Antigen combination of influenza virus and application thereof

Abstract

The invention discloses an antigen combination of influenza virus and application thereof. According to the invention, the multivalent influenza vaccine aiming at H1N1, H3N2 and BV strains is developed by screening and optimizing sequence codons and proportions. Compared with inactivated split vaccines on the market, the multivalent influenza mRNA vaccine developed by the invention has excellent immunogenicity and protective efficacy, and has broad spectrum and immune persistence. According to the combined vaccine, the influenza vaccine and the SARS-CoV-2 virus vaccine are integrated into the combined vaccine, so that influenza and SARS-CoV-2 virus infection can be prevented at the same time, and the inoculation needle frequency is reduced.

Description

Technical Field

[0001] This invention belongs to the field of biomedical technology, specifically relating to an antigen combination of influenza virus and its application, and more specifically to an antigen combination of influenza virus and / or SARS-CoV-2 virus and its application. Background Technology

[0002] Influenza viruses can be classified into four subtypes: A, B, C, and D. Types A and B influenza viruses can spread among the population and cause seasonal epidemics. After infection, the virus enters and replicates by binding to respiratory surface cells, leading to systemic symptoms such as fever, headache, and muscle pain. Influenza seriously endangers human health and poses a significant threat to public health and the global economy. The WHO estimates that seasonal influenza causes approximately 3-5 million severe cases annually. Vaccination is currently the most effective measure to combat influenza.

[0003] Influenza viruses are negative-sense RNA viruses and are prone to mutation. To ensure vaccine effectiveness, the WHO updates vaccine strain components annually based on global influenza virus epidemiology, virology, and vaccine serological analysis. Several influenza vaccines are available domestically and internationally, but they are mainly traditional split vaccines or protein vaccines, which struggle to achieve sufficient protective efficacy and production efficiency, posing significant challenges in addressing viral mutations, timely supply, and the target population.

[0004] For influenza vaccines, the mRNA technology platform has significant advantages over traditional technology platforms. These include: (1) Flexible antigen design: Traditional influenza vaccines may experience antigen drift or mutation during preparation, leading to a mismatch between the vaccine and the circulating strain. mRNA vaccine technology can quickly customize vaccines based on currently circulating virus strains. (2) Rapid production and response capabilities: The production of mRNA vaccines does not require virus culture, thus enabling large-scale vaccine production in a shorter time. Currently, Bluebird has established a rapid response platform for infectious disease vaccines, which can complete the design and production of mRNA vaccines within 60 days. (3) Multi-component strategy: The mRNA platform allows for flexible combination of various vaccine components, effectively improving vaccine efficacy and expanding its protective range. (4) Safety and efficacy: mRNA vaccines have shown good safety and efficacy in multiple clinical trials. They do not contain viral components, therefore posing no risk of infection.

[0005] Currently, no influenza mRNA vaccines have been approved for marketing globally. Pfizer and Moderna's influenza mRNA vaccines have entered Phase 3 clinical trials. Pfizer's influenza mRNA vaccine showed non-inferiority and superiority against influenza A virus strains in Phase 3 clinical trials. However, in terms of the secondary immunogenicity endpoint against influenza B virus strains, the vaccine did not meet expectations, only achieving the secondary endpoint against influenza A virus strains. Moderna's influenza mRNA vaccine, mRNA-1010, showed superiority against influenza A virus strains H1N1 and H3N2 in Phase 3 clinical trials, but similarly did not show superiority over existing split vaccines in seroconversion rates against influenza B virus strains Yamagata and Victoria. Domestic development of influenza mRNA vaccines in China is slow; no influenza mRNA vaccine has yet received clinical trial approval, and all are still in the preclinical research stage. Weak immunogenicity against influenza B is a major challenge in the development of influenza mRNA vaccines. Summary of the Invention

[0006] The technical problem to be solved by the present invention is to overcome the problems of insufficient protection against influenza variants by existing influenza vaccines and unsatisfactory immunization effects of combination vaccines, and to provide an antigen combination of influenza virus and its application.

[0007] This invention designs vaccines targeting the HA proteins of influenza H1N1, H3N2, and BV subtypes. By optimizing the HA sequence codons of these three strains, it enables high expression of the HA proteins of each subtype. Through combination and optimization of these three sequences, it achieves simultaneous high expression of the HA proteins of all three subtypes. When the HA sequences of the three selected strains are used to prepare monovalent mRNA vaccines, each monovalent mRNA vaccine induces highly effective neutralizing antibodies against H1N1, H3N2, and BV subtypes, respectively. Combining the HA sequences of the three strains into a trivalent mRNA vaccine activates highly effective immune protection against H1N1, H3N2, and BV subtypes of influenza, achieving long-term and broad-spectrum immune protection.

[0008] The objective of this invention is achieved through the following technical solution:

[0009] A first aspect of the present invention provides an antigen combination of influenza virus, said antigen combination comprising one or more of the following:

[0010] (1) The HA protein of H1N1 influenza virus or its immunogenic fragment, wherein the H1N1 influenza virus is A / Wisconsin / 67 / 2022;

[0011] (2) The HA protein or an immunogenic fragment of the H3N2 influenza virus, wherein the H3N2 influenza virus is selected from any one of A / Darwin / 6 / 2021, A / Massachusetts / 18 / 2022 and A / District of Columbia / 27 / 2023; or,

[0012] (3) The HA protein of BV influenza virus or its immunogenic fragment, wherein the BV influenza virus is B / Austria / 1359417 / 2021.

[0013] In this invention, the antigen combination satisfies one or more of the following conditions:

[0014] (1) The amino acid sequence of the HA protein of the H1N1 influenza virus is shown in SEQ ID NO: 1;

[0015] (2) The amino acid sequence of the HA protein of the H3N2 influenza virus is shown in any one of SEQ ID NO: 2-4; and,

[0016] (3) The amino acid sequence of the HA protein of the H3N2 influenza virus is shown in SEQ ID NO: 5.

[0017] In this invention, the mass ratio of the antigen combination is HA protein of H1N1 influenza virus : HA protein of H3N2 influenza virus : HA protein of BV influenza virus = 1 : 1 : (0.5-4), preferably 1 : 1 : (1-2).

[0018] A second aspect of the present invention provides a combined antigen combination of influenza virus and SARS-CoV-2 virus, the combined antigen combination comprising the antigen combination as described in the first aspect of the present invention, and further comprising the Spike protein of SARS-CoV-2 virus or an immunogenic fragment thereof, wherein the SARS-CoV-2 virus is preferably SARS-CoV-2 JN.1.

[0019] In this invention, the amino acid sequence of the Spike protein of the SARS-CoV-2 virus is shown in SEQ ID NO: 31.

[0020] In this invention, the mass ratio of the combined antigen combination is HA protein of H1N1 influenza virus: HA protein of H3N2 influenza virus: HA protein of BV influenza virus: Spike protein of SARS-CoV-2 virus = 1:1:(0.5-4):1, preferably 1:1:(1-2):1.

[0021] A third aspect of the present invention provides an isolated nucleic acid that encodes an antigen combination as described in the first aspect of the present invention or a combined antigen combination as described in the second aspect of the present invention.

[0022] In this invention, the nucleic acid satisfies one or more of the following conditions:

[0023] (1) The nucleotide sequence of the HA protein encoding A / Wisconsin / 67 / 2022 is shown in any one of SEQ ID NO: 6-11;

[0024] (2) The nucleotide sequence of the HA protein encoding A / Darwin / 6 / 2021 is shown in any one of SEQ ID NO: 12-14;

[0025] (3) The nucleotide sequence of the HA protein encoding A / Massachusetts / 18 / 2022 is shown in any one of SEQ ID NO: 15-17;

[0026] (4) The nucleotide sequence of the HA protein encoding A / District of Columbia / 27 / 2023 is shown in any one of SEQ ID NO: 18-23;

[0027] (5) The nucleotide sequence of the HA protein encoding B / Austria / 1359417 / 2021 is shown in any one of SEQ ID NO:24-26;

[0028] (6) The nucleotide sequence of the Spike protein encoding SARS-Cov2 JN.1 is shown in SEQ ID NO: 32.

[0029] In this invention, the nucleic acid is selected from one or more of the following:

[0030] (1) mRNA, preferably, the mRNA further comprises one or more of a cap promoter, 5'UTR, 3'UTR and poly(A); and / or, the mRNA further comprises polynucleotide modifications;

[0031] (2) DNA, wherein the DNA is single-stranded DNA or double-stranded DNA; and,

[0032] (3) Self-amplifying RNA, self-replicating RNA or circular RNA.

[0033] In this invention, when the nucleic acid is mRNA, the mRNA also satisfies at least one of the following conditions:

[0034] (i) The promoter comprises the nucleotide sequence as described in SEQ ID NO: 27;

[0035] (ii) The 5'UTR contains the nucleotide sequence as described in SEQ ID NO: 28;

[0036] (iii) The 3'UTR contains the nucleotide sequence as described in SEQ ID NO: 29;

[0037] (iv) The poly(A) comprises the nucleotide sequence as described in SEQ ID NO: 30; and,

[0038] (v) The polynucleotide modification is selected from one or more of the following: pseudouridine modification, N1-methyl-pseudouridine modification, 5-methoxyuridine modification, N1-methyladenosine modification, N6-methyladenosine modification and 5-methylcytidine modification; the polynucleotide modification is preferably pseudouridine modification or N1-methyl-pseudouridine modification.

[0039] In this invention, the DNA satisfies any one of the following:

[0040] (1) The DNA is a single-stranded DNA, which is the template strand for transcribing the mRNA as defined in the nucleic acid as described in the third aspect of the present invention; or, the single-stranded DNA is a coding strand that is inversely complementary to the template strand for transcribing the mRNA as defined in the nucleic acid as described in the third aspect of the present invention.

[0041] (2) The DNA is double-stranded DNA, which includes the template strand and the coding strand described in (1).

[0042] A fourth aspect of the present invention provides a recombinant expression vector comprising the nucleic acid as described in the third aspect of the present invention.

[0043] A fifth aspect of the present invention provides a transformant comprising a nucleic acid as described in the third aspect of the present invention or a recombinant expression vector as described in the fourth aspect of the present invention.

[0044] In this invention, the host cell of the transformant is a eukaryotic cell.

[0045] In this invention, the host cell is selected from yeast cells or mammalian cells, such as 293T cells.

[0046] A sixth aspect of the present invention provides a composition comprising (1) mRNA as described in the third aspect of the present invention, and (2) a delivery vector.

[0047] In this invention, the delivery carrier is lipid nanoparticles.

[0048] In this invention, the lipid nanoparticles are composed of cationic lipids, cholesterol, phospholipids, and lipid conjugates.

[0049] In this invention, the N / P ratio of the ionizable lipids in the lipid nanoparticles to the mRNA is (3~15):1.

[0050] In this invention, the lipid nanoparticles are composed of cationic lipid RL151, cholesterol, DSPC and DMG-PEG2000, and the molar ratio of cationic lipid RL151: cholesterol: DSPC: DMG-PEG2000 is (45-55):(35-42):(8-14):(1-5), preferably 50:38.5:10:1.5.

[0051] The seventh aspect of the present invention provides a method for preparing a composition for alleviating, preventing and / or treating diseases caused by influenza viruses, the method comprising the step of mixing an aqueous phase containing mRNA with a lipid phase containing a delivery carrier, wherein the mRNA and the delivery carrier are as defined in the composition described in the sixth aspect of the present invention.

[0052] In this invention, the method employs microfluidic technology.

[0053] In this invention, the total flow rate of microfluidic synthesis is 11-13 mL / min, preferably 12 mL / min; and / or, the flow rate ratio of the aqueous phase to the lipid phase is 2:1-4:1, preferably 3:1.

[0054] The eighth aspect of the present invention provides a method for preparing a combined composition for alleviating, preventing and / or treating diseases caused by influenza virus and SARS-CoV-2 virus, the method comprising the step of mixing an aqueous phase containing mRNA with a lipid phase containing a delivery carrier, wherein the mRNA and the delivery carrier are as defined in the composition described in the sixth aspect of the present invention.

[0055] In this invention, the method employs microfluidic technology.

[0056] In this invention, the total flow rate of microfluidic synthesis is 11-13 mL / min, preferably 12 mL / min; and / or, the flow rate ratio of the aqueous phase to the lipid phase is 2:1-4:1, preferably 3:1.

[0057] A ninth aspect of the present invention provides a pharmaceutical composition comprising an antigen combination as described in the first aspect of the present invention, a combined antigen combination as described in the second aspect of the present invention, a nucleic acid as described in the third aspect of the present invention, or a composition as described in the sixth aspect of the present invention, and optionally a pharmaceutically acceptable carrier and / or excipients.

[0058] The tenth aspect of the present invention provides a vaccine comprising an antigen combination as described in the first aspect of the present invention, a combined antigen combination as described in the second aspect of the present invention, a nucleic acid as described in the third aspect of the present invention, a composition as described in the sixth aspect of the present invention, and / or a pharmaceutical composition as described in the ninth aspect of the present invention, and an adjuvant.

[0059] In this invention, the vaccine is administered via intramuscular immunization, either as a single or multiple doses.

[0060] The eleventh aspect of the present invention provides the use of antigen combinations as described in the first aspect of the present invention, combined antigen combinations as described in the second aspect of the present invention, nucleic acids as described in the third aspect of the present invention, recombinant expression vectors as described in the fourth aspect of the present invention, transformants as described in the fifth aspect of the present invention, compositions as described in the sixth aspect of the present invention, and / or pharmaceutical compositions as described in the ninth aspect of the present invention in the preparation of medicaments for alleviating, preventing, and / or treating diseases caused by influenza virus and / or SARS-CoV-2 virus infection.

[0061] In this invention, the influenza virus is an H1N1 influenza virus, an H3N2 influenza virus, and / or a type B influenza virus.

[0062] In this invention, the SARS-CoV-2 is the JN.1 variant or its sub-variant.

[0063] In this invention, the disease is influenza, upper respiratory tract infection, influenza virus pneumonia, or novel coronavirus.

[0064] Based on common knowledge in the field, the above-mentioned preferred conditions can be combined arbitrarily to obtain various preferred embodiments of the present invention.

[0065] The reagents and raw materials used in this invention are all commercially available.

[0066] The significant advancements of this invention are as follows: Through sequence codon and ratio optimization, a multivalent influenza vaccine targeting H1N1, H3N2, and BV strains has been developed. Compared to commercially available inactivated split vaccines, the multivalent influenza mRNA vaccine developed in this invention exhibits superior immunogenicity and protective efficacy, as well as broad-spectrum and durable immunity. This invention integrates influenza and SARS-CoV-2 virus vaccines into a combined vaccine, enabling simultaneous prevention of both influenza and SARS-CoV-2 virus infection, reducing the number of vaccination doses. Currently, there are no commercially available influenza mRNA vaccines. This invention not only promotes vaccine technology innovation but also provides a key solution for reducing influenza-related morbidity, mortality, and socioeconomic burden, making it suitable for widespread application. Attached Figure Description

[0067] Figure 1The in vitro expression of H1N1, H3N2, and BV HA proteins using different codons is shown. In the figure, the sequences corresponding to RQ1-RQ6 of the H1N1 sequence are SEQ ID NO: 6-11, the sequences corresponding to RQ1-RQ3 of the H3N2 sequence are SEQ ID NO: 12-14, and the sequences corresponding to RQ1-RQ3 of the BV sequence are SEQ ID NO: 24-26.

[0068] Figure 2A and Figure 2B The in vitro expression of antigens for H1N1, H3N2, BV monovalent, first-generation trivalent mRNA-LNP, S monovalent, and first-generation quadrivalent combined vaccine is shown. The number above each sample lane represents the transfection dose.

[0069] Figure 3 Immunogenicity assays for H1N1, H3N2, BV monovalent and first-generation trivalent and quadrivalent combined vaccines in mouse models are shown. HAT serum antibody titers against strains A / Wisconsin / 67 / 2022, A / Darwin / 6 / 2021, and B / Austria / 1359417 / 2021 are also presented.

[0070] Figure 4 The titer of neutralizing antibodies against the SARS-CoV-2 JN.1 pseudovirus in serum is shown.

[0071] Figure 5 The titer of neutralizing antibodies against strain A / California / 07 / 2009 in serum is shown.

[0072] Figure 6 The results show the detection of spleen antigen-specific T cell responses.

[0073] Figure 7 The in vitro expression of different codon antigens of the second-generation H3N2 HA protein is shown. The sequences corresponding to RQ1 in the second-generation H3N2 sequence expression in the figure are SEQ ID NO: 15-17.

[0074] Figure 8A and Figure 8B The in vitro expression of H1N1, H3N2, BV monovalent and first-generation, second-generation trivalent and quadrivalent combined mRNA-LNP antigens was shown.

[0075] Figure 9 The results show the serum HAI antibody titers against strains A / Wisconsin / 67 / 2022, A / Darwin / 6 / 2021, A / Thailand / 8 / 2022, and B / Austria / 1359417 / 2021.

[0076] Figure 10 The results show the detection of spleen antigen-specific T cell responses.

[0077] Figure 11 The results of MN method for detecting neutralizing antibody titers against strains A / Wisconsin / 67 / 2022, A / Darwin / 6 / 2021, B / Austria / 1359417 / 2021, and B / Washington / 02 / 2019 in serum are shown.

[0078] Figure 12 The study showed changes in mouse body weight and survival rate after challenge with the virus.

[0079] Figure 13 This shows the changes in survival rate after infection.

[0080] Figure 14 The in vitro expression of different codon antigens of the three generations of H3N2 HA protein is shown. The sequences corresponding to RQ1-RQ6 of the three generations of H3N2 sequence expression in the figure are SEQ ID NO: 18-23, respectively.

[0081] Figure 15 The in vitro expression of H3N2 HA protein with different codons and trivalent mRNA-LNP antigen is shown. Among them, 1-2 are first-generation H3N2 monovalent antigens, 3 is second-generation H3N2 monovalent antigens, 4-5 are third-generation H3N2 monovalent antigens with different codons, 6-10 are trivalent antigens containing codons corresponding to H3N2 in 1-5 and H1N1 and BV, and 11-13 are controls.

[0082] Figure 16 The results show the HAI antibody titers detected in serum against strains A / Wisconsin / 67 / 2022, A / Darwin / 6 / 2021, A / Thailand / 8 / 2022, and B / Austria / 1359417 / 2021.

[0083] Figure 17 The in vitro expression of H1N1, H3N2, BV monovalent and trivalent mRNA-LNP antigens in different ratios was shown.

[0084] Figure 18 The results of HAI titers for strains A / Wisconsin / 67 / 2022, A / Darwin / 6 / 2021, and B / Austria / 1359417 / 2021 in serum were shown using the HAI method. Detailed Implementation

[0085] The present invention is further illustrated below by way of embodiments, but the invention is not limited to the scope of the embodiments described herein. Experimental methods in the following embodiments that do not specify specific conditions were performed according to conventional methods and conditions, or as selected according to the product instructions.

[0086] Example 1: Codon Screening for the 2023-2024 Influenza Vaccine

[0087] Antigen design was based on the HA protein sequences of the WHO recommended strains H1N1 (A / Wisconsin / 67 / 2022), H3N2 (A / Darwin / 6 / 2021), and BV (B / Austria / 1359417 / 2021) from the Northern Hemisphere for 2023-2024. Codon optimization was performed on the three strain sequences, and multiple sequences were synthesized as templates for in vitro transcription. In vitro transcription was performed, and the UTPs in the mRNA sequences were replaced with N1-UTP or Pseudo-UTP. Each mRNA vaccine of this invention also includes the following structures (5'→3' direction): T7 promoter sequence (SEQ ID NO: 27), 5'UTR (SEQ ID NO: 28), 3'UTR (SEQ ID NO: 29), and poly A tail (SEQ ID NO: 30).

[0088] The synthesized mRNA and Lipofectamine TM The mixture of 2000 (catalog number: 11668019, manufacturer: Thermo) was transfected into 293T cells, and the expression of each antigen sequence (HA protein) was verified by Western blot. Figure 1 The results show that all screened sequences express the target protein HA. The sequences marked with red arrows (H1N1-RQ1 (SEQ ID NO: 6), H3N2-RQ2 (SEQ ID NO: 13), and BV-RQ1 (SEQ ID NO: 21)) showed the best expression levels in 293T cells and will be used for subsequent vaccine development. NC represents cells transfected only with Lipofectamine. TM The negative control (2000) did not detect the target band.

[0089] Example 2: Preparation of lipid nanoparticles for a combined influenza vaccine and SARS-CoV-2 vaccine for the 2023-2024 season.

[0090] For monovalent influenza vaccines and first-generation trivalent vaccines, the three sequences with the best expression levels for H1N1, first-generation H3N2, and BV respectively—H1N1-RQ1 (SEQ ID NO: 6), first-generation H3N2-RQ2 (SEQ ID NO: 13), and BV-RQ1 (SEQ ID NO: 24)—are packaged separately as LNPs, and the resulting mRNA-LNP is the monovalent vaccine. Alternatively, the three antigen sequences can be mixed at a mass ratio of 1:1:1 and then packaged as LNPs, resulting in the first-generation trivalent vaccine. For first-generation quadrivalent combined vaccines, the influenza H1N1-RQ1, first-generation H3N2-RQ2, and BV-RQ1 sequences, along with the SARS-CoV-2 JN.1 virus Spike protein expression sequence, are mixed at a mass ratio of 1:1:1:1 and then packaged as LNPs. The LNP packaging process is as follows: The selected antigen sequence mRNA was ionized (cationic) at low pH and coated into nanoparticles by two auxiliary lipids: DSPC (distearylphosphatidylcholine, catalog number: B90536, manufacturer: Nippon Seika Co., Ltd.) and cholesterol (catalog number: C00373, manufacturer: Nippon Seika Co., Ltd.), as well as RL151 (catalog number: W211-YB211202, purchased from: Zhejiang Shenzhou Pharmaceutical Co., Ltd.) and polyethylene glycol-modified lipid (DMG-PEG2000, catalog number: M-DMG-2000, purchased from: JenKem). An aqueous solution of the mRNA was prepared by mixing the mRNA dissolved in ultrapure water with a 100 mM (millimoles per liter, or mmol / L) citrate buffer at pH 4.0 at a 1:1 volume ratio. The ratio of four lipid components (molar ratio, e.g., cationic lipid RL151: cholesterol: DSPC: DMG-PEG2000 = 50:38.5: 10: 1.5) was adjusted and dissolved in 99.5% ethanol to form a lipid solution. The mRNA and lipid solution were mixed in a NanoAssemblr (manufacturer: Precision Nanosystems) microfluidic mixing system at a volume ratio of H2O: EtOH = 3:1 and a constant total flow rate of 12 mL / min, to prepare lipid nanoparticles with a nitrogen-to-phosphorus ratio of ionizable lipids to mRNA of (3~15:1). This yielded lipid nanoparticles containing mRNA (mRNA-LNP). The lipid nanoparticles were then dialyzed, concentrated, filtered, and stored to obtain a vaccine containing the target sequence antigen. The mRNA-LNP was transfected into 293T cells, and the expression of mRNA-LNP at the cellular level was verified by Western blot. Empty LNPs were used as negative controls, and mRNA-LNPs containing only the Spike protein sequence were used as controls (S monovalent). Figure 2A and Figure 2BThe results showed that the negative control (NC) did not express the HA protein. The H1N1, first-generation H3N2, and BV monovalent vaccines expressed specific HA proteins, while the first-generation trivalent vaccine expressed HA proteins from all three strains: H1N1, H3N2, and BV. The S monovalent vaccine expressed only the Spike protein, and the first-generation quadrivalent combination vaccine expressed HA proteins from all three strains: H1N1, H3N2, and BV, as well as the SARS-CoV-2 Spike protein.

[0091] Example 3: Immunogenicity of a combined influenza and SARS-CoV-2 vaccine for the 2023-2024 season.

[0092] Six- to eight-week-old BALB / c female mice were selected and randomly divided into several experimental groups, with six animals in each group. These groups included a placebo control group (8% Tris-Ac, Shanghai Bluebird Biopharmaceutical Co., Ltd.), an H1N1 monovalent vaccine group, a first-generation H3N2 monovalent vaccine group, a BV monovalent vaccine group, a first-generation trivalent vaccine group, and a first-generation quadrivalent combined vaccine group. The immunization groups and dosages are shown in Table 1 below.

[0093] Table 1. Mouse Immunization Protocol

[0094]

[0095] Mice in each group were administered the vaccine at weeks 0 and 4, including a placebo and a packaged alternative vaccine, respectively. The administration was intramuscular, and serum was collected at week 2 after the second administration for later use. At week 6 after the second administration, the spleens of the mice were harvested, and spleen cells were isolated for cellular immunoassay. The titer of strain-specific hemagglutination inhibition (HAI) antibodies is a recognized indicator of humoral immunity against influenza. Therefore, the HAI method was used to detect HAI antibody titers in serum at week 2 after the second administration. The HAI method is as follows:

[0096] Serum samples were mixed with receptor-destroying enzyme (RDE) (catalog number: B90536, manufacturer: Nippon Sanken) at a ratio of 3:1, incubated at 37°C for 16-18 h, briefly centrifuged, and then inactivated by water bath at 56°C for 30 min. The samples were cooled to room temperature and briefly centrifuged. HAI of H1N1 and BV strains was determined using 1% turkey blood (catalog number: B0054-1, manufacturer: Yuchun Bio). HAI of H3N2 strain was determined using 2% guinea pig erythrocytes (catalog number: B0023-2, manufacturer: Yuchun Bio). To determine viral titer, the following influenza viruses or viral HA proteins were used: A / Wisconsin / 67 / 2022 (manufacturer: NIBSC), B / Austria / 1359417 / 2021 (manufacturer: NIBSC); Influenza A H3N2 (A / Darwin / 6 / 2021) Hemagglutinin / HA Protein (ECD, His Tag) (catalog number: 40868-V08B, manufacturer: Sinocare). The virus or viral HA protein stock solution was serially diluted 2-fold in 96-well plates, and an equal volume of 0.75% turkey or guinea pig blood was added. The plates were incubated at room temperature for 30 min, and the hemagglutination (HA) titer was determined by the reciprocal of the dilution factor of the well with the highest complete hemagglutination. Serum samples were serially diluted 2-fold with PBS in 96-well V-plates. Based on the measured HA titer, the virus was diluted to contain 4 HA units per 25 μL. The diluted serum was added to the wells, followed by 0.75% red blood cell suspension. The mixture was thoroughly and gently mixed, and allowed to stand at room temperature for about 30 min. The 96-well plate was then placed at a 45° angle for 30-60 s and photographed. The highest dilution well showing typical "teardrop" red blood cell precipitation without hemagglutination was taken as the endpoint of hemagglutination inhibition.

[0097] Neutralizing antibodies against the JN.1 strain were detected in serum of the placebo group and the first-generation quadrivalent combined vaccine group at week 2 after a second dose using a sham neutralization method. The sham neutralization method is as follows:

[0098] Serum samples collected from the immunized animals described in this example were serially diluted with cell culture medium. The diluted serum and pseudovirus suspension were mixed at a 1:1 ratio in 96-well plates. HeLa-GFP-ACE2-B10 cells were then added to the serum-pseudovirus mixture in the 96-well plates, and the plates were incubated at 37˚C in an incubator containing 5% CO2 (i.e., an incubator containing 5% CO2 and 95% air). After 48 hours, luciferase activity, reflecting the degree of SARS-CoV-2 pseudovirus transfection, was measured using a luciferase assay kit. The NT (Net Thromboplastin) of each sample was calculated by comparing the inhibition rate of luciferase activity relative to the control group at different serum dilutions. 50The value was used to evaluate the level of neutralizing antibodies induced by the SARS-CoV-2 component in the quadrivalent combined vaccine.

[0099] Figure 3 The results showed that the H1N1, first-generation H3N2, BV monovalent vaccine, and first-generation trivalent vaccine all activated humoral immune responses. In the placebo group, HAI antibody titers were all below the limit of detection (assigned as half the limit of detection). The monovalent vaccine group induced high-level HAI antibody titers against their respective matched strains, with GMT (log2) greater than 8 at a 0.5 μg immunization dose, significantly higher than the placebo group (p < 0.01). The first-generation trivalent vaccine induced high-level HAI antibody titers against all three matched strains, and there was no significant difference between the 1.5 μg dose of the trivalent vaccine and the 0.5 μg dose of the monovalent vaccine, indicating no significant immunogenic interference among the three strain sequences. The first-generation quadrivalent combined vaccine induced high levels of HAI antibody titers against three matched strains. At a 0.5 μg immunization dose, the GMT (log2) was greater than 6 for all three strains. Furthermore, there was no significant difference in HAI titers against the three matched strains induced by a 2 μg dose of the first-generation quadrivalent vaccine compared to a 1.5 μg dose of the first-generation trivalent vaccine.

[0100] Figure 4 The results showed that the first-generation quadrivalent combined vaccine induced high levels of neutralizing antibody titers against JN.1, with GMT (log10) greater than 10 at a 0.5 μg immunization dose, which was statistically significant compared to the placebo group (p < 0.01). These results indicate that the quadrivalent combined vaccine can activate protective antibodies against all three influenza strains, as well as protective antibodies against SARS-CoV-2 virus.

[0101] The MN method was used to detect the serum neutralizing antibody titer at week 2 after a second dose. The MN method employs MDCK cell-based FFA (speckled focus assay) to detect the serum's neutralizing capacity against influenza virus. The specific method is as follows:

[0102] Serum was inactivated at 56°C for 30 min, and then serially diluted 1:50 in 3-fold increments to ensure an initial dilution of 1:100 before mixing with the virus for incubation. Simultaneously, the virus was prepared in 50 μL solutions containing 100 FFU and incubated with serum at different dilutions at 37°C for 1 h. 0.3 × 10⁶ MDCK cells (ATCC® CCL-34-VHG) were then added. 6The cells were seeded in 96-well plates and incubated at 37°C for 24 h. After washing with PBS, 100 μL of virus-serum mixture was added to the cells and incubated at 37°C for 1 h. The supernatant was discarded, and the cells were washed once with PBS. 100 μL of covering medium containing TPCK trypsin (catalog number: 4370285, manufacturer: Sigma) was added to each well. The cells were then incubated at 37°C for 24 h. After fixation with 4% paraformaldehyde (200 μL / well) at room temperature for at least 0.5 h, wash the plate three times with PBS, and then incubate with 1% BSA containing 0.2% Triton at room temperature for 20-30 min to complete permeabilization and blocking. Wash three more times with PBS. Then, dilute Anti-Influenza A virus NP Antibody (product number: HY-P990811, manufacturer: MCE) to 1:4000 with 1% BSA and incubate at 37°C for 1 h. Wash the plate three times with 0.1% Tween-PBS (PBST), and then dilute Goat anti-mouse IgG-HRP (product number: A0216, manufacturer: Beyotime) to 1:2000 with 1% BSA and incubate at 37°C for 1 h. Discard the secondary antibody, wash the plate three times with PBST, and shake off the wash buffer. Color development: Use TrueBlue (KPL, cat. 50-78-02) for color development at room temperature for 10 minutes. Wash the plate three times with ddH2O, spin dry, and count the spots using an AT-Stop1100 / CTL enzyme-linked spot analyzer.

[0103] Figure 5 The results showed that the antibodies induced by the first-generation trivalent vaccine had high-level cross-neutralizing activity against unmatched strains. At an immunization dose of 0.5 μg, the GMT (log10) was greater than 3, and was significantly higher than that of the placebo group (p < 0.01), indicating that the vaccine has good broad-spectrum activity.

[0104] Intracellular factor staining (ICS) was used to detect the spleen antigen-specific T cell response in animals immunized with a first-generation trivalent vaccine. The ICS method is as follows:

[0105] Peptide libraries containing the HA protein sequences of strains A / Wisconsin / 67 / 2022 (H1N1), A / Darwin / 6 / 20 (H3N2), and B / Austria / 1359417 / 2021 (BV) (named H1N1-HA peptide library, H3N2-HA peptide library, and BV-HA peptide library, respectively), a peptide library containing the Spike protein sequence (named S peptide library), or medium containing an equal volume of DMSO were added to 96-well plates as negative controls. Mouse spleen cells resuspended in RIPM1640 complete medium were incubated at 37°C for 1 hour, followed by the addition of a protein transport inhibitor and incubation for another 5 hours. Cells were washed once with PBS and stained with Fixable Viability Stain 510 (catalog number: 564406, purchased from BD Bioscience). After incubation for 10 minutes, the cells were washed and then incubated at 4°C for 10 minutes with anti-mouse CD16 / CD32 (catalog number: 553142, purchased from BD Bioscience). A mixture of anti-surface molecule antibodies against mouse CD3-FITC, CD4-APC, and CD8-Percp-cy5.5 (catalog numbers: 553061, 553051, and 551162, purchased from BD Bioscience) was added for staining. After incubation for 30 minutes, the cells were washed twice, fixed and permeabilized for 20 minutes, washed once, and stained with a mixture of anti-cytokine antibodies against mouse IFN-γ-Pe-Cy7, IL-2-BV605, and TNF-α-BV650 (catalog numbers: 557649, 563943, and 563911, purchased from BD Bioscience). After incubation for 30 minutes, the cells were washed twice and resuspended in 200 µL PBS. Fluorescence signals were analyzed using a CYTEK Aurora / NL flow cytometer (model: NL-CLC V16B14R8, purchased from CytekBiosciences).

[0106] Figure 6 The results showed that monovalent vaccines, first-generation trivalent vaccines, and first-generation quadrivalent combined vaccines all fully activated antigen-specific CD4. + and CD8 + T-cell immune response. The placebo group did not activate specific T-cell responses, while the monovalent vaccine induced specific CD4+ responses against the HA protein of its respective matched strain. + and CD8 + T-cell immune response, antigen-specific CD4 + The proportion of T cells is greater than 1% (expressing at least one of the factors IFN-γ, TNF-α, or IL-2). First-generation trivalent vaccines induce the production of specific CD4 cells against the HA protein of the H1N1 strain. + and CD8 +T cell immune response (cell percentage greater than 1%); HA primarily induces specific CD4+ against H3N2. + T-cell immune response, antigen-specific CD4 + The proportion of T cells is greater than 1%; BV HA mainly induces specific CD8 cells. + T-cell immune response, antigen-specific CD8 + The proportion of T cells is greater than 10%; the first-generation quadrivalent vaccine induces specific CD4 cells against the HA protein of the three matched strains and against the Spike protein. + and CD8 + T-cell immune response: The activated T-cell response in the vaccine group was significantly higher than that in the placebo group (p < 0.01).

[0107] Example 4: Codon Screening for the 2024-2025 Seasonal Influenza Vaccine

[0108] In the Northern Hemisphere, only the H3N2 strain recommended by the WHO changed during the 2024-2025 quarter. Therefore, iterative updates to the H3N2 strain antigen were performed, ultimately resulting in a second-generation trivalent vaccine. The specific strategy involved codon optimization of the H3N2 strain A / Massachusetts / 18 / 2022 HA sequence, synthesizing multiple sequences as templates. In vitro transcription was performed, replacing UTPs in the mRNA sequences with N1-UTP or Pseudo-UTP. The mRNA and Lipofectamine were then... TM 2000 (catalog number: 11668019, manufacturer: Thermo) was mixed and transfected into 293T cells. The expression of each antigen sequence was verified by Western blot. NC represents cells transfected only with Lipofectamine. TM The negative control was 2000, and PC was the self-prepared mRNA-LNP containing first-generation monovalent H3N2, which served as the positive control for this experiment. Figure 7 The results showed that the target band was not detected in NC, and H3N2 protein was expressed in PC. Among the screened second-generation H3N2 sequences, the asterisked sequence (SEQ ID NO: 15) showed the best expression level in 293T cells.

[0109] Example 5: Preparation of lipid nanoparticles for a combined influenza vaccine and SARS-CoV-2 vaccine for the 2024-2025 season.

[0110] The second-generation H3N2 sequence with optimal expression (SEQ ID NO: 15), along with the previously screened 2023-2024 H1N1 and BV sequences, were packaged into LNPs using the same packaging method as the LNP preparation method described above. The packaged mRNA-LNPs constituted a monovalent vaccine. Alternatively, the three sequences were mixed at a mass ratio of 1:1:1 and then packaged into LNPs, resulting in a second-generation trivalent vaccine. For the second-generation quadrivalent combined vaccine, the influenza H1N1-RQ1, second-generation H3N2-RQ2, and BV-RQ1 sequences, along with a SARS-CoV-2 JN.1 virus Spike protein expression sequence, were mixed at a mass ratio of 1:1:1:1 and then packaged into LNPs. Western blot was used to verify the expression of mRNA-LNPs at the cellular level. Empty LNP packages served as negative controls (NC). Figure 8A and Figure 8B The results showed that the NC vaccine does not express the HA protein, while the H1N1, second-generation H3N2, and BV monovalent vaccines each express specific HA proteins. The second-generation trivalent vaccine expresses HA proteins from all three strains of H1N1, H3N2, and BV, and the expression levels of each strain's HA protein in the second-generation trivalent vaccine are comparable to those in the first-generation trivalent vaccine. The second-generation quadrivalent combined vaccine expresses HA proteins from all three strains of H1N1, H3N2, and BV, as well as the SARS-CoV-2 Spike protein.

[0111] Example 6: Immunogenicity of the 2024-2025 seasonal influenza vaccine and the SARS-CoV-2 combined vaccine

[0112] Six- to eight-week-old female BALB / c mice were selected, with six animals per group. Mice in each group were administered the vaccine at week 0 and week 4, including a placebo and a packaged alternative vaccine. Animal immunization groups are shown in Table 2 below.

[0113] Table 2. Mouse Immunization Protocol

[0114]

[0115] The mice were administered the drugs via intramuscular injection, and serum was collected two weeks after the second administration. Spleens were harvested nine weeks after the second administration, and spleen cells were isolated for cellular immunoassay. The HAI antibody titer in serum was detected two weeks after the second administration. The HAI method used influenza strains or viral HA proteins including A / Wisconsin / 67 / 2022, A / Thailand / 8 / 2022 (H3N2), and B / Austria / 1359417 / 2021 (all strains were derived from NIBSC); Influenza A H3N2 (A / Darwin / 6 / 2021) Hemagglutinin / HA Protein (ECD, His Tag) (catalog number: 40868-V08B, manufacturer: Sinopharm), and the rest was as described in Example 3.

[0116] Figure 9 The results showed that both the monovalent and trivalent vaccines activated humoral immune responses. In the placebo group, HAI antibody titers were all below the limit of detection (assigned as half the limit of detection). The monovalent vaccine group induced high levels of HAI antibody titers against their respective strains, which were significantly higher than those in the placebo group (p < 0.01). The second-generation H3N2 monovalent vaccine induced HAI antibodies against the 2024-2025 seasonal strain A / Thailand / 8 / 2022 (H3N2), and the induced antibodies also showed cross-activity against the 2023-2024 circulating strain A / Darwin / 6 / 2021 (H3N2). At a 0.5 μg immunization dose, the GMT (log2) against both seasonal H3N2 strains was greater than 8. The second-generation trivalent vaccine induced high-level HAI antibody titers against three strains, and there was no significant difference between the 1.5 μg dose of the trivalent vaccine and the 0.5 μg dose of the monovalent vaccine, indicating that there was no significant immunogenic interference between sequences after H3N2 sequence iteration. The second-generation trivalent vaccine induced high-level HAI antibody titers against H1N1 and BV matched strains, and also showed high-level HAI antibody titers against the H3N2 strains of 2023-2024 (A / Darwin / 6 / 2021) and 2024-2025 (A / Thailand / 8 / 2022), which were significantly higher than those in the placebo group (p < 0.01). The second-generation quadrivalent combined vaccine induced high levels of HAI antibody titers against three influenza strains. At a 0.5 μg immunization dose, the GMT (log2) was greater than 6 for all three strains. Furthermore, the HAI titers induced by the 2 μg dose of the second-generation quadrivalent vaccine against the three matched strains showed no significant difference compared to the 1.5 μg dose of the second-generation trivalent vaccine. These results indicate that the second-generation quadrivalent combined vaccine with H3N2 sequence iteration can effectively activate and generate protective antibodies against all three influenza strains.

[0117] Intracellular factor staining (ICS) was used to detect the spleen antigen-specific T cell response in animals immunized with a second-generation trivalent vaccine. The ICS method was the same as described in Example 3. Figure 10 The results showed that the second-generation trivalent vaccine activated antigen-specific CD4. + and CD8 + T-cell immune response. The placebo group showed no activation of specific T-cell responses. The second-generation trivalent vaccine induced the production of specific CD4+ against the H1N1 strain HA protein. + and CD8 + T-cell immune response, primarily inducing specific CD4+ against H3N2 strain HA. + T-cell immune response, antigen-specific CD4 + T cell proportion greater than 2% (expressing at least one of IFN-γ, TNF-α, or IL-2); HA primarily induces specific CD8+ in BV strains. + T-cell immune response, antigen-specific CD8 + The proportion of T cells is greater than 3% (expressing at least one of the factors IFN-γ, TNF-α, or IL-2).

[0118] Six- to eight-week-old female BALB / c mice were selected, with six animals per group. Mice in each group were administered the following vaccines at week 0 and week 4: placebo, packaged second-generation trivalent vaccine, and the marketed inactivated split vaccine QIV (Beijing Sinovac Biotech Co., Ltd.). Animal immunization groups are shown in Table 3 below.

[0119] Table 3. Immunization regimen for mice

[0120]

[0121] The influenza virus was administered via intramuscular injection, and serum was collected two weeks after the second administration for later use. The neutralizing antibody titer in the serum was detected two weeks after the second immunization using the MN method. The influenza strains used in the MN method included A / Wisconsin / 67 / 2022, A / Darwin / 6 / 2021, B / Austria / 1359417 / 2021, and B / Washington / 02 / 2019; the rest were as described in Example 3.

[0122] Figure 11The results showed that the second-generation trivalent and quadrivalent combined vaccines induced high levels of neutralizing antibody titers against both matched and unmatched strains. The GMT (log10) of neutralizing antibodies against A / Wisconsin / 67 / 2022, A / Darwin / 6 / 2021, and B / Austria / 1359417 / 2021 were all between 4 and 5, while the GMT (log10) of neutralizing antibody against B / Washington / 02 / 2019 was between 3 and 4. These levels were significantly higher than the placebo group (p < 0.01) and significantly higher than the control vaccine QIV (p < 0.01), indicating that the second-generation trivalent and quadrivalent combined vaccines have good immunogenicity and broad-spectrum activity, and their immunogenicity is superior to the control inactivated lysate vaccine.

[0123] Example 7: Protective effect of the 2024-2025 seasonal influenza vaccine and SARS-CoV-2 combined vaccine in a mouse influenza pneumonia model.

[0124] Six- to eight-week-old female BALB / c mice were selected, with six animals per group. Mice in each group were administered the following vaccines at weeks 0 and 4: placebo, packaged second-generation trivalent vaccine, and the marketed inactivated split vaccine QIV (Beijing Sinovac Biotech Co., Ltd.). The immunization regimens for mice are shown in Table 4 below. To investigate the protective efficacy of the vaccines, four weeks after the second immunization, the mice were challenged with a lethal dose of influenza virus via nasal instillation. The challenge strains were A / California / 07 / 2009 (H1N1), A / HongKong / 1 / 1968 (H3N2), and B / Guangzhou / 0215 / 2012 (BV). Seven animals were randomly selected from each group for each strain.

[0125] Table 4. Mouse Immunization Protocol

[0126]

[0127] The survival rate and weight changes of the animals were monitored after the challenge. Figure 12 and Figure 13The results showed that the second-generation trivalent and quadrivalent combined vaccines provided 100% protection in H1N1, H3N2, and BV-induced fatal mouse pneumonia models, while all mice in the placebo group died. In the QIV group, all H1N1-challenged mice survived, the survival rate of H3N2-challenged mice was only 14.3%, and the survival rate of BV-challenged mice was 85.7%. Weight monitoring results showed that the second-generation trivalent and quadrivalent combined vaccines effectively alleviated weight loss. In the three subtype challenge models, the percentage weight loss of the second-generation trivalent and quadrivalent combined vaccines was less than 10%, and weight began to increase one week after challenge. In contrast, the placebo group experienced continuous weight loss until death, the weight loss percentage in the split vaccine control group exceeded 10%, and the weight loss in the H1N1 and H3N2 challenge models reached approximately 20%. The second-generation trivalent and quadrivalent combined vaccines were still significantly superior to the marketed control vaccine QIV in alleviating weight loss. These results suggest that the second-generation trivalent vaccine activates and produces superior protective efficacy against influenza H1N1, H3N2, and BV subtypes.

[0128] Example 8: Preparation of Influenza Vaccine for the 2025-2026 Season

[0129] The WHO-recommended strain for the 2025-2026 quarter only changed in H3N2, therefore, the H3N2 strain antigen was iteratively updated to ultimately obtain a third-generation trivalent vaccine. The specific strategy involved codon optimization of the H3N2 strain A / District of Columbia / 27 / 2023 HA sequence, synthesizing multiple sequences as templates. In vitro transcription was performed, replacing UTPs in the mRNA sequences with N1-UTP or Pseudo-UTP. The mRNA and Lipofectamine were then... TM 2000 (catalog number: 11668019, manufacturer: Thermo) was mixed and transfected into 293T cells. The expression of each antigen sequence was verified by Western blot. NC represents cells transfected only with Lipofectamine. TM 2000 negative control, first-generation and second-generation H3N2 sequences as PC positive control. Figure 14 The results showed that all six sequences in the third-generation H3N2 were highly expressed under N1 or pseudo modification.

[0130] Example 9: Preparation of lipid nanoparticles for 2025-2026 seasonal influenza vaccine

[0131] The superior expression levels of the third-generation H3N2 sequences RQ1 (SEQ ID NO: 18) or RQ5 (SEQ ID NO: 22), along with the previously screened H1N1 and BV sequences, were packaged into LNPs using the same packaging method as the LNP preparation method described above. The packaged mRNA-LNPs were monovalent vaccines. Alternatively, the three sequences were mixed at a mass ratio of 1:1:1 and then packaged into LNPs. The packaged mRNA-LNPs were third-generation trivalent vaccines, with the third-generation H3N2 sequence RQ1 pseudodo being designated as third-generation trivalent-RQ1, and the third-generation H3N2 sequence RQ5 pseudodo being designated as third-generation trivalent-RQ5. Western blot was used to verify the expression of mRNA-LNPs at the cellular level. The correspondence between transfected samples is shown in Table 5 below. Empty LNP packages were used as negative controls (NC), and previously prepared first-generation and second-generation trivalent vaccines were used as positive controls. Figure 15 The results showed that NC does not express HA protein, while the H1N1, third-generation H3N2, and BV monovalent vaccines express specific HA proteins, and the third-generation trivalent vaccine expresses HA proteins from three strains: H1N1, H3N2, and BV.

[0132] Table 5

[0133]

[0134] Example 10: Immunogenicity of the 2025-2026 seasonal influenza vaccine

[0135] Six BALB / c female mice aged 6-8 weeks were selected, with 6 animals in each group. Each group of mice was administered the drug at week 0 and week 3, including placebo and packaged alternative vaccines. The immunization regimens are shown in Table 6.

[0136] Table 6. Immunization regimens for mice

[0137]

[0138] The drugs were administered via intramuscular injection, and serum samples were collected two weeks after the second administration for later use. The HAI antibody titer in the serum was detected two weeks after the second administration using the HAI method. The HAI method used influenza strains or viral HA proteins including A / Wisconsin / 67 / 2022, A / Thailand / 8 / 2022 (H3N2), and B / Austria / 1359417 / 2021 (all strains were derived from NIBSC); Influenza A H3N2 (A / Darwin / 6 / 2021) Hemagglutinin / HA Protein (ECD, His Tag) (catalog number: 40868-V08B, manufacturer: Sinopharm), and the rest was as described in Example 3. Figure 16The results showed that the HAI antibody titers in the placebo group were all below the detection limit (assigned as half of the detection limit). The monovalent vaccine group induced high-level HAI antibody titers against their respective matched strains, with GMT (as log2) greater than 6 at a 0.5 μg immunization dose, which were significantly higher than the placebo group (p < 0.01). The trivalent vaccine induced high-level HAI antibody titers against the three matched strains, with GMT (as log2) greater than 6 at a 1.5 μg immunization dose, which were significantly higher than the placebo group (p < 0.01), and there was no significant difference compared with the monovalent vaccine.

[0139] Example 11 Preparation of lipid nanoparticles with different ratios for trivalent influenza vaccine

[0140] To explore the optimal range of the mass ratio of the three antigens in a trivalent vaccine, the immunogenicity differences of trivalent antigens at mass ratios of 1:1:0.5–1:1:4 were compared by varying the BV ratio. The three sequences H1N1-RQ1, second-generation H3N2-RQ2, and BV-RQ1 were mixed in different proportions and then packaged as LNPs using the same packaging method as the LNP preparation method described above. Trivalent vaccines 1–4 were obtained by packaging LNPs at mass ratios of 1:1:0.5–1:1:4, as shown in Table 7 below.

[0141] Table 7

[0142]

[0143] Western blot was used to verify the expression of mRNA-LNP at the cellular level. An empty LNP packet was used as a negative control (NC). Figure 17 The results showed that all three trivalent vaccines (1-4) expressed HA proteins from three strains: H1N1, H3N2, and BV. As the BV antigen content increased, the HA expression of H1N1 and H3N2 decreased, while the HA expression of BV increased.

[0144] Example 12 Immunogenicity of Different Ratios of Trivalent Influenza Vaccine Antigens

[0145] Six- to eight-week-old female BALB / c mice were selected, with six animals per group. Mice in each group were administered the vaccine at week 0 and week 4, including a placebo and a packaged alternative vaccine. Animal immunization groups are shown in Table 8 below.

[0146] Table 8. Immunization regimens for mice

[0147]

[0148] The drugs were administered via intramuscular injection, and serum samples were collected two weeks after the second administration for later use. The HAI antibody titer in the serum was detected two weeks after the second administration using the HAI method. The HAI method used influenza strains or viral HA proteins including A / Wisconsin / 67 / 2022 and B / Austria / 1359417 / 2021 (all strains were derived from NIBSC); Influenza A H3N2 (A / Darwin / 6 / 2021) Hemagglutinin / HA Protein (ECD, His Tag) (Catalog No.: 40868-V08B, Manufacturer: Sinopharm), and the rest was as described in Example 3. Figure 18 The results showed that HAI antibody titers in the placebo group were all below the detection limit (assigned as half of the lower detection limit). The vaccine group induced high levels of HAI antibody titers against all three strains, which were significantly higher than those in the placebo group (p < 0.01). When the BV antigen ratio was 1:1:0.5–1:1:2, there was no significant change in HAI titers against H1N1 and H3N2 strains, and the GMT (log2) was greater than 6. When the BV antigen ratio was 1:1:4, the HAI titers against H1N1 and H3N2 decreased. However, as the BV antigen ratio increased, the HAI titers against BV strains gradually increased. When the BV antigen ratio was 1:1:0.5, the GMT (log2) was between 4 and 6; when the BV antigen ratio was 1:1:2–1:1:4, the GMT (log2) was greater than 6. Based on the above results, the HAI titers against H1N1, H3N2, and BV induced by the three antigen mass ratios of 1:1:1 to 1:1:2 are optimal.

[0149] The sequence involved in this invention is shown below:

[0150] The amino acid and nucleotide sequences of A / Wisconsin / 67 / 2022 HA (Wis67-H1N1-HA) are as follows:

[0151] (SEQ ID NO: 1):

[0152] MKAILVVMLYTFTTANADTLCIGYHANNSTDTVDTVLEKNVTVTHSVNLLEDKHNGKLCKLRGVAPLHLGQCNIAGWILGNPECESLSTARSWSYIVETSNSDNGTCYPGDFINYEELREQLSSVSSFERFEIFPKTSSWPNHDSDNGVTAACSHAGARSFYKNLIWLVKKGKSYPKINQTYINDKGKEVLVLWGIHHPPTITDQESLYQNADAYVFVGTSRYSKKFKPEIATRPKVRDQAGRMNYYWTLVEPGDKITFEATGNLVAPRYAFTMEKEAGSGIIISDTPVHDCNATCQTPEGAINTSLPFQNVHPITIGKCPKYVRSTKLRLATGLRNVPSIQSRGLFGAIAGFIEGGWTGMVDGWYGYHHQNDQGSGYAADLKSTQNAIDKITNKVNSVIEKMNTQFTAVGKEFNHLEKRIENLNKKVDDGFLDVWTYNAELLVLLENERTLDYHDSNVKNLYEKVRHQLKNNAKEIGNGCFEFYHKCDNTCMESVKNGTYDYPKYSEEAKLNREKIDGVKLDSTRIYQILAIYSTVASSLVLVVSLGAISFWMCSNGSLQCRICIYPYDVPDYAGSSGVSGWRLFKKIS

[0153] (SEQ ID NO: 6):

[0154]

[0155] (SEQ ID NO: 7):

[0156]

[0157] (SEQ ID NO: 8):

[0158]

[0159] (SEQ ID NO: 9):

[0160]

[0161] (SEQ ID NO: 10):

[0162]

[0163] (SEQ ID NO: 11):

[0164]

[0165] The amino acid sequence and nucleotide sequence of A / DARWIN / 6 / 2021 (DA06-H3N2-HA) are as follows:

[0166] (SEQ ID NO: 2)

[0167] MKTIIALSNILCLVFAQKIPGNDNSTATLCLGHHAVPNGTIVKTITNDRIEVTNATELVQNSSIGEICGSPHQILDGGNCTLIDALLGDPQCDGFQNKEWDLFVERSRANSNCYPYDVPDYASLRSLVASSGTLEFKNESFNWTGVKQNGTSSACIRGSSSSFFSRLNWLTSLNNIYPAQNVTMPNKEQFDKLYIWGVHHPDTDKNQISLFAQSSGRITVSTKRSQQAVIPNIGSRPRIRDIPSRISIYWTIVKPGDILLINSTGNLIAPRGYFKIRSGKSSIMRSDAPIGKCKSECITPNGSIPNDKPFQNVNRITYGACPRYVKQSTLKLATGMRNVPEKQTRGIFGAIAGFIENGWEGMVDGWYGFRHQNSEGRGQAADLKSTQAAIDQINGKLNRLIGKTNEKFHQIEKEFSEVEGRVQDLEKYVEDTKIDLWSYNAELLVALENQHTIDLTDSEMNKLFEKTKKQLRENAEDMGNGCFKIYHKCDNACIGSIRNETYDHNVYRDEALNNRFQIKGVELKSGYKDWILWISFAMSCFLLCIALLGFIMWACQKGNIRCNICI

[0168] (SEQ ID NO: 12):

[0169]

[0170] (SEQ ID NO: 13):

[0171]

[0172] (SEQ ID NO: 14):

[0173]

[0174] The amino acid sequence and nucleotide sequence of A / MASSACHUSETTS / 18 / 2022 (MA18-H3N2-HA) are as follows:

[0175] (SEQ ID NO: 3):

[0176] MKAIIALSNILCLVFAQKIPGNDNSTATLCLGHHAVPNGTIVKTITNDRIEVTNATELVQNSSIGKICNSPHQILDGGNCTLIDALLGDPQCDGFQNKEWDLFVERSRANSSCYPYDVPDYASLRSLVASSGTLEFKNESFNWTGVKQNGTSSACKRGSSSSFFSRLNWLTSLNNIYPAQNVTMPNKEQFDKLYIWGVHHPDTDKNQFSLFAQSSGRITVSTKRSQQAVIPNIGSRPRVRDIPSRISIYWTIVKPGDILLINSTGNLIAPRGYFKIRSGKSSIMRSDAPIGKCKSECITPNGSIPNDKPFQNVNRITYGACPRYVKQSTLKLATGMRNVPEKQTRGIFGAIAGFIENGWEGMVDGWYGFRHQNSEGRGQAADLKSTQAAIDQISGKLNRLIGKTNEKFHQIEKEFSEVEGRVQDLEKYVEDTKIDLWSYNAELLVALENQHTIDLTDSEMNKLFEKTKKQLRENAEDMGNGCFKIYHKCDNACIGSIRNETYDHNVYRDEALNNRFQIKGVELKSGYKDWILWISFAMSCFLLCIALLGFIMWACQKGNIRCNICI

[0177] (SEQ ID NO: 15):

[0178]

[0179] (SEQ ID NO: 16):

[0180]

[0181] (SEQ ID NO: 17):

[0182]

[0183] The amino acid sequence and nucleotide sequence of A / DISTRICT OF COLUMBIA / 27 / 2023 (DI27 - H3N2 - HA) are as follows:

[0184] (SEQ ID NO: 4):

[0185] MKAIIALSNILCLVFAQKIPGNDNSTATLCLGHHAVPNGTIVKTITNDRIEVTNATELVQNSSIGKICNSPHQILDGGNCTLIDALLGDPQCDGFQNKEWDLFVERSRANSSCYPYDVPDYASLRSLVASSGTLEFKDESFNWTGVKQNGTSSACKRGSSNSFFSRLNWLTSLNNIYPAQNVTMPNKEQFDKLYIWGVHHPDTDKNQFSLFAQSSGRITVSTKRSQQAVIPNIGSRPRVRDIPSRISIYWTIVKPGDILLINSTGNLIAPRGYFKIRSGKSSIMRSDAPIGECKSECITPNGSIPNDKPFQNVNRITYGACPRYVKQSTLKLATGMRNVPEKQTRGIFGAIAGFIENGWEGMVDGWYGFRHQNSEGRGQAADLKSTQAAIDQISGKLNRLIGKTNEKFHQIEKEFSEVEGRVQDLEKYVEDTKIDLWSYNAELLVALENQHTIDLTDSEMNKLFEKTKKQLRENAEDMGNGCFKIYHKCDNACIGSIRNETYDHNVYRDEALNNRFQIKGVELKSGYKDWILWISFAMSCFLLCIALLGFIMWACQKGNIRCNICI [[ID=,10]]

[0186] (SEQ ID NO: 18):

[0187]

[0188] (SEQ ID NO: 19):

[0189]

[0190] (SEQ ID NO: 20):

[0191]

[0192] (SEQ ID NO: 21):

[0193]

[0194] (SEQ ID NO: 22):

[0195]

[0196] (SEQ ID NO: 23):

[0197]

[0198] The amino acid sequence and nucleotide sequence of B / AUSTRIA / 1359417 / 2021 (B13 - BV - HA) are as follows:

[0199] (SEQ ID NO: 5):

[0200] MKAIIVLLMVVTSNADRICTGITSSNSPHVVKTATQGEVNVTGVIPLTTTPTKSHFANLKGTETRGKLCPKCLNCTDLDVALGRPKCTGKIPSARVSILHEVRPVTSGCFPIMHDRTKIRQLPNLLRGYEHVRLSTHNVINTEDAPGGPYEIGTSGSCLNITNGKGFFATMAWAVPKNKTATNPLTIEVPYICTEEEDQITVWGFHSDDETQMARLYGDSKPQKFTSSANGVTTHYVSQIGGFPNQTEDGGLPQSGRIVVDYMVQKSGKTGTITYQRGILLPQKVWCASGKSKVIKGSLPLIGEADCLHEKYGGLNKSKPYYTGEHAKAIGNCPIWVKTPLKLANGTKYRPPAKLLKERGFFGAIAGFLEGGWEGMIAGWHGYTSHGAHGVAVAADLKSTQEAINKITKNLNSLSELEVKNLQRLSGAMDELHNEILELDEKVDDLRADTISSQIELAVLLSNEGIINSEDEHLLALERKLKKMLGPSAVEIGNGCFETKHKCNQTCLDRIAAGTFDAGEFSLPTFDSLNITAASLNDDGLDNHTILLYYSTAASSLAVTLMIAIFVVYMVSRDNVSCSICL

[0201] (SEQ ID NO: 24):

[0202]

[0203] (SEQ ID NO: 25):

[0204]

[0205] (SEQ ID NO: 26):

[0206]

[0207] T7 promoter:

[0208] GAATTCGCCGTAATACGACTCACTATA (SEQ ID NO: 27)

[0209] 5' Untranslated Region (5'UTR):

[0210] AGGAAATAAGAGAGAAAACTCTTCTGGTCCCCACAGACTCAGAGAGAACCCGCCACC (SEQ ID NO: 28)

[0211] 3' Untranslated Region (3'UTR):

[0212] GCTGGAGCCTCGGTGGCCATGCTTTCTTGCCCCTTGGGCCTCCCCCCAGCCCCTCCTCCCCTTCCTGCACCCGTACCCCCGTGGTCTTTGAATAAAGTCTGAGTGGGCGGCA (SEQ ID NO: 29)

[0213] Polyadenylated acid (POLY A):

[0214] AAAAAAAAAAAAAAAAAAAAAAAAAAAGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA (SEQ ID NO: 30)

[0215] The amino acid and nucleotide sequences of SARS-CoV-2 JN.1 used are as follows:

[0216] (SEQ ID NO: 31):

[0217]

[0218] (SEQ ID NO: 32):

[0219]

[0220] While specific embodiments of the present invention have been described above, those skilled in the art should understand that these are merely illustrative examples, and the scope of protection of the present invention is defined by the appended claims. Those skilled in the art can make various changes or modifications to these embodiments without departing from the principles and essence of the present invention, but all such changes and modifications fall within the scope of protection of the present invention.

Claims

1. An antigen combination of an influenza virus, characterized in that, The antigen combination includes one or more of the following: (1) The HA protein of H1N1 influenza virus or its immunogenic fragment, wherein the H1N1 influenza virus is A / Wisconsin / 67 / 2022; (2) The HA protein or an immunogenic fragment of the H3N2 influenza virus, wherein the H3N2 influenza virus is selected from any one of A / Darwin / 6 / 2021, A / Massachusetts / 18 / 2022 and A / District of Columbia / 27 / 2023; or, (3) The HA protein of BV influenza virus or its immunogenic fragment, wherein the BV influenza virus is B / Austria / 1359417 / 2021.

2. An antigen combination of an influenza virus, characterized in that, The antigen combination satisfies one or more of the following conditions: (1) The amino acid sequence of the HA protein of the H1N1 influenza virus is shown in SEQ ID NO: 1; (2) The amino acid sequence of the HA protein of the H3N2 influenza virus is shown in any one of SEQ ID NO: 2-4; and, (3) The amino acid sequence of the HA protein of the H3N2 influenza virus is shown in SEQ ID NO: 5; More preferably, the mass ratio of the antigen combination is HA protein of H1N1 influenza virus : HA protein of H3N2 influenza virus : HA protein of BV influenza virus = 1 : 1 : (0.5-4), preferably 1 : 1 : (1-2).

3. A combined antigen combination of influenza virus and SARS-CoV-2 virus, characterized in that, The combined antigen combination includes the antigen combination as described in claim 1 or 2, and the Spike protein of SARS-CoV-2 virus or its immunogenic fragment, wherein the SARS-CoV-2 virus is preferably SARS-CoV-2 JN.1; Preferably, the amino acid sequence of the Spike protein of the SARS-CoV-2 virus is shown in SEQ ID NO: 31; More preferably, the mass ratio of the combined antigen combination is HA protein of H1N1 influenza virus: HA protein of H3N2 influenza virus: HA protein of BV influenza virus: Spike protein of SARS-CoV-2 virus = 1:1:(0.5-4):1, preferably 1:1:(1-2):

1.

4. An isolated nucleic acid, characterized in that, The nucleic acid encodes the antigen combination as described in claim 1 or 2, or the combined antigen combination as described in claim 3; preferably, the nucleic acid satisfies one or more of the following conditions: (1) The nucleic acid encodes the HA protein A / Wisconsin / 67 / 2022, the nucleotide sequence of which is shown in any one of SEQ ID NO: 6-11; (2) The nucleic acid encodes the HA protein of A / Darwin / 6 / 2021, the nucleotide sequence of which is shown in any one of SEQ ID NO: 12-14; (3) The nucleic acid encodes the HA protein of A / Massachusetts / 18 / 2022, the nucleotide sequence of which is shown in any one of SEQ ID NO:15-17; (4) The nucleic acid encoding the HA protein of A / District of Columbia / 27 / 2023 has a nucleotide sequence as shown in any one of SEQ ID NO: 18-23; (5) The nucleic acid encoding the HA protein of B / Austria / 1359417 / 2021 has a nucleotide sequence as shown in any one of SEQ ID NO:24-26; (6) The nucleic acid encodes the Spike protein of SARS-Cov2 JN.1, and its nucleotide sequence is shown in SEQ ID NO: 32; Preferably, the nucleic acid is selected from one or more of the following: (1) mRNA, preferably, the mRNA further comprises one or more of a cap promoter, 5'UTR, 3'UTR and poly(A); and / or, the mRNA further comprises polynucleotide modifications; (2) DNA, wherein the DNA is single-stranded DNA or double-stranded DNA; and, (3) Self-amplifying RNA, self-replicating RNA, or circular RNA; More preferably, when the nucleic acid is mRNA, the mRNA also satisfies at least one of the following conditions: (i) The promoter comprises the nucleotide sequence as described in SEQ ID NO: 27; (ii) The 5'UTR contains the nucleotide sequence as described in SEQ ID NO: 28; (iii) The 3'UTR contains the nucleotide sequence as described in SEQ ID NO: 29; (iv) The poly(A) comprises the nucleotide sequence as described in SEQ ID NO: 30; and, (v) The polynucleotide modification is selected from one or more of the following: pseudouridine modification, N1-methyl-pseudouridine modification, 5-methoxyuridine modification, N1-methyladenosine modification, N6-methyladenosine modification and 5-methylcytidine modification; the polynucleotide modification is preferably pseudouridine modification or N1-methyl-pseudouridine modification.

5. The nucleic acid as described in claim 4, characterized in that, The DNA satisfies any of the following: (1) The DNA is a single-stranded DNA, which is the template strand for transcribing the mRNA defined in the nucleic acid as described in claim 4; or, the single-stranded DNA is a coding strand that is inversely complementary to the template strand for transcribing the mRNA defined in the nucleic acid as described in claim 4. (2) The DNA is double-stranded DNA, which includes the template strand and the coding strand described in (1).

6. A recombinant expression vector, characterized in that, The recombinant expression vector comprises the nucleic acid as described in claim 4 or 5.

7. A transformant, characterized in that, The transformant comprises the nucleic acid as described in claim 4 or 5 or the recombinant expression vector as described in claim 6; Preferably, the host cell of the transformant is a eukaryotic cell; More preferably, the host cell is selected from yeast cells or mammalian cells, such as 293T cells.

8. A composition, characterized in that, The composition comprises (1) mRNA as defined in the nucleic acid of claim 4, and (2) a delivery vector; Preferably, the delivery carrier is a lipid nanoparticle; More preferably, the lipid nanoparticles are composed of cationic lipids, cholesterol, phospholipids, and lipid conjugates; and / or, The N / P ratio of the ionizable lipids in the lipid nanoparticles to the mRNA is (3~15):1; More preferably, the lipid nanoparticles are composed of cationic lipid RL151, cholesterol, DSPC and DMG-PEG2000, and the molar ratio of cationic lipid RL151: cholesterol: DSPC: DMG-PEG2000 is (45-55):(35-42):(8-14):(1-5), preferably 50:38.5:10:1.

5.

9. A method for preparing a composition for alleviating, preventing, and / or treating diseases caused by influenza viruses, characterized in that, The method includes the step of mixing an aqueous phase containing mRNA with a lipid phase containing a delivery vector, wherein the mRNA and the delivery vector are as defined in the composition of claim 8; Preferably, the method employs microfluidic technology; More preferably, the total flow rate of the microfluidic synthesis is 11-13 mL / min, preferably 12 mL / min; and / or, the flow rate ratio of the aqueous phase to the lipid phase is 2:1-4:1, preferably 3:

1.

10. A method for preparing a combined composition for alleviating, preventing, and / or treating diseases caused by influenza virus and SARS-CoV-2 virus, characterized in that, The method includes the step of mixing an aqueous phase containing mRNA with a lipid phase containing a delivery vector, wherein the mRNA and the delivery vector are as defined in the composition of claim 8; Preferably, the method employs microfluidic technology; More preferably, the total flow rate of the microfluidic synthesis is 11-13 mL / min, preferably 12 mL / min; and / or, the flow rate ratio of the aqueous phase to the lipid phase is 2:1-4:1, preferably 3:

1.

11. A pharmaceutical composition, characterized in that, The pharmaceutical composition comprises an antigen combination as described in claim 1 or 2, a combined antigen combination as described in claim 3, a nucleic acid as described in claim 4 or 5, or a composition as described in claim 8, and optionally a pharmaceutically acceptable carrier and / or excipient.

12. A vaccine, characterized in that, The vaccine comprises an antigen combination as described in claim 1 or 2, a combined antigen combination as described in claim 3, a nucleic acid as described in claim 4 or 5, a composition as described in claim 8, and / or a pharmaceutical composition as described in claim 11, and an adjuvant.

13. The use of the antigen combination as described in claim 1 or 2, the combined antigen combination as described in claim 3, the nucleic acid as described in claim 4 or 5, the recombinant expression vector as described in claim 6, the transformant as described in claim 7, the composition as described in claim 8, and / or the pharmaceutical composition as described in claim 11 in the preparation of medicaments for alleviating, preventing, and / or treating diseases caused by influenza virus and / or SARS-CoV-2 virus infection; Preferably, the influenza virus is an H1N1 influenza virus, an H3N2 influenza virus, and / or an influenza B virus, and / or, the SARS-CoV-2 is a JN.1 variant or a sub-variant; and / or, The disease mentioned is influenza, upper respiratory tract infection, influenza virus pneumonia, or novel coronavirus.

Images