAAGGAGAAAAAACTATAATGGATTCATTTATTTTTTTGA

[0275] SEQ ID NO:52 T10OH-T10-R

[0276] TTCATTCTTCAGACTTAGTGATGATGGTGGTGATGTGATCTAGGAAACAATTTAATAGA

[0277] SEQ ID NO:53 T10OH-GPM1t-F

[0278] ATTGTTTCCTAGATCACATCACCACCATCATCACTAAGTCTGAAGAATGAATGATTTGA

[0279] SEQ ID NO:54 T10OH-GPM1t-R

[0280] GACTACCTTTCATCCTACATAAATAGACGCATATAAGTACGTATTCGAACTGCCCATTC

[0281] SEQ ID NO:55 T10OH-HIS-F

[0282] TTGCAAAGGGAAAAGCTGAATGGGCAGTTCGAATACGTACTTATATGCGTCTATTTATG

[0283] SEQ ID NO:56 T10OH-HIS-R

[0284] TTTTTTTCCAAAGTGACAGGTGCCCCGGGTAACCCAGTTCCACTCAACCCTATCTCGGT

[0285] SEQ ID NO:57 T10OH-DOWN-F

[0286] AATCAAAAGAATAGACCGAGATAGGGTTGAGTGGAACTGGGTTACCCGGGGCACCTGTC

[0287] SEQ ID NO:58 T10OH-DOWN-R

[0288] TTTCCTCTAATCAGGTTCCACC

[0289] SEQ ID NO:59 TCPR-UP-F

[0290] TGTTGGAATAGAAATCAACTATC

[0291] SEQ ID NO:60 TCPR-UP-R

[0292] TAACATATATCTAGATGCAGTAATATACACAGATTCCGGATATAGGAATCCTCAAAATG

[0293] SEQ ID NO:61 TCPR-TER-F

[0294] GAAATATAGATTCCATTTTGAGGATTCCTATATCCGGAATCTGTGTATATTACTGCATC

[0295] SEQ ID NO:62 TCPR-TER-R

[0296] GATATTTGGGATTATAAAGATGACGACGATAAATAAGTGAATTTACTTTAAATCTTGCA

[0297] SEQ ID NO:63 TCPR-F

[0298] AAATTCACTTATTTATCGTCGTCATCTTTATAATCCCAAATATCTCTCAAATATCTACC

[0299] SEQ ID NO:64 TCPR-R

[0300] CAAAAAAAAAGTAAGAATTTTTGAAAATTCAATATAAATGCAAGCAAATTCTAATACTG

[0301] SEQ ID NO:65 TCPR-PRO-F

[0302] GAAGCACCTTCAIRAGTAGATTTGCTTGCATTTATTGAATTTTCAAAATTCT

[0303] SEQ ID NO:66 TCPR-PRO-R

[0304] GGCGATCGGTGCGGGCCTCTTCGCTATTACGCCAGTATAGTTTTTTCTCCTTGACGTTA

[0305] SEQ ID NO:67 TCPR-MF

[0306] ATATACCTCTTACTTTTAACGTCAAGGAAAAAACTACTGGCGTAATAGCGAAGAG

[0307] SEQ ID NO:68 TCPR-MR

[0308] TATTAGGTATACAGAATATACTAGAAGTTCTCCTCGAGCATATACCTTTTTCAACTGAA

[0309] SEQ ID NO:69 TCPR-Down-F

[0310] TTTTCCCAATTTTTCAGTTGAAAAAGGTATATGCTCGAGGAGAACTTCTAGTATATT

[0311] SEQ ID NO:70 TCPR-Down-R

[0312] REPEAT GTTGTTGTTGTC

[0313] SEQ ID NO:71 TCYP-UP-F

[0314] agagtagcaacgtagctctaa

[0315] SEQ ID NO:72 TCYP-UP-R

[0316] AAAAAAGTAGAATTTTTGAAAATTCAAATTACTCATTATTTTTTACTGCGGAAGCGG

[0317] SEQ ID NO:73 TCYP-PRO-F

[0318] tttccgcttccgcttccgcagtaaaaaatagtgagTTATATTGAATTTTCAAAAATTCT

[0319] SEQ ID NO:74 TCYP-PRO-R

[0320] TATAGTTTTTTCTCCTTGACGTTA

[0321] SEQ ID NO:75 TCYP-TER-F

[0322] GTCTGAAGAATGAATGATTTGA

[0323] SEQ ID NO:76 TCYP-TER-R

[0324] GACTACCTTTCATCCTACATAAATAGACGCATATAAGTACGTATTCGAACTGCCCATTC

[0325] SEQ ID NO:77 TCYP-M-F

[0326] ttgcaaagggaaaagctgaatgggcagttcgaataCGTACTTATATGCGTCTATTTATG

[0327] SEQ ID NO:78 TCYP-M-R

[0328] TTTTTTTCCAAAGTGACAGGTGCCCCGGGTAACCCAGTTCCACTCAACCCTATCTCGGT

[0329] SEQ ID NO:79 TCYP-Down-F

[0330] aatcaaaagaatagaccgagatagggttgagtgGAACTGGGTTACCCGGGGCACCTGTC

[0331] SEQ ID NO:80 TCYP-Down-R

[0332] TTTCCTCTAATCAGGTTCCACC

[0333] SEQ ID NO:81 TCRP-TCYP01-F

[0334] aatatacctctatactttaacgtcaaggagaaaaaactataATGAATAACCTTCAGTTTC

[0335] SEQ ID NO:82 TCRP-TCYP01-R

[0336] AAATCATTCATTCTTCAGACTTAGTGATGATGGTGGTGATGCGATCTGGGAAATACTTT

[0337] SEQ ID NO:83TCRP-TCYP02-F

[0338] aatatacctctatactttaacgtcaaggagaaaaaactataATGGTTCATGTGTTGCAG

[0339] SEQ ID NO:84TCRP-TCYP02-R

[0340] AAATCATTCATTCTTCAGACTTAGTGATGATGGTGGTGATGGGATCTGAGAATAGGTTT

[0341] SEQ ID NO:85 28A-AT5-F

[0342] TAAGAAGGAGATATACCATGGAGAATCCAAGCTCAACAG

[0343] SEQ ID NO:86 28A-AT5-R

[0344] GGATCTCAGTGGTGGTGGTGGTGGTGCTCGAGCGATTTAGTCACAAATTTG

[0345] All documents mentioned in this application are incorporated herein by reference, just as if each document were incorporated herein by reference individually. It should also be understood that after reading the above teachings of the present invention, those skilled in the art may make various changes or modifications to the present invention, and that such equivalents also fall within the scope of the claims appended hereto.

Claims

1. A taxane compound or a pharmaceutically acceptable salt thereof, characterized in that: Has the following structure:

2. A composition, characterized in that include: (a) The taxane compound according to claim 1 or a pharmaceutically acceptable salt thereof.

3. The composition according to claim 2, wherein The composition also includes other drugs having tumor treatment, cancer treatment, anti-platelet aggregation and antibacterial activities, as well as drugs for treating autoimmune diseases and nervous system diseases.

4. The composition according to claim 3, wherein The other drugs having anti-tumor, anti-cancer, anti-platelet aggregation and antibacterial activities, and drugs for treating autoimmune diseases and nervous system diseases are selected from the following group: paclitaxel, docetaxel, derivatives having a taxane skeleton structure, or a combination thereof.

5. A use of a taxane compound or a pharmaceutically acceptable salt thereof according to claim 1, characterized in that: For preparing a composition or preparation for one or more uses selected from the group consisting of: (a) Treatment of tumors; (b) treatment of cancer; (c) antibacterial; (d) antiplatelet aggregation; (e) treatment of autoimmune diseases; (f) Nervous system diseases.

6. A method for preparing the taxane compound or a pharmaceutically acceptable salt thereof according to claim 1, characterized in that: Including steps: (a) in a reaction system, using the compound of formula I as a substrate, performing an acetylation reaction in the presence of an acetyltransferase to produce a compound of formula II, wherein the amino acid sequence of the acetyltransferase is shown in SEQ ID NO.2; or (b) in a reaction system, using the compound of formula II as a substrate, and conducting a hydroxylation reaction in the presence of a cytochrome P450 enzyme to produce a compound of formula III, wherein the amino acid sequence of the cytochrome P450 enzyme is shown in SEQ ID NO. 4 or 8; or (c) in a reaction system, using the compound of formula IV as a substrate, and conducting a hydroxylation reaction in the presence of a cytochrome P450 enzyme to produce a compound of formula V, wherein the amino acid sequence of the cytochrome P450 enzyme is shown in SEQ ID NO. 4 or 8; or (d) in a reaction system, using the compound of formula VI as a substrate, performing benzoylation and acetylation reactions in the presence of a benzoyltransferase and an acetyltransferase, thereby producing a compound of formula VII, wherein the amino acid sequence of the benzoyltransferase is shown in SEQ ID NO. 10, and the amino acid sequence of the acetyltransferase is shown in SEQ ID NO. 12; or (e) in a reaction system, using the compound of formula VII as a substrate, conducting an epoxidation reaction in the presence of a cytochrome P450 enzyme to produce a compound of formula VIII, wherein the amino acid sequence of the cytochrome P450 enzyme is shown in SEQ ID NO. 14; and (f) optionally isolating the compound of formula II, III, V, VII or VIII from the reaction system after the reaction of steps (a) to (e).

7. The method according to claim 6, wherein In steps (a)-(e), the reaction time is 1-80 hours, preferably 5-50 hours, more preferably 10-30 hours, and even more preferably 20-30 hours.

8. The method according to claim 6, wherein In steps (a)-(e), the reaction temperature is 10°C-50°C, preferably 20°C-40°C, and more preferably 25°C-35°C.

9. The method according to claim 6, wherein In step (f), the separation comprises: adding an extraction solvent, such as tertiary methyl ether, dichloromethane, toluene, ethyl acetate, n-hexane, etc., then centrifuging to obtain an organic layer, drying, filtering, and concentrating the organic layer to obtain the product.

10. The method according to claim 6, wherein In each reaction system of steps (a) to (e), the concentration of the substrate (compound of Formula I, II, IV, VI, VII) is independently 5-5000 mM, preferably 10-1000 mM, and more preferably 20-500 mM.

Images