Ester-decomposing yeast engineering bacterium for synthesizing triacetate lactone by utilizing lignocellulose and application of ester-decomposing yeast engineering bacterium

Abstract

The invention discloses ester-decomposing yeast engineering bacteria for synthesizing triacetate lactone by utilizing lignocellulose and application, and belongs to the technical field of biosynthesis and genetic engineering. The method comprises the following steps: by taking lipolytic yeast Yali05-10 as a starting strain, weakening an FAS gene, and performing overexpression on a PK gene, a Pta gene and an ACL gene, so as to obtain a lipolytic yeast engineering strain Yali14-3; or the Yali14-3 is taken as a starting strain, and an SP7 gene, an xlnD gene and an xyn2 gene are introduced, so that the ester-decomposing yeast engineering strain Yali13-7 is obtained. A fermentation substrate is optimized, and it is found that the yield of triacetate synthesized by fermentation of Yali14-3 with lignocellulose hydrolysate as a substrate is 5.01 g / L. The highest yield of the triacetate lactone produced by using the lignocellulose hydrolysate as the substrate ester-decomposing yeast engineering bacteria at present is achieved, and a foundation is laid for the subsequent production of high-value triacetate lactone by using a low-cost carbon source through a biological method.

Description

Technical Field

[0001] The present invention relates to the technical field of biosynthesis and genetic engineering, in particular to an engineered esterolytic yeast for synthesizing triacetic acid lactone by utilizing lignocellulose and its application. Background Art

[0002] Lignocellulose is the most abundant renewable biomass, primarily composed of cellulose, hemicellulose, and lignin. It is widely available and inexpensive, occurring in large quantities in solid agricultural and forestry wastes such as straw, sorghum, sugarcane, corn stover, and wheat bran. However, the current disposal method for lignocellulose raw materials is landfill or combustion, which not only wastes resources but also pollutes the environment.

[0003] The cellulose and hemicellulose components of lignocellulose are primarily composed of glucans and xylans. Chemical or biological treatment yields hydrolyzates rich in glucose and xylose. Numerous studies have reported on the use of microbial cell factories to convert lignocellulose feedstock into high-value biochemicals. However, studies have shown that xylose, a pentose sugar found in abundant wood fiber, is difficult for most microorganisms to efficiently utilize. Therefore, improving the utilization efficiency of xylose and xylan in lignocellulose feedstock is key to achieving its comprehensive utilization.

[0004] Triacetic acid lactone (TAL), with the chemical formula C6H6O3, is a pale yellow crystalline powder at room temperature with high melting and boiling points. Due to its unique chemical structure, TAL possesses properties similar to those of pyrans and polyketides, making it widely applicable in various industrial fields. TAL is commonly used in the food industry to produce various food additives and antioxidants, including γ-caprolactone, sorbic acid, and 2-hexenoic acid. Furthermore, due to the anti-inflammatory properties of 2-pyrone, TAL can be used to produce antibiotics, antifungals, and anticancer agents. Furthermore, TAL is used as an intermediate and precursor in the materials and chemical fields to produce high-value products, including 1,3-pentadiene, 1,3,5-triamino-2,4,6-trinitrobenzene (TATB), resorcinol, phloroglucinol, and acetylacetone. Acetylacetone, a key commercial chemical, is a key additive in aircraft fuels, metal extraction, and resin modification. Acetylacetone can be obtained through the ring-opening and decarboxylation reactions of TAL without any catalyst. Due to its wide range of applications, TAL was selected by the U.S. Department of Energy in 2004 as one of the ten most promising platform molecules.

[0005] Yarrowia lipolytica is a non-traditional model oleaginous yeast well-suited for the industrial production of oleochemicals. Wild-type strains can accumulate up to 70% of their dry biomass as lipids. Yarrowia lipolytica has high acetyl-CoA flux and tricarboxylic acid cycle flux, and can grow under a wide range of pH and salinity conditions. Therefore, Yarrowia lipolytica is considered an advantageous platform for the industrial production of triacetic acid lactones. Hal S. Alper et al. used Yarrowia lipolytica as a platform and successfully constructed a triacetic acid lactone biosynthesis pathway by expressing the 2-pyrone synthase gene from Gerbera chrysanthemum. Through metabolic pathway optimization and fermentation process optimization, TAL production reached 35.9 g / L using glucose as a substrate. Using this strain as a starting strain, they fused it with an engineered Yarrowia lipolytica strain expressing the xylose metabolic pathway to generate a diploid strain of Yarrowia lipolytica that can utilize xylose. However, TAL production was only 2.9 g / L using xylose as a feedstock.

[0006] Currently, there are few studies on the synthesis of TAL using lignocellulose hydrolysate as a raw material. Professor Yong-Su Jin's team at the University of Illinois at Urbana-Champaign has developed an engineered lipolytic yeast strain that produces 3.55 g / L of TAL using hemicellulose hydrolysate as a raw material. This yield is lower than that of glucose or xylose. However, there are no reports on the direct synthesis of TAL using xylan from lignocellulose as a raw material. Summary of the Invention

[0007] The present invention aims to provide an engineered lipolytic yeast for synthesizing triacetic acid lactone from lignocellulose and its application, in order to solve the problems existing in the above-mentioned prior art. By optimizing the metabolic pathway of the lipolytic yeast Yali05-10 and obtaining a functional bacterium, combined with the optimization of fermentation conditions, the content of triacetic acid lactone synthesized by the engineered bacterium can be significantly increased.

[0008] To achieve the above object, the present invention provides the following solutions:

[0009] The present invention provides an engineered lipolytic yeast, characterized in that it comprises any one of the bacteria shown in (1) or (2):

[0010] (1) Using the lipolytic yeast strain Yali05-10 as the starting strain, the fatty acid synthase gene FAS was weakened and the heterologous phosphoketase gene PK, phosphotransacetylase gene Pta and citrate lyase gene ACL were overexpressed to obtain the lipolytic yeast engineered strain Yali14-3;

[0011] (2) Using the lipolytic yeast engineered strain Yali14-3 obtained in step (1) as the starting strain, the secretory peptide gene SP7, the xylanase gene xlnD and the xylosidase gene xyn2 were introduced to obtain the lipolytic yeast strain Yali13-7.

[0012] The fatty acid synthase gene FAS, phosphoketolase gene PK, phosphotransacetylase gene Pta, citrate lyase gene ACL1, xylanase gene xlnD, xylosidase gene xyn2 and secretory peptide gene SPX are expressed by plasmid expression or genome integration expression.

[0013] Preferably, the fatty acid synthase genes FAS1 and FAS2 are attenuated by the CRISPR-dCas9 system, and the nucleotide sequences are shown in SEQ ID NO.27 and SEQ ID NO.28, respectively;

[0014] and / or the nucleotide sequence of the phosphoketase gene PK is any one of SEQ ID NOs. 1-3;

[0015] and / or the nucleotide sequence of the phosphotransacetylase gene Pta is any one of SEQ ID NOs. 4-5;

[0016] and / or the nucleotide sequence of the citrate lyase gene ACL is any one of SEQ ID NOs. 7-9.

[0017] Preferably, the nucleotide sequence of the gRNA of the CRISPR-dCas9 system is shown in SEQ ID NO. 25-26. The promoter used to express the gRNA in the attenuation system of the present invention is a fatty acid inducible promoter P POX 、P LIP or constitutive promoter P TEF 、P PGK wait.

[0018] Preferably, the nucleotide sequence of the secretory peptide gene SPX is any one of SEQ ID NOs. 10-18; SP7 is used as an example for illustration in the embodiments of the present invention.

[0019] and / or the nucleotide sequence of the xylanase gene xlnD is any one of SEQ ID NOs. 19-21;

[0020] And / or the nucleotide sequence of the xylosidase gene xyn2 is any one of SEQ ID NOs. 22-24.

[0021] The present invention also provides application of the lipolytic yeast engineering bacteria in producing triacetic acid lactone.

[0022] The present invention also provides a method for producing triacetic acid lactone using the lipolytic yeast engineered bacteria, comprising the steps of (1) inoculating the lipolytic yeast engineered bacteria Yali14-3 into a fermentation medium with lignocellulose hydrolyzate as a carbon source for fermentation; or (2) inoculating the lipolytic yeast engineered bacteria Yali13-7 into a fermentation medium with xylan as a carbon source for fermentation.

[0023] Preferably, the fermentation medium for the engineered lipolytic yeast strain Yali14-3 comprises the following components: 25-35 mL of lignocellulose hydrolysate, 15-25 g / L of tryptone, 5-15 g / L of yeast extract, and the remainder water, with the pH adjusted to 2.5-7.5. Fermentation conditions are: inoculum size 1%-5%, fermentation temperature 25-35°C, rotation speed 200-300 rpm, and fermentation time 5-7 days.

[0024] Preferably, the fermentation medium of the engineered lipolytic yeast strain Yali13-7 comprises the following components: 30-50 g / L xylan, 15-25 g / L tryptone, 5-15 g / L yeast extract, and the remainder water, with the pH adjusted to 2.5-7.5. Fermentation conditions are: inoculum size 1%-5%, fermentation temperature 25-35°C, rotation speed 200-300 rpm, and fermentation time 5-7 days.

[0025] Preferably, the engineered lipolytic yeast Yali14-3 increases the supply of the precursor substance acetyl-CoA by introducing the expression of the heterologous phosphoketolase gene PK, the phosphotransacetylase gene Pta, and the citrate lyase gene ACL1, so that the strain can synthesize triacetic acid lactone using the xylose-rich lignocellulose hydrolyzate raw material, thereby improving the synthesis yield of triacetic acid lactone.

[0026] Preferably, the engineered lipolytica yeast Yali13-7 is capable of simultaneously saccharifying and converting xylan to produce triacetic acid lactone.

[0027] The present invention discloses the following technical effects:

[0028] The present invention is based on the previously constructed lipolytic yeast Yali05-10 that integrates exogenous xylose reductase gene XR, xylulose dehydrogenase gene XDH, and xylulokinase gene XK. By weakening the fatty acid synthesis pathway and strengthening the supply of the precursor substance acetyl-CoA, an engineered lipolytic yeast that can efficiently convert lignocellulose hydrolysate is constructed. Based on this, exogenous xylanase and xylosidase are expressed to construct an engineered lipolytic yeast that can simultaneously saccharify and convert xylan and synthesize TAL.

[0029] The lipolytic yeast engineered bacteria constructed by the present invention can utilize lignocellulose, a cheap carbon source, to produce triacetic acid lactone (the metabolic pathway for producing triacetic acid lactone in lipolytic yeast is as followsFigure 1 By optimizing the pathway and culture medium, the shake flask yield of triacetic acid lactone using lignocellulose hydrolysate as the substrate was maintained at 5.01 g / L; the shake flask yield of triacetic acid lactone using xylan as the substrate was 1.18 g / L. This is the highest yield of triacetic acid lactone produced by engineered ester-lytic yeast using lignocellulose hydrolysate as the substrate so far, laying the foundation for the subsequent use of inexpensive carbon sources to produce high-value triacetic acid lactone by biological methods. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0031] Figure 1 Metabolic diagram of the production of triacetic acid lactone in esterolytic yeast;

[0032] Figure 2 is the map of the recombinant plasmid PrDNAloxP-dCas9-FAS;

[0033] Figure 3 The fermentation results of Yali14-3 using non-detoxified lignocellulose hydrolysate;

[0034] Figure 4 The fermentation results of Yali14-3 using detoxified lignocellulose hydrolysate;

[0035] Figure 5 These are the fermentation results of Yali13-7 utilizing xylan. DETAILED DESCRIPTION

[0036] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0037] It should be understood that the terms described herein are intended only to describe particular embodiments and are not intended to limit the present invention. In addition, for numerical ranges herein, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. The intermediate value within any stated value or stated range, and each smaller range between any other stated value or intermediate value within the stated range, is also encompassed within the present invention. The upper and lower limits of these smaller ranges may be independently included or excluded within the scope.

[0038] Unless otherwise indicated, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art. Although only preferred methods and materials are described herein, any methods and materials similar or equivalent to those described herein may also be used in the practice or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of any conflict with any incorporated document, the contents of this specification shall prevail.

[0039] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments described herein without departing from the scope or spirit of the invention. Other embodiments will be apparent to those skilled in the art from the description of the invention. The description and examples are intended to be illustrative only.

[0040] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0041] Based on the previously constructed lipolytic yeast Yali05-10, which integrates exogenous xylose reductase XR, xylulose dehydrogenase XDH, and xylulokinase XK, this invention constructs an engineered lipolytic yeast strain that efficiently converts lignocellulose hydrolysate by weakening the fatty acid synthesis pathway and enhancing the supply of the precursor acetyl-CoA. Furthermore, by expressing exogenous xylanase and xylosidase, an engineered lipolytic yeast strain capable of simultaneously saccharifying and converting xylan to synthesize TAL was constructed. This provides a feasible approach for the industrial production of triacetic acid lactone from inexpensive lignocellulose feedstock. Specific examples are provided below to further illustrate this.

[0042] The lipolytic yeast Yali05-10 used in the following examples and its preparation method have been disclosed in the document "Construction of an engineered lipolytic yeast for producing triacetic acid lactone using lignocellulosic raw materials".

[0043] The primer sequences involved in the following examples are shown in Table 1.

[0044] Table 1 Primer sequences involved in the present invention

[0045]

[0046] Example 1: Construction of an engineered lipolytic yeast strain Yali11-3 that inhibits the synthesis of by-product fatty acids

[0047] In order to reduce the waste of the precursor substance acetyl-CoA, the CRISPR-dCas system driven by the fatty acid-responsive promoter Ppox was introduced into the strain Yali05-10 to inhibit the transcriptional expression of fatty acid synthase, thereby inhibiting fatty acid synthesis, and obtaining the optimized lipolytic yeast engineered strain Yali11-3.

[0048] (1) Construction of PrDNAloxP-dCas9-FAS expression plasmid

[0049] PrDNAloxP was selected as the expression vector, and the PrDNAloxP-dCas9-FAS plasmid was constructed using the homozygous enzyme ligation method. The integrated plasmid contains two small sgRNAs targeting FAS1 and FAS2, as well as the dCas9 protein. Single-stranded guide RNA gRNA1-2 (nucleotide sequence: 5'-TTTTGCTACAGGAAACAGCG-3', SEQ ID NO. 25) targeting FAS1 and single-stranded guide RNA gRNA2-1 (nucleotide sequence: 5'-CTGATTTGTGGCTCAGGTTT-3', SEQ ID NO. 26) targeting FAS2 were designed and synthesized by Jinweizhi Company and constructed on the PrDNAloxP plasmid to obtain PrDNAloxP-gRNA-dFAS12. The PYLXP'-dCas9 plasmid was cut with AvrII and SalI as restriction sites for gel recovery of the target fragment, while the PrDNAloxP-gRNA-dFAS12 plasmid was cut with NheI and SalI as restriction sites for gel recovery of the backbone. The fragments were ligated via T4 ligation. The ligation system was as follows: 100 ng of vector gene fragment, 300 ng of target gene fragment, a molar ratio of vector to target fragment of 1:3, 4 μl of 5× buffer, 1 μl of T4 DNA ligase, and ddHO. The volume was filled to 20 μl with H2O; reaction conditions: 37°C, 30 min. The T4 ligation product was then transformed into competent E. coli DH5α cells via heat transformation and cultured in LB solid medium. Discrete monoclonal colonies formed on the surface of the solid medium were picked with a sterile pipette tip. Specific primer pairs (D1-F / R, D2-F / R, gRNA-FAS1-2 / gRNA-FAS2-1, D4-F / R) were designed to target sequences flanking the vector's multiple cloning site, and a 20 μL PCR amplification system was prepared. Amplified products were analyzed using agarose gel electrophoresis. Detection of a characteristic band of the expected molecular weight indicated that the target recombinant plasmid, PrDNAloxP-dCas9-FAS (see Figure 2), had been successfully constructed.

[0050] Amplification reaction system: Prime Star Max 25 μL, upstream and downstream primers 2 μL each, template 1 μL, ddH2O fill to 20 μL.

[0051] Amplification program: pre-denaturation at 95°C for 3 min; denaturation at 95°C for 15 s, annealing at 55-62°C for 15 s, extension at 72°C, 30 s per 1000 bp, 34 cycles; extension at 72°C for 5 min; hold at 4°C.

[0052] (2) Transformation and verification of integrated fragments

[0053] The dCas9-FAS fragment was linearized using AvrII and NotI restriction sites. The fragment containing the dCas9-FAS target gene was transformed into the lipolytic yeast Yali05-10 using the PEG-lithium acetate method (see Liu Yangming: Construction of Yarrowia Lipolytica Strain For Producing Triacetic Acid Lactone From Lignocellulose), generating the engineered lipolytic yeast strain Yali05-10-dFAS12-URA. The genome of the transformant was extracted using a Biomed yeast genomics kit, and the primer pair gRNA-FAS1-2 / gRNA-FAS2-1 was designed to verify the integration of the target gene.

[0054] (4) Recycling of labeled fragments

[0055] The plasmid PYLXP'-Cre carrying the Cre enzyme was transformed into a successfully validated strain and screened on XYL-Leu-5FOA plates (30-50 g / L xylose, 1.5-2 g / L YNB, 0.05-0.1 g / L CSM-leu, 0.5-1.0 g / L ammonium sulfate, the remainder water, pH adjusted to 2.5-7.5). The URA3 marker was recovered (see Liu Yangming: Construction of Yarrowia Lipolytica Strain for Producing Triacetic Acid Lactone from Lignocellulose). The strain containing the URA3 marker was designated Yali11-3, an engineered lipolytic yeast strain with suppressed byproduct fatty acid synthesis.

[0056] Example 2: Enhanced precursor supply to construct the lipolytic yeast Yali14-3

[0057] To enhance the supply of the precursor acetyl-CoA, phosphoketolase PK, phosphotransacetylase Pta, and citrate lyase ACL1 were heterologously expressed in strain Yali11-3.

[0058] (1) Construction of prDNAloxp-Pta-LIXpk-ACL1 expression plasmid

[0059] The genome of yeast Yali11-3 was extracted using a genome extraction kit. The extracted yeast genome was used as a template to amplify phosphoketase PK (phosphoketase genes are derived from Lactococcus lactis, Bifidobacterium, and Corynebacterium glutamicum, and the nucleotide sequences are shown in SEQ ID NO.1, SEQ ID NO.2, and SEQ ID NO.3, respectively), phosphotransacetylase Pta (phosphotransacetylase genes are derived from Escherichia coli, Bacillus subtilis, and Clostridium kluyveri, and the nucleotide sequences are shown in SEQ ID NO.4, SEQ ID NO.5, and SEQ ID NO.6, respectively); and citrate lyase ACL1 (citrate lyase genes are derived from Yarrowia lipolytica, Aspergillus oryzae, and Lipomyces starkeyi, and the nucleotide sequences are shown in SEQ ID NO. After screening, it was found that phosphoketolase PK from Lactococcus lactis, phosphotransacetylase Pta from Escherichia coli, and citrate lyase ACL1 endogenous to Saccharomyces lipolytica were more effective. The following examples further construct the prDNAloxp-Pta-LIXpk-ACL1 expression plasmid, specifically:

[0060] The prDNAloxp plasmid was used as an expression vector to construct the expression vector prDNAloxp-Pta-LIXpk-ACL1, containing phosphoketolase PK, phosphotransacetylase Pta, and citrate lyase ACL1. PK, Pta, and ACL1 were derived from different exogenous genomes. The target gene fragments with homology arms were amplified using primers P-PK-F / P-PK-R, P-Pta-F / P-Pta-R, and P-ACL1-F / P-ACL-R. The prDNAloxp vector backbone carries the Leu resistance gene.

[0061] Amplification reaction system: Prime Star Max 25 μL, upstream and downstream primers 2 μL each, template 1 μL, ddH2O fill to 20 μL.

[0062] Amplification program: pre-denaturation at 95°C for 3 min; denaturation at 95°C for 15 s, annealing at 55-62°C for 15 s, extension at 72°C, 30 s per 1000 bp, 34 cycles; extension at 72°C for 5 min; hold at 4°C.

[0063] The amplified gene fragment was connected to the expression vector prDNAloxp to obtain an expression plasmid containing the target genes PK, Pta and ACL1.

[0064] (2) Construction of the lipolytic yeast engineered strain Yali14-3 and fermentation culture

[0065] The plasmid prDNAloxp-Pta-LIXpk-ACL1 was linearized and transformed into the lipolytic yeast Yali11-3. The successfully transformed strain was selected and named Yali14-3. The transformation method and verification are shown in Example 1.

[0066] Example 3: Production of triacetic acid lactone by engineered bacteria Yali14-3 using lignocellulose hydrolysate

[0067] Lignocellulose hydrolysate, obtained after lignocellulose processing, can serve as an inexpensive carbon source for microbial fermentation. However, pretreatment of lignocellulose raw materials can produce substances such as furfural, weak acids, and phenols. These compounds can inhibit yeast growth and negatively impact the fermentation process. Detoxification can remove these inhibitors, allowing microorganisms to better utilize lignocellulose hydrolysate to produce products.

[0068] (1) Preparation of lignocellulose hydrolysate

[0069] Corn straw hydrolysate (lignocellulosic hydrolysate) was prepared using steam explosion (Su C, Zhang C, Wu Y, et al. Combination of pH adjusting and intermittent feeding can improve fermentative acetone-butanol-ethanol (ABE) production from steam exploded cornstover [J]. Renew Energ, 2022, 200:592-600). Undetoxified hydrolysate contained 35-45 g / L glucose and 7-12 g / L xylose. Physically detoxified hydrolysate reduced the concentration to 30-40 g / L glucose and 6-10 g / L xylose. Using this prepared lignocellulosic hydrolysate as a carbon source, the synthesis of TAL using both detoxified and undetoxified hydrolysates was further investigated.

[0070] (2) Fermentation culture of integrated strains

[0071] Based on the fermentation optimization results in the previous work, the ability of the optimized strain Yali14-3 to ferment and produce triacetic acid lactone using two types of lignocellulose hydrolysates as substrates was explored.

[0072] The Yali14-3 strain was inoculated into 3 mL of YPX seed medium and cultured at 30°C for 24 h. It was then inoculated into a 250 mL shake flask containing 30 mL of YPW fermentation medium at a 2% inoculum size. The culture was carried out at 250 rpm, with the pH adjusted to 6.5-7.0, and cultured at 30°C for 7 days. Three parallel samples were set up in the experiment.

[0073] The components and contents of YPX seed culture medium are as follows: xylose 20g / L, yeast extract powder 10g / L, tryptone 20g / L,

[0074] The components and contents of the YPW fermentation medium are as follows: 30 mL of non-detoxified lignocellulose hydrolysate, 10 g / L yeast extract, 20 g / L tryptone, and the remainder is water, pH 2.5-7.5; or 30 mL of detoxified lignocellulose hydrolysate, 10 g / L yeast extract, 20 g / L tryptone, and the remainder is water, pH 2.5-7.5;

[0075] (3) Analysis and detection of cell growth and product TAL

[0076] Measure the OD of the fermentation broth using a microplate reader or UV spectrophotometer 600 The fermentation broth was centrifuged at 13000 rpm for 10 minutes, the supernatant was filtered through a membrane, and the content of target product TAL, xylose, glucose and citric acid in the fermentation broth was determined by high performance liquid chromatography.

[0077] TAL detection conditions: A Welch Ultimate LP-C18 (4.6×250 mm, 5 μm) column was used, with 1% acetic acid as the mobile phase, a UV detector at a wavelength of 280 nm, a flow rate of 1 mL / min, an injection volume of 10 μL, a column temperature of 50°C, a detection time of 60 minutes, and a peak elution time of approximately 51 minutes. Residual sugar and citric acid detection conditions: A Bio-Rad Aminex HPX-87H organic acid column was used, with 5 mM sulfuric acid as the mobile phase at a flow rate of 0.6 mL / min. Glucose and xylose were detected using a differential detector, and citric acid was detected using a UV detector with an absorption wavelength set to 210 nm.

[0078] (4) Results

[0079] like Figure 3As shown, the integrated strain Yali14-3 used non-detoxified lignocellulose hydrolysate as substrate and produced TAL of 4.35 g / L; Figure 4 As shown in the figure, the TAL production reached 5.01 / L using detoxified lignocellulose hydrolysate as substrate.

[0080] The Yali14-3 strain was more effective in utilizing detoxified lignocellulose hydrolysate than non-detoxified lignocellulose hydrolysate, laying the foundation for further research on the production of high-value triacetic acid lactone using lignocellulose as a cheap carbon source.

[0081] Example 4: Construction and cultivation of engineered ester-lytic yeast for simultaneous saccharification and conversion of xylan to triacetic acid lactone

[0082] Using the lipolytic yeast Yali14-3 as the starting strain, xylanase (xlnD) and xylosidase (xyn2) with secretion signal peptides were expressed to construct the xylan metabolic pathway.

[0083] (1) Construction of expression plasmids containing the secretory peptide SPX for xylanase and xylosidase genes

[0084] The secretory peptide SPX is a microbial gene derived from Saccharomyces cerevisiae, Bacillus licheniformis, Bacillus subtilis, etc., and the nucleotide sequence is any one of the following:

[0085] SP1: atgaagttcacatttgctgccgttac cgccgcgctggcctcgtccgccatggcc, SEQ IDNO.10;

[0086] SP2: atgaagttctccaccgcccttctggctctggccgccgtcgccaccgcc, SEQ ID NO.11;

[0087] SP3: atgaaatctctattgctgtcgctgct ggcggtcccggccaccgcc, SEQ ID NO.12;

[0088] SP4: atgaagttctcagcggtctcaatcgctgctgccctggcctcgctggtggcagca, SEQ IDNO.13;

[0089] SP5: atgaagctctccatcgttctcgtggc tctggcagccgtctcctccgcc, SEQ ID NO.14;

[0090] SP6: atgaagttctccaccgcccttctggct ctggccgccgtcgccaccgcc, SEQ ID NO.15;

[0091] SP7: atgaagctgtctaccattctgtttaccgcttgtgctactctggctctcgctctggct, SEQ IDNO.16;

[0092] SP8: atgaaggtgctcgccctgctggttac tgtctgcttttccgttgcctcggct, SEQ IDNO.17;

[0093] SPT: atgaagctcgctaccgcctttactatt ctcacggccgttctggcc, SEQ ID NO. 18.

[0094] Xylanase xlnD is a microbial gene derived from Aspergillus niger, Marinimicrobium sp. strain, and Bacillus tequilensis, and the nucleotide sequences are shown in SEQ ID NO. 19, SEQ ID NO. 20, and SEQ ID NO. 21, respectively;

[0095] Xylosidase xyn2 is a microbial gene derived from Trichoderma Reesei, Microbulbifer Thermotolerans DAU221, and Streptomyces Albogriseolus NPDC052628. The nucleotide sequences are shown in SEQ ID NO.22, SEQ ID NO.23, and SEQ ID NO.24, respectively.

[0096] The plasmid pYLXP'-SP7-xlnD-SP7-xyn2 carries exogenous xylanase (xlnD) and xylosidase (xyn2) genes, the secretory peptide gene SP7, and the LEU selection marker. Both xlnD and xyn2 are derived from different exogenous genomes. The optimized nucleotide sequence xlnD was obtained by amplification using P-SP7-xlnD-F / P-xlnD-R primers (amplification conditions were the same as in Example 2). The optimized nucleotide sequence xyn2 was obtained by amplification using P-SP7-xyn2-F / P-xyn2-R primers (amplification conditions were the same as in Example 2). The backbone contains ampicillin and leucine resistance genes. The resulting gene fragments were ligated into the expression vector pYLXP' to obtain the plasmid pYLXP'-SP7-xlnD-SP7-xyn2.

[0097] (2) Plasmid transformation and verification

[0098] The plasmid pYLXP'-SP7-xlnD-SP7-xyn2 was transformed into the lipolytic yeast Yali14-3 by yeast. The successfully transformed strain was selected and the strain with the highest yield was named Yali13-7. The transformation method is shown in Example 1, and the fermentation method and fermentation broth analysis method are shown in Example 3.

[0099] The components and contents of XYL-Leu seed culture medium are as follows: xylose 20 g / L, amino-free yeast nitrogen source 1.7 g / L, CSM-LEU 0.069 g / L, ammonium sulfate 0.5 g / L, and the remainder water;

[0100] The components and contents of the XYL-Leu fermentation medium are as follows: 40 g / L xylan, 20 g / L tryptone, 10 g / L yeast extract powder, and the remainder is water. The pH is adjusted to 2.5-7.5.

[0101] (3) Results

[0102] Based on the lipolytic yeast Yali14-3, the secretory peptide SP7 gene, xylanase xlnD and xylosidase xyn2 genes were introduced. The lipolytic yeast strain can grow on the medium with xylan as substrate. After 120h of fermentation, the strain with the highest TAL production, Yali13-7, reached 1.18g / L (see Figure 5 ) to achieve the synchronous saccharification, conversion and utilization of xylan by lipolytic yeast.

[0103] The present invention relates to the sequence:

[0104] SEQ ID NO.1 (2246 bp):

[0105]

[0106] SEQ ID NO.2(2475bp):

[0107]

[0108] SEQ ID NO.3(2436bp):

[0109]

[0110] SEQ ID NO.4(2145bp):

[0111]

[0112] SEQ ID NO.5(2322bp):

[0113]

[0114] SEQ ID NO.6(2289bp):

[0115]

[0116] SEQ ID NO.7(1950bp):

[0117]

[0118] SEQ ID NO.8(2120bp):

[0119]

[0120] SEQ ID NO.9(1058bp):

[0121]

[0122] SEQ ID NO.19(2421bp):

[0123]

[0124] SEQ ID NO.20(1260bp):

[0125]

[0126] SEQ ID NO.21(1893bp):

[0127]

[0128] SEQ ID NO.22(678bp):

[0129] taaccgcaggtgtctttcacctctctgctggccggagtggccgccatctctggcgtcctggctgctcccgctgctgaggtggagcccgtggctgtggagaagcgacagaccatccaacccggaactggctacaacaacggctacttccactcttactggaacgacggccacggcggcgtgacctacaccaacggccccggcggacagttctctgtgaactggtctaactctggcaacttcgtgggcggcaagggctggcagcccggcaccaagaacaaggtgatcaacttctctggctcttacaaccccaacggcaactcttacctgtctgtgtacggctggtctcgaaaccccctgatcgagtactacatcgtgggcaacttcggcacctacaacccctctaccggcgccaccaagctgggcgaggtgacctctgacggctctgtgtacgacatctaccgaactcagcgagtgaatcagccctctatcatcggcaccgccaccttctatcagtactggtctgtgcgacgaaaccaccgatcttccggctctgtgaacaccgccaaccacttcaacgcctgggctcagcaaggcctgaccctgggcaccatggactatcagatcgtggccgtggaaggatatttctcctctggctctgcctctatcaccgtgtcttaa。

[0130] SEQ ID NO.23(1644bp):

[0131]

[0132] SEQ ID NO.24(1518bp):

[0133]

[0134] FAS1 nucleotide sequence (SEQ ID NO.27):

[0135]

[0136] FAS2 nucleotide sequence (SEQ ID NO.28):

[0137]

[0138] The embodiments described above are merely descriptions of preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Without departing from the spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by ordinary technicians in this field should fall within the scope of protection determined by the claims of the present invention.

Claims

1. A lipolytic yeast engineered bacterium, characterized in that It includes any one of the bacteria shown in (1) or (2): (1) Using the lipolytic yeast strain Yali05-10 as the starting strain, the fatty acid synthase gene FAS was weakened and the heterologous phosphoketase gene PK, phosphotransacetylase gene Pta and citrate lyase gene ACL were overexpressed to obtain the lipolytic yeast engineered strain Yali14-3; (2) Using the lipolytic yeast engineered strain Yali14-3 obtained in step (1) as the starting strain, the secretory peptide gene SPX, the xylanase gene xlnD and the xylosidase gene xyn2 were introduced to obtain the lipolytic yeast strain Yali13-7.

2. The engineered lipolytic yeast according to claim 1, wherein The fatty acid synthase genes FAS1 and FAS2 were attenuated using the CRISPR-dCas9 system, and the nucleotide sequences were shown in SEQ ID NO. 27 and SEQ ID NO. 28, respectively; and / or the nucleotide sequence of the phosphoketase gene PK is any one of SEQ ID NOs. 1-3; and / or the nucleotide sequence of the phosphotransacetylase gene Pta is any one of SEQ ID NOs. 4-5; and / or the nucleotide sequence of the citrate lyase gene ACL is any one of SEQ ID NOs. 7-9.

3. The engineered lipolytic yeast according to claim 2, wherein The nucleotide sequence of the gRNA of the CRISPR-dCas9 system is shown in SEQ ID NO.25-26.

4. The engineered lipolytic yeast according to claim 1, wherein The nucleotide sequence of the secretory peptide gene SPX is any one of SEQ ID NOs. 10-18; and / or the nucleotide sequence of the xylanase gene xlnD is any one of SEQ ID NOs. 19-21; And / or the nucleotide sequence of the xylosidase gene xyn2 is any one of SEQ ID NOs. 22-24.

5. Use of the engineered lipolytic yeast according to any one of claims 1 to 4 in the production of triacetic acid lactone.

6. A method for producing triacetic acid lactone using the lipolytic yeast engineered bacteria according to any one of claims 1 to 4, characterized in that: The method comprises the steps of (1) inoculating the lipolytic yeast engineered bacteria Yali14-3 into a fermentation medium with lignocellulose hydrolysate as a carbon source for fermentation; or (2) inoculating the lipolytic yeast engineered bacteria Yali13-7 into a fermentation medium with xylan as a carbon source for fermentation.

7. The method according to claim 6, wherein The fermentation medium of the lipolytic yeast engineered bacteria Yali14-3 comprises the following components: 25-35 mL of lignocellulose hydrolyzate prepared from straw, 15-25 g / L of tryptone, 5-15 g / L of yeast extract powder, and the rest is water, and the pH is adjusted to 2.5-7.

5.

8. The method according to claim 6, wherein The fermentation medium of the lipolytic yeast engineered bacteria Yali13-7 comprises the following components: 30-50 g / L of xylan, 15-25 g / L of tryptone, 5-15 g / L of yeast extract powder, and the remainder is water, and the pH is adjusted to 2.5-7.

5.

9. The method according to claim 6, wherein The lipolytic yeast engineered bacterium Yali14-3 improves the synthesis yield of triacetic acid lactone by increasing the supply of the precursor substance acetyl coenzyme A.

10. The method according to claim 6, wherein The lipolytic yeast engineered bacterium Yali13-7 can simultaneously saccharify and convert xylan to produce triacetic acid lactone.

Images