A golden tiger kidney cell and its establishment method and application

By treating golden tiger grouper kidney cells with enzymatic digestion and culturing them in L-15 complete culture medium, a stably proliferating golden tiger grouper kidney cell line was established, solving the problem of the lack of golden tiger grouper kidney cell lines and enabling research on iridovirus and bacterial infections and drug preparation.

CN120442527BActive Publication Date: 2026-02-24QINGDAO AGRI UNIV
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202510605022.9
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-05-12
Publication Date
2026-02-24
Estimated Expiration
2045-05-12

AI Technical Summary

Technical Problem

Currently, there is no established kidney cell line for golden tiger grouper, which makes it difficult to effectively study the infection mechanisms of iridoviruses and bacteria, and to prepare corresponding vaccines and therapeutic drugs.

Method used

Golden tiger grouper kidney cells were treated with enzymatic digestion and cultured in L-15 complete medium for primary and subculture. The composition of the culture medium was adjusted to obtain stably proliferating golden tiger grouper kidney cells, which were then used to construct iridovirus and bacterial infection models.

Benefits of technology

A golden tiger kidney cell line capable of stable proliferation for more than 70 generations was established. The cells exhibit rapid growth, stable morphology, and sensitivity to iridoviruses and common pathogens in aquaculture, and can be used to study infection mechanisms and prepare vaccines/therapeutic drugs.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120442527B_ABST
    Figure CN120442527B_ABST
Patent Text Reader

Abstract

The application discloses a gold tiger kidney cell, a method for establishing the same and an application thereof, and belongs to the technical field of cell culture. The gold tiger kidney cell is preserved in the China General Microbiological Culture Collection Center on April 3, 2025, and the preservation number is CGMCC No.46341. The gold tiger kidney cell can be stably proliferated for more than 70 generations, has a high proliferation speed, is stable in morphology, is sensitive to iridovirus and common pathogenic bacteria in aquaculture, and can be used to establish an iridovirus or bacterial infection cell model, thereby laying a foundation for researching an iridovirus infection mechanism, a bacterial infection mechanism, preparing an iridovirus vaccine or a therapeutic drug, and a bacterial infection therapeutic drug.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of cell culture technology, and in particular to a golden tiger-spotted kidney cell, its establishment method, and its application. Background Technology

[0002] Fish cell lines provide powerful tools for studying epidemiology, toxicology, pathology, immunology, and the isolation and identification of fish viruses. They are also tools for studying the gene function of cell-derived tissues. The kidneys, as vital immune organs, are frequently attacked by pathogens, causing fish mortality and significant economic losses. Therefore, establishing healthy and sensitive cell lines is crucial for isolating, identifying, and describing infectious viruses in fish and for studying fish immune mechanisms.

[0003] The Golden Tiger Grouper is a hybrid of the Brown Spotted Grouper (Epinephelus fuscoguttatus♀) and the Blue Spotted Grouper (Epinephelus tukula♂), representing a new breed with superior traits. The Brown Spotted Grouper has high market value and delicious flesh, but it grows slowly and has a long feeding cycle. Due to its strong disease resistance, it is often used as the female parent for hybrid groupers. The Blue Spotted Grouper is distributed in the waters of southern China, with its main breeding stock coming from wild catches. The Golden Tiger Grouper is obtained through artificial insemination using frozen sperm from the Blue Spotted Grouper and eggs from the Brown Spotted Grouper. As a new hybrid grouper variety, it exhibits excellent traits such as rapid growth, tolerance to low temperatures (16-32℃), tolerance to low oxygen levels (0.24mg / L), and rich nutrition, making it suitable for factory farming, pond culture, and deep-sea cage culture in both northern and southern regions. The successful breeding and widespread application of the Golden Tiger Grouper will strongly promote innovation in marine fisheries seed industry and the development of the fisheries economy. However, in recent years, the emergence of iridovirus has caused serious economic losses to the grouper farming industry.

[0004] The kidney is a primary organ for viral infection in fish, especially in grouper. Kidney cells have been established and applied in various fields. For example, Xu Jin et al. established a channel catfish (Lctalurus puncatatus) kidney cell line (CCK) for virus isolation and identification; Zhang Xiaoyu et al. established a perch (Trachidermus fasciatus) kidney cell line for virus and cadmium ion sensitivity testing, and found that perch can serve as a biological indicator for cadmium ion detection. Currently, the establishment of a golden tiger grouper kidney cell line has not been reported. Therefore, it is necessary to establish a golden tiger grouper kidney cell line to provide excellent experimental material for research on grouper viral diseases and gene function. Summary of the Invention

[0005] The purpose of this invention is to provide a golden tiger-spotted kidney cell, its establishment method, and its application, to solve the problems existing in the prior art. The golden tiger-spotted kidney cells of this invention can stably proliferate for more than 70 generations, exhibiting rapid proliferation, stable morphology, and sensitivity to iridoviruses and common pathogens in aquaculture. They can be used to establish cell models of iridovirus or bacterial infection, laying the foundation for studying the infection mechanisms of iridoviruses and bacteria, and for preparing iridovirus vaccines or therapeutic drugs, as well as therapeutic drugs for bacterial infections.

[0006] To achieve the above objectives, the present invention provides the following solution:

[0007] This invention provides a golden tiger-spotted kidney cell, which was deposited on April 3, 2025 at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC No. 46341.

[0008] This invention also provides a method for establishing the above-mentioned golden tiger-spotted kidney cells, comprising the following steps:

[0009] Kidney tissue was taken from golden tiger grouper, digested, and single cells were obtained; the single cells were seeded in L-15 complete culture medium for primary culture.

[0010] Primary cultured cells until fusion, digested and then seeded into L-15 complete culture medium for passage culture to obtain the golden tiger-spotted kidney cells;

[0011] The complete culture medium for L-15 is: L-15 culture medium + 20% fetal bovine serum + 200 IU / ml penicillin + 200 IU / ml streptomycin;

[0012] During the passage culture, after the 5th generation, the concentration of penicillin in the L-15 complete culture medium was adjusted to 100 IU / ml, the concentration of streptomycin was adjusted to 100 IU / ml, and the concentration of fetal bovine serum was adjusted to 15%; after the 10th generation, the concentration of penicillin in the L-15 complete culture medium was adjusted to 50 IU / ml, the concentration of streptomycin was adjusted to 50 IU / ml, and the concentration of fetal bovine serum was adjusted to 10-20%.

[0013] Optionally, the primary culture temperature is 27°C; the subculture temperature is 27-30°C.

[0014] The present invention also provides a proliferation culture medium for the above-mentioned golden tiger kidney cells, wherein the proliferation culture medium is: L-15 culture medium + 10%-20% fetal bovine serum + 100 IU / ml penicillin + 100 IU / ml streptomycin.

[0015] The present invention also provides the application of the above-mentioned proliferation culture medium in the propagation of the above-mentioned golden tiger kidney cells.

[0016] The present invention also provides the application of the above-mentioned golden tiger grouper kidney cells in constructing a cell model of golden tiger grouper iridovirus infection.

[0017] The present invention also provides the application of the above-mentioned golden tiger kidney cells in iridovirus culture.

[0018] The present invention also provides the use of the above-mentioned golden tiger grouper kidney cells in the preparation of golden tiger grouper iridovirus vaccine or in the screening of golden tiger grouper iridovirus therapeutic drugs.

[0019] The present invention also provides the application of the above-mentioned golden tiger grouper kidney cells in constructing a bacterial infection cell model of golden tiger grouper, wherein the bacteria include one or more of Edwardsiella tarda, Vibrio vulnificus, Vibrio harveyi, Vibrio anguillarum, and Vibrio alginolyticus.

[0020] The present invention also provides the application of the above-mentioned golden tiger grouper kidney cells in screening drugs for treating bacterial infections in golden tiger grouper.

[0021] The present invention discloses the following technical effects:

[0022] This invention provides a golden tiger grouper kidney cell line, which is obtained by selecting low-differentiation, high-proliferation-potential golden tiger grouper kidney cells, treating them with enzymatic digestion, and then culturing them in primary culture. A suitable and nutritionally complete cell culture medium is then developed to allow for rapid cell growth and proliferation, resulting in a stable cell line. The golden tiger grouper kidney cells constructed by this invention can be passaged for 70 generations or more, exhibiting rapid growth, high passage frequency, and stable cell morphology. It can provide a large number of golden tiger grouper kidney cells, with the main cell type being fibroblast-like cells. Furthermore, this cell line can be used for transfection of exogenous gene plasmids with high transfection efficiency, making it suitable for exogenous gene expression studies. This cell line is also sensitive to iridoviruses and common aquaculture pathogens, enabling the establishment of iridovirus or bacterial infection cell models. This lays the foundation for studying iridovirus infection mechanisms, bacterial infection mechanisms, and the preparation of iridovirus vaccines or therapeutic drugs, as well as bacterial infection treatments. Attached Figure Description

[0023] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0024] Figure 1Morphological observation of kidney cells from golden tiger grouper on day 7 of primary culture;

[0025] Figure 2 The proliferation of golden tiger-spotted kidney cells under different culture media;

[0026] Figure 3 The proliferation of golden tiger kidney cells at different culture temperatures;

[0027] Figure 4 The proliferation of golden tiger-spotted kidney cells at different serum concentrations;

[0028] Figure 5 This shows the metaphase division of chromosomes in golden tiger-striped kidney cells;

[0029] Figure 6 The transfection status of pEGFP-N3 plasmid in golden tiger kidney cells;

[0030] Figure 7 The results of RSIV challenge experiments on golden tiger kidney cells are shown; where A represents the morphology of uninfected golden tiger kidney cells; B represents the morphology of golden tiger kidney cells 7 days after RSIV challenge; and C represents the morphology of golden tiger kidney cells 10 days after blind passage. Scale bar = 200 μm.

[0031] Figure 8 The results of bacterial infection of golden tiger-spotted kidney cells after 3 hours are shown. Among them, A is the cell morphology of the control group; B is the cell morphology after infection with Edwardsiella tarda; C is the cell morphology after infection with Vibrio vulnificus; D is the cell morphology after infection with Vibrio harveyi; E is the cell morphology after infection with Vibrio anguillarum; F is the cell morphology after infection with Vibrio alginolyticus; scale bar = 200 μm.

[0032] Figure 9 The results of bacterial infection of golden tiger kidney cells for 6 hours are shown. Among them, A is the cell morphology of the control group; B is the cell morphology after infection with Edwardsiella tarda; C is the cell morphology after infection with Vibrio vulnificus; D is the cell morphology after infection with Vibrio harveyi; E is the cell morphology after infection with Vibrio anguillarum; F is the cell morphology after infection with Vibrio alginolyticus; scale bar = 200 μm. Detailed Implementation

[0033] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0034] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0035] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.

[0036] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be apparent to those skilled in the art. This specification and embodiments are merely exemplary.

[0037] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.

[0038] Unless otherwise specified, the experimental methods used in the embodiments of this invention are all conventional methods; unless otherwise specified, the materials and reagents used are commercially available.

[0039] Example 1

[0040] In this embodiment, primary and passaged cultures of golden tiger grouper kidney cells were performed to obtain a golden tiger grouper kidney cell line:

[0041] Take golden tiger grouper, wipe the body surface with 70% alcohol, and then remove the kidney tissue. Wash three times with L-15 cell culture medium containing high concentrations of antibiotics (400 IU / ml penicillin and 400 IU / ml streptomycin). After washing, thoroughly mince the tissue sample with scissors and transfer it to a 15 mL centrifuge tube containing 5 mL of 0.25% trypsin solution (Gibco). Incubate at 26°C for 30 minutes. When the tissue suspension becomes turbid, filter it through a 100 μm filter to obtain a single-cell suspension. Add the filtered cell suspension to L-15 culture medium (hereinafter referred to as L-15 complete culture medium) containing 20% ​​fetal bovine serum (FBS), 200 IU / ml penicillin, and 200 IU / ml streptomycin, and then centrifuge at 1000 × g for 10 min. Resuspend the cell pellet in fresh L-15 complete culture medium and inoculate into 9.6 cm cells. 2 Cells were placed in six-well plates and incubated at 27°C. The culture medium was changed every two days.

[0042] In primary culture, cell adhesion was good, and confluence was achieved after 7 days of culture at 27°C. When the cells completely covered a six-well plate under a microscope (e.g.) Figure 1 Cells were digested with trypsin and then passaged in the original wells, with one well passaged to two wells. After 10 passages, cells were passaged to one cell culture flask per well. After 15 passages, cells were passaged to two flasks per flask.

[0043] During passage, cells were digested with trypsin. After the cells became rounded, 2 mL of L-15 complete culture medium was used to flush down the cells adhering to the bottom of the flask. The mixed cells were then evenly divided into two flasks, and the culture medium was added to each flask to a total of 4 mL. The culture temperature was 27℃. After the cells were passaged to the 5th generation, the concentration of penicillin-streptomycin in the L-15 complete culture medium was halved, and the concentration of fetal bovine serum was reduced by 5%. After the cells were passaged to the 10th generation, the concentration of penicillin-streptomycin in the L-15 complete culture medium was halved again, and the concentration of fetal bovine serum was reduced to 10%. Morphological observation revealed that the cells in the early passages consisted of fibroblast-like cells and epithelial-like cells. After 10 passages, the cells were mainly composed of fibroblast-like cells, which proliferated stably in subsequent passages. Currently, the golden tiger grouper kidney cells have been passaged more than 70 times, and a golden tiger grouper kidney cell line has been established. This cell line has been deposited at the China General Microbiological Culture Collection Center (CGMCC) and named Golden Tiger Kidney Cells, with accession number CGMCC No. 46341 and deposit date of April 3, 2025.

[0044] Example 2

[0045] This example investigated the effects of different culture media on cell growth:

[0046] The cell culture plates used in the experiment were 12-well plates. 20th generation golden tiger kidney cells from Example 1 were cultured at 1.5 × 10⁻⁶ wells. 5 Initially, cells were seeded at the specified density in each well of the culture plate. After the cells adhered and stabilized, the original culture medium was aspirated, the cells were washed with PBS, and then cultured in L-15, MEM, and M199 media, respectively. Each culture medium was supplemented with 10% FBS, 100 IU / ml penicillin, and 100 IU / ml streptomycin. The culture temperature was 27℃. During culture, cells from different culture media were collected on days 1, 3, 5, and 7 and counted using a hemocytometer. Fresh culture medium was replaced every two days. The counting method was as follows: after aspirating the culture medium and washing with PBS, 1 mL of trypsin-EDTA digestion solution was added to each well for complete digestion. After thorough mixing, 20 μL of the liquid was pipetted onto the hemocytometer, and the cells were counted under a microscope according to the instructions for using the hemocytometer. The experiment was performed in triplicate.

[0047] The results are as follows Figure 2 As shown, the proliferation of golden tiger kidney cells in L-15 culture medium was significantly higher than that in MEM and M199 culture medium. In particular, after 5 days of culture, the number of cells in L-15 culture medium continued to increase, while the number of cells in MEM and M199 culture medium showed a decreasing trend.

[0048] Example 3

[0049] This example investigated the effects of different temperatures on cell growth:

[0050] The cell culture plates used in the experiment were 12-well plates. 20th generation golden tiger kidney cells from Example 1 were cultured at 1.5 × 10⁻⁶ wells. 5 The initial seeding density was achieved in each well of the culture plate. Three 12-well cell culture plates were prepared and cultured at 24°C, 27°C, and 30°C, respectively. The culture medium used was L-15 medium supplemented with 10% FBS, 100 IU / ml penicillin, and 100 IU / ml streptomycin. During culture, cells were collected at different temperatures on days 1, 3, 5, and 7 and counted using a hemocytometer. Fresh culture medium was added every two days. The counting method was the same as in Example 2. The experiment was performed in triplicate.

[0051] The results are as follows Figure 3 As shown, the cells grow faster at 27℃ and 30℃. This indicates that the cell line can proliferate rapidly at 27-30℃.

[0052] Example 4

[0053] This example investigated the effects of different serum concentrations on cell growth:

[0054] The cell culture plates used in the experiment were 12-well plates. 20th generation golden tiger kidney cells from Example 1 were cultured at 1.5 × 10⁻⁶ wells.5 The cells were initially seeded at a density in the culture plate. After the cells adhered and stabilized, the original culture medium was aspirated, the cells were washed with PBS, and replaced with culture medium containing different concentrations of FBS. The culture medium used was L-15 medium supplemented with 100 IU / ml penicillin and 100 IU / ml streptomycin, with FBS concentrations set at 0%, 5%, 10%, and 20%, respectively. During the culture process, cells from different culture media were collected on days 1, 3, 5, and 7 and counted using a hemocytometer. The counting method was the same as in Example 2. The experiment was performed in triplicate.

[0055] The results are as follows Figure 4 As shown, golden tiger kidney cells exhibit relatively rapid and similar growth rates in serum concentrations of 10% and 20%, while growth is slower at serum concentrations below 10%, and no significant cell proliferation is observed in serum concentrations between 0% and 5%. Therefore, in the proliferation culture of golden tiger kidney cells, a concentration range of 10-20% can be selected based on the actual culture environment and research costs.

[0056] Example 5

[0057] Timely cryopreservation of cells during cell culture passage facilitates subsequent experimental use. Timely cell cryopreservation also prevents the loss of all previous work due to bacterial contamination. Cells typically have a large cell count by passage 5, making them suitable for preservation. This example provides a method for the cryopreservation and thawing of golden tiger kidney cells:

[0058] Cells from each passage were cryopreserved. Similar to the digestion method used during cell passage, the cells were first digested and resuspended, then added to 15 mL centrifuge tubes, centrifuged, and the cells were collected. The cells were then resuspended in cryopreservation buffer (DMSO) to achieve a cell density of 3.0 × 10⁻⁶ cells / mL. 6 Cells / mL. Add cells to cryovials and place them in a cryopreservation box. Freeze overnight at -80°C. Then store the cryovials in liquid nitrogen and record the relevant information.

[0059] Remove the frozen cells from the liquid nitrogen container and quickly place them in a 37°C water bath for thawing. The water in the water bath should be changed regularly and kept clean. During thawing, ensure the cryovial opening is not submerged in water; use sealing film to seal the opening and prevent contamination. Once the ice in the cryovial has thawed, add the cryopreservation solution to a centrifuge tube and centrifuge at 1200 rpm for 5 minutes to collect the cells. Resuspend the cells at the bottom of the centrifuge tube in L-15 complete culture medium and seed them into new cell culture flasks. Place the flasks in a 27°C cell culture incubator for culture.

[0060] Example 6

[0061] Chromosome analysis was performed on golden tiger-spot kidney cells in this embodiment:

[0062] Chromosome karyotype analysis was performed on 30 generations of golden tiger-striped kidney cells from Example 1. The cells were cultured until they reached a confluence of 25 μm. 2 In culture flasks, colchicine is added to the culture medium. After culturing for 4-6 hours, the original culture medium is aspirated, and 2 mL of trypsin-EDTA digestion solution is added for digestion. After centrifugation, cells are collected, and the supernatant is aspirated. KCl solution is added dropwise and mixed well, then added to a final volume of 5-10 mL. The cells are incubated at 37°C for 20-30 minutes. Carnoy's fixative (methanol: glacial acetic acid = 3:1) is prepared and pre-chilled at -20°C. The slides are pre-chilled in alcohol at -80°C. After hypotonicity, 1 mL of Carnoy's fixative is added, and the cells are pre-fixed for 2 minutes. After centrifugation, the supernatant is discarded, and then 8-10 mL of fresh Carnoy's fixative is slowly added along the tube wall for fixation for 15-20 minutes. This fixation is repeated twice. Cells are resuspended and placed on slides using the cold drop method. The slides are then air-dried in a ventilated area, stained with 10% Giemsa stain for 10-20 minutes, rinsed, and air-dried. The cells are placed under a microscope to locate chromosomes, and observation and photographic recording are performed. Chromosome counting is then performed.

[0063] The results are as follows Figure 5 As shown, chromosome karyotype analysis of the kidney cells of the golden tiger grouper revealed that most cells had a normal diploid chromosome number [2N=48], consistent with the chromosome number characteristics of the golden tiger grouper.

[0064] Example 7

[0065] This embodiment analyzed the exogenous gene transfection of golden tiger-spotted kidney cells:

[0066] 30 generations of golden tiger-spotted kidney cells from Example 1 were used at a concentration of 1.5 × 10⁻⁶. 5 The cells were initially introduced into six-well plates at the initial density of each well. The pEGFP-N3 plasmid was transfected into the cells using the Seven HighTrans™ DNA non-liposome transfection method. Gene expression was detected after culturing at 27°C for 48 hours without changing the culture medium.

[0067] The results are as follows Figure 6 As shown, gene expression was observed within 48 hours of transformation, and green fluorescence was visible in EGFP-positive cells under an inverted fluorescence microscope. This indicates that the golden tiger kidney cells of this invention can be directly applied to the study of exogenous gene function.

[0068] Example 8

[0069] In this embodiment, iridovirus (RSIV) infection experiments were performed on golden tiger kidney cells to verify their susceptibility to the virus.

[0070] Spleen tissue from diseased spotted sea bream preserved at -80℃ (from the laboratory of the College of Marine Science and Engineering, Qingdao Agricultural University) was collected and homogenized thoroughly at low temperature in L-15 culture medium containing 5% penicillin-streptomycin. The homogenate was subjected to three freeze-thaw cycles at -80℃ and 25℃, centrifuged at 8000 rpm for 15 min at 4℃, and the supernatant was collected. The supernatant was diluted 10-fold with L-15 culture medium containing 5% penicillin-streptomycin and filtered through a 0.22 μm cell filter to obtain the viral solution. The viral solution was inoculated into culture flasks containing 30 generations of golden tiger bream kidney cells, ensuring 0.2 g of viral tissue per flask. After inoculation, the cells were cultured at 27℃ for 1 h, and the original culture medium was aspirated. The cells were then cultured in L-15 culture medium containing 1% FBS and 1% penicillin-streptomycin (to maintain cell viability and control cell growth rate, avoiding excessive proliferation leading to cell death). Pathological changes in the cells were observed daily. Cells showed CPE on day 7 after infection. Figure 7 B). With healthy golden tiger kidney cells ( Figure 7 Compared to A), CPE is characterized by localized cell death and detachment, with adherent cells exhibiting atrophy and irregularly distributed filamentous morphology. CPE appeared on day 10 after blind passage. Figure 7 (C). The morphology of CPE appearing after blind passage was the same as that of CPE appearing after challenge, indicating that the CPE in the challenge experiment was due to the presence of RSIV. Viral suspension was collected from diseased cells, serially diluted 10-fold, and inoculated into 30-generation golden tiger kidney cells to determine the viral infection degree. The viral infection degree reached 10. 5 TCID 50 / mL.

[0071] 50 generations of golden tiger-spotted kidney cells were used at a concentration of 1.5 × 10⁻⁶. 5 The initial density of the virus was introduced into six-well plates. The experiment was divided into a control group (virus suspension treated at 100℃) and an experimental group (virus suspension), with three replicates in each group. After 7 days of culture, nucleic acid was extracted, and real-time quantitative PCR (qPCR) was performed using competitive quantitative PCR to detect viral proliferation. Viral DNA was extracted from diseased golden tiger kidney cells using the SteadyPure Viral DNA / RNA Extraction Kit (Aikerui Biotechnology), following the kit instructions. Specific primers for amplifying the major capsid protein (MCP) gene of RSIV iridovirus are shown in Table 1. The qPCR reaction system and amplification conditions are shown in Tables 2 and 3.

[0072] Table 1 Primers for Real-time PCR Detection

[0073] Primers Sequence (5'-3') MCP-152F GGGTGGCGACTACCTCATTA(SEQ ID NO.1) MCP-152R TCTGTGCCACCAGGTCGTTA(SEQ ID NO.2)

[0074] Table 2 qPCR reaction system

[0075] reagents Dosage 2×SYBRGreenPremix 12.5 MCP-152F 1μL MCP-152R 1μL <![CDATA[ddH2O]]> 9.5μL DNA 1μL Total 25μL

[0076] Table 3 qPCR amplification conditions

[0077] temperature reaction time 95℃ 10s 95℃ 8s (40 cycles) 60℃ 5s (40 cycles) 72℃ 10 (40 cycles)

[0078] The results showed that the CT value of the control group was 30, while the CT value of the experimental group was 16, indicating significant viral proliferation.

[0079] The results indicate that the golden tiger grouper kidney cells constructed in this invention are sensitive to iridovirus and have a rapid viral proliferation rate. They can be used to establish a golden tiger grouper iridovirus cell model for isolating and culturing iridovirus, as well as for studying iridovirus-related vaccines or therapeutic drugs.

[0080] Example 9

[0081] In this embodiment, a bacterial infection experiment was conducted on golden tiger kidney cells to verify their susceptibility to bacteria:

[0082] Edwardsiella tarda, Vibrio vulnificus, Vibrio harveyi, Vibrio anguillarum, and Vibrio alginolyticus were isolated from diseased spotted sea bream and preserved in the laboratory of the College of Marine Science and Engineering, Qingdao Agricultural University. The diseased sea bream were obtained from Mingbo Aquatic Products Co., Ltd., Laizhou City, Shandong Province. The diseased fish exhibited the following symptoms: black body color, abnormal swimming movements in the water, and lethargy. No obvious external injuries were found; however, in severe cases, bulging eyes, gill congestion, or hemorrhage were observed. Severe anemia was present, manifested as a pale liver, and enlarged spleen and kidneys with petechiae.

[0083] 30 generations of golden tiger-spotted kidney cells were used at a rate of 1×10 5 The cells were seeded at a density of 1 / 2 well into six-well cell culture plates and cultured in a cell culture incubator at 27°C. When cell coverage reached 80% to 90%, subsequent experimental procedures were performed. *Vibrio harveyi*, *Edwardsiella tarda*, *Vibrio alginolyticus*, *Vibrio vulnificus*, and *Vibrio anguillarum* were inoculated into 5 mL LB broth and cultured on a shaker at 27°C until all strains entered the logarithmic growth phase. The bacterial suspension was transferred to 1.5 mL centrifuge tubes, centrifuged, and the supernatant was discarded. The bacterial pellet was then resuspended in antibiotic-free medium. The absorbance (OD) of the bacterial suspension at 600 nm was measured using a microplate reader. 600 Then, the bacterial concentration was adjusted to 1×10⁻⁶ using antibiotic-free culture medium.5 CFU / mL. Inoculate the bacterial suspension into the corresponding cell culture wells at a concentration of 1×10⁻⁶ CFU / mL. 5 CFU / well. The experimental setup included a control group (uninfected with bacteria) and experimental groups (inoculated with 5 different bacterial strains each). Morphological changes in golden tiger kidney cells under different bacterial infections were observed using an inverted microscope. The observation results were photographed for subsequent analysis and comparison.

[0084] Cell morphological changes 3 hours after bacterial infection are as follows Figure 8 As shown, the cell morphology changes 6 hours after bacterial infection are as follows: Figure 9 As shown in the figure, the control group did not exhibit significant lesions during the experiment. Infection of cells by the five different bacteria had varying degrees of impact on their morphology, distribution, and aggregation. Cells showed high sensitivity to *Vibrio vulnificus* and *Vibrio harveyi*, exhibiting significant cell shrinkage and extensive apoptosis 3 hours after infection; after 6 hours, cells infected with *Vibrio vulnificus* and *Vibrio harveyi* were almost completely apoptotic. In contrast, *Edwards tarda* and *Vibrio anguillarum* induced slightly less apoptosis than *Vibrio anguillarum* and *Vibrio vulnificus*, but still possessed strong pathogenicity. *Vibrio alginolyticus* had a relatively small effect on golden tiger-spotted kidney cells, and its pathogenicity was significantly lower than that of the other bacteria.

[0085] The above results demonstrate that the golden tiger grouper kidney cells established in this invention exhibit sensitivity to five common pathogenic bacteria. Among them, the cells show higher sensitivity to Vibrio vulnificus and Vibrio harveyi. This characteristic indicates that the golden tiger grouper kidney cells of this invention have significant potential in the field of bacteriological research, especially in antimicrobial drug screening and the elucidation of bacterial pathogenic mechanisms. The golden tiger grouper kidney cells of this invention can be used to establish a bacterial infection cell model in golden tiger grouper, for the isolation and culture of common pathogenic bacteria in aquaculture, providing theoretical support and practical guidance for disease prevention and control in aquaculture.

[0086] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.

Claims

1. A type of golden tiger-spotted kidney cell, characterized in that, It was deposited on April 3, 2025 at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC No. 46341.

2. The application of the golden tiger grouper kidney cells as described in claim 1 in constructing a cell model of golden tiger grouper infected with iridovirus.

3. The application of the golden tiger kidney cells as described in claim 1 in iridovirus culture.

4. The application of the golden tiger grouper kidney cells as described in claim 1 in constructing a bacterial infection cell model of golden tiger grouper, characterized in that, The bacteria include one or more of Edwardsiella tarda, Vibrio vulnificus, Vibrio harveyi, Vibrio anguillarum, and Vibrio alginolyticus.

Citation Information

Patent Citations

  • Epinephelus lanceolatus kidney tissue cell line and construction method thereof

    CN104974977A