P450 monooxygenase for catalytically synthesizing omega-hydroxy fatty acid and application of P450 monooxygenase
By using the P450 monooxygenase MCC of Spongiibacter sp.IMCC21906, the ω-position hydroxylation of fatty acids is directly used to activate the hydrogen peroxide shunt pathway, solving the problem of relying on redox chasms and cofactors in the prior art, and achieving efficient and economical ω-hydroxy fatty acid synthesis.
Patent Information
- Application Number
- CN202510419387.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-04-03
- Publication Date
- 2025-08-08
AI Technical Summary
The existing P450 monooxygenase catalyzed synthesis of omega-hydroxy fatty acids requires redox chaperone and expensive cofactor NADPH, which has low catalytic efficiency, limiting its application in industrial applications.
The P450 monooxygenase MCC derived from Spongiibacter sp.IMCC21906 was used to activate the hydrogen peroxide shunt pathway using H2O2 to directly catalyze the ω hydroxylation of fatty acids, and simplify the catalytic pathway without relying on redox chaperone and cofactor NADPH.
It has achieved efficient and economical hydroxylation of fatty acid ω-position, simplified the catalytic process, improved the catalytic efficiency, and had important industrial application potential.
Smart Images

Figure CN120442570A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the field of enzyme catalysis engineering technology, and in particular to a novel P450 monooxygenase expressed intracellularly that can utilize H2O2 small molecules for catalytic reactions and its application in the ω oxidation of medium- and long-chain fatty acids. Background Art
[0002] Inserting an oxygen atom into an unactivated C-H bond is a reaction difficult to achieve using traditional chemical methods, but it is a common reaction in biological systems catalyzed by heme-dependent cytochrome P450 monooxygenases (CYPs). Biocatalysis offers significant green chemistry advantages: high regio- and stereoselectivity, air as a mild oxidant, reactions primarily in aqueous phase, and operation at near-ambient temperature and pressure. These advantages contribute to a reduction in reaction steps, improved atom economy, reduced safety risks, and minimal solvent usage. Furthermore, through directed evolution, the selectivity, turnover rate, and substrate scope of biocatalysts can be optimized for specific transformations, achieving maximum utility. This biological function is of great significance for the generation of fine chemicals, such as natural products, drug metabolites, and flavor and fragrance compounds. For example, CYP enzymes have been engineered to convert the natural product valerene into the expensive grapefruit-flavoring compound nootkatone. In addition, the selective hydroxylation of fatty acids provides a wide range of opportunities for the production of a variety of compounds such as pharmaceuticals, flavors, and fragrances from limited biomass feedstocks. For example, ω-hydroxy fatty acids (ω-OHFAs) and α,ω-dicarboxylic acids (α,ω-DCAs) with terminal oxidation of fatty acids are multifunctional compounds used to produce polymers and musk fragrances. Polymers derived from saturated and unsaturated ω-OHFAs are considered to be bio-based plastics with high water resistance, durability, and chemical versatility. ω-Oxygen functionalized products derived from long-chain fatty acids such as dodecanoic acid (C12-FA) can be used to synthesize different bioplastics.
[0003] Honda Malca et al. studied CYP153 from Marinobacter aquaeloei. M.aq It can be used to catalyze the synthesis of ω-OHFAs of different sizes and degrees of saturation with high conversion rates (63-93%) and ω-regioselectivity (over 95%). (See Chem Commun (Camb). 2012 May 25; 48(42): 5115-7.) Polymers synthesized from these monomers can be used to produce environmentally friendly elastic materials. Hyungdon Yun et al. improved the catalytic efficiency of CYPs by introducing natural redox partners. (See Catalysts 2019, 9(1), 54).
[0004]
[0005] However, the above-mentioned oxidation reaction CYPs rely on expensive nicotinamide cofactors (NAD(P)H) and redox partners to assist electron transfer, and uncoupling and redox partner incompatibility often occur during the catalytic process, resulting in extremely low catalytic efficiency and limiting their application in large-scale or industrial synthesis.
[0006] P450 monooxygenase has a hydrogen peroxide shunt (H2O2 shunt) in the catalytic cycle, similar to heme peroxidase, which activates hydrogen peroxide to generate [Fe(IV)=O Por·+] through the "acid-base" effect without the need for additional redox proteins, thus avoiding the complex electron transfer process. Matsunaga et al. (see Journal of Biological Chemistry. 1997, 27(38), 23592-23596.) reported that P450 from Sphingomonas paucimobilis spα , which can utilize H2O2 to achieve hydroxylation reaction at the α position of lauric acid.
[0007]
[0008] The P450 monooxygenases that can utilize H2O2 reported so far are mainly CYP152 family, among which P450 spα , P450 BSβ It specifically hydroxylates at the α or β position of fatty acids and cannot achieve terminal hydroxylation of fatty acids. Summary of the Invention
[0009] The present invention obtains a P450 monooxygenase (named MCC) from Spongiibacter sp.IMCC21906 by screening and studying cytochrome P450 monooxygenases from various sources. The MCC can directly utilize small molecules of H2O2 to achieve terminal hydroxylation of fatty acids.
[0010] The specific technical solutions of the present invention are as follows:
[0011] A cytochrome P450 monooxygenase, wherein the enzyme molecule comprises the amino acid sequence shown in SEQ ID NO: 1.
[0012] Another object of the present invention is to provide a DNA molecule encoding the cytochrome P450 monooxygenase according to claim 1. Preferably, the nucleotide sequence is shown in SEQ ID NO: 2.
[0013] Another object of the present invention is to provide an expression vector for cytochrome P450 monooxygenase, which can express the cytochrome P450 monooxygenase of the present invention. The expression vector can be a plasmid, a phage, a virus or a host cell.
[0014] The host cell is a prokaryotic cell or a eukaryotic cell, and can be Escherichia coli, yeast, Bacillus, Lactobacillus, Aspergillus or Trichoderma, preferably Escherichia coli.
[0015] Another object of the present invention is to provide the use of the cytochrome P450 monooxygenase, DNA molecule, or expression vector described herein for catalytic synthesis of ω-hydroxy fatty acids. The cytochrome P450 monooxygenase utilizes small molecules of H2O2 to catalyze the terminal oxidation of medium-chain fatty acids to produce hydroxyl groups. The medium-chain fatty acids are saturated fatty acids ranging from C6 to C18.
[0016] Advantages of the present invention:
[0017] The present invention addresses the problem that the prior art cytochrome P450 monooxygenase-catalyzed synthesis of ω-hydroxy fatty acids (ω-OHFAs) requires a redox partner and uses the expensive cofactor NADPH. A new P450 monooxygenase MCC is screened out. The MCC utilizes the "hydrogen peroxide shunt pathway" in the catalytic mechanism of cytochrome P450 monooxygenase to specifically hydroxylate the ω position of fatty acids in the presence of small molecule H2O2. This MCC does not rely on the redox partner to transfer electrons or the expensive cofactor NADPH to transfer protons, thus avoiding the complex electron transfer process and greatly simplifying the catalytic pathway. The MCC is highly economical and environmentally friendly, and is of great significance for the industrial application of P450 monooxygenase. BRIEF DESCRIPTION OF THE DRAWINGS
[0018] The drawings constituting a part of this application are used to provide a further understanding of the present invention. The illustrative embodiments of the present invention and their descriptions are used to explain the present invention and do not constitute improper limitations on the present invention.
[0019] Figure 1 The figure shows the SDS-PAGE electrophoresis analysis of cytochrome P450 monooxygenase MCC. Lane 1 is the blank control, lane 2 is the soluble crude enzyme expressed intracellularly, and lane 3 is the purified enzyme.
[0020] Figure 2 This is the optimal temperature analysis of cytochrome P450 monooxygenase MCC.
[0021] Figure 3 Temperature stability analysis of cytochrome P450 monooxygenase MCC.
[0022] Figure 4These are the catalytic results and mass spectrometry results of cytochrome P450 monooxygenase MCC on octanoic acid.
[0023] Figure 5 These are the catalytic results and mass spectrometry results of cytochrome P450 monooxygenase MCC on decanoic acid.
[0024] Figure 6 These are the catalytic results and mass spectrometry results of cytochrome P450 monooxygenase MCC on Dodecanoic acid.
[0025] Figure 7 These are the catalytic results and mass spectrometry results of cytochrome P450 monooxygenase MCC on myristic acid.
[0026] Figure 8 These are the catalytic results and mass spectrometry results of cytochrome P450 monooxygenase MCC on palmitic acid.
[0027] Figure 9 This is the catalytic result of cytochrome P450 monooxygenase MCC on Dodecanoic acid in the NADPH-redox chaperone system. DETAILED DESCRIPTION
[0028] In order to enable those skilled in the art to better understand the present invention, the present invention will be further described below with reference to the accompanying drawings and implementation examples. It should be noted that this embodiment is only used to explain the present invention and is not intended to limit the scope of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative work should fall within the scope of protection of the present invention.
[0029] Example 1 Construction of an engineered bacterium for expressing cytochrome P450 monooxygenase
[0030] The cytochrome P450 monooxygenase of the present invention is derived from Spongiibacter sp.IMCC21906, and its amino acid sequence is shown in SEQ ID NO: 1. To increase the protein expression, a recombinant Escherichia coli expression vector was constructed. The genomic DNA of the strain Spongiibacter sp.IMCC21906 was used as a template, high-fidelity enzyme 2×Phanta Max Master Mix (Nanjing Novizan Biotechnology Co., Ltd.), and primer pair BF (5'CG CATATG AAAATTGTGGATGGTGGCGGAA 3', Nde I, SEQ ID NO:3) and BR (5'GC CTCGAG TAAACGAGCAGTCAAAGTGGTA 3', Xho I, SEQ ID NO: 4) was amplified by PCR. The experimental procedures were referred to the Vazyme biological product and operation manual. The amplified coding gene DNA fragment should be 1377bp. The correct band length was verified by nucleic acid electrophoresis, and its base sequence is shown in SEQ ID NO: 2. The amplified DNA fragment was digested with Dpn I to digest the template DNA. After digestion, the PCR product was purified to remove primers, enzyme proteins, single nucleotides, etc. in the system. This step was completed using the AxyPrep PCR Cleanup Kit.
[0031] The purified DNA fragment was double-digested with the pET-22b(+) vector using restriction endonucleases Nde I and Xho I (Baoriyi Biotechnology Co., Ltd.). All digestions were performed in a 50 μl volume, following the manufacturer's instructions for DNA restriction endonuclease preparation and digestion. After digestion, gel extraction was performed. The vector DNA and fragment DNA were ligated at a molar ratio of 1:3 using a 10 μl volume of ligation system, catalyzed by T4 ligase, and incubated at 16°C overnight to obtain the plasmid pET22b-MCC. Following ligation, the ligation solution was heat-shocked and transformed into competent E. coli BL21(DE3) cells. The cells were plated on LB agar plates containing 100 μg / ml ampicillin and incubated at 37°C for 14-16 hours. Sequencing results (performed by Anhui General Biological Company) were used to verify the results, resulting in the corresponding recombinant strain, E. coli BL21(DE3)-MCC.
[0032] Example 2 Expression of Cytochrome P450 Monooxygenase MCC
[0033] The recombinant strain constructed in Example 1 was inoculated into 50 mL of LB liquid medium, and ampicillin was added to a final concentration of 100 μg / mL. The culture was carried out at 180 rpm / min and 37°C overnight. The seed solution of the overnight culture was inoculated into fresh 50 mL of LB liquid medium at an inoculum size of 2%, and the culture was carried out at 180 rpm / min and 37°C at a constant temperature until the OD600 was 0.6-1.0. Then, the inducer IPTG (final concentration 0.01 mM), Fe2SO4 (final concentration 0.25 mM), and 5-ALA (final concentration 0.5 mM) were added, and the expression was induced at 16°C for 16-20 h. Take the induced expression fermentation liquid, centrifuge at 12000rpm / min for 10min, discard the supernatant, and then resuspend the bacteria with 50mM K2HPO4-KH2PO4 (pH 7.4) buffer, then ultrasonically disrupt, and perform SDS-PAGE electrophoresis detection. The concentration of the concentrated gel is 4%, the concentration of the separation gel is 12.5%, the sample and the loading buffer are mixed in a ratio of 3:1, and the reaction is carried out in a boiling water bath for 5min for loading electrophoresis. The initial voltage of the electrophoresis instrument is set to 120V. When the sample moves to the separation gel, the voltage is increased to 230V until the sample moves to the bottom of the electrophoresis tank and the electrophoresis is terminated. The results are as follows Figure 1 As shown, the molecular weight of MCC is 52 kDa, which is consistent with the calculated molecular weight, indicating that MCC expression was successfully induced and accounted for about 80% of the total soluble protein.
[0034] Example 3 Detection of Cytochrome P450 Monooxygenase MCC Enzyme Activity
[0035] The recombinant strain constructed in Example 1 was fermented and cultured according to the method of Example 2, and the obtained crude protein enzyme solution was used to measure the enzyme activity change using lauric acid as a substrate. The measurement method is as follows:
[0036] Definition of enzyme activity unit: One unit of enzyme activity is the amount of enzyme required to catalyze the conversion of lauric acid to 1 μmol of 12-hydroxylauric acid per minute at 30°C and pH 8.0.
[0037] Accurately weigh 20 mg of lauric acid and dissolve it in 1 mL of DMSO. Mix thoroughly to obtain a 100 mM substrate solution. Accurately pipette 10 μl of substrate solution into a reaction vessel, add 45 μl of appropriately diluted enzyme solution, and add H2O2 to a final concentration of 5 mM. Use the inactivated enzyme reaction solution as a control. Incubate at 45°C for 30 minutes, and then monitor product formation by gas chromatography.
[0038]
[0039] Example 4 Isolation and Purification of Cytochrome P450 Monooxygenase MCC
[0040] Because the N-terminus of MCC is fused with six histidine (His) tags, the nickel chloride in the Ni column can be bound to the protein containing the His tag, and can also be bound to imidazole. Therefore, nickel column is used to purify the target protein respectively. After centrifugal crushing, the bacterial liquid obtained by fermentation expression of embodiment 2 is taken and filtered through a 0.22 μm filter membrane. The nickel column is rinsed to equilibrium with a flow rate of 2 mL / min using Buffer A (50 mM Tris-HCl, pH 8.0). The protein sample is injected into the injection loop with a syringe, and the penetration peak protein of the sample is collected. The nickel column is rinsed again with Buffer A (50 mM Tris-HCl, pH 8.0) until no protein is eluted. 20% Buffer B (50 mM Tris-HCl, 500 mM imidazole, pH 8.0) gradient elution is used to elute the target protein. The protein solution obtained by nickel column purification uses a desalting column pre-installed by GE, and the Buffer containing imidazole is replaced with 50 mM Tris-HCl (pH 8.0) to remove the imidazole in the protein solution. The collected protein solution was subjected to SDS-PAGE verification. The results are shown in Figure 1 The amino acid sequencing results were consistent with SEQ ID NO: 1.
[0041] Example 5 Stability Analysis of Cytochrome P450 Monooxygenase MCC
[0042] In order to determine the optimal conditions for the catalytic reaction of MCC, the optimal temperature and temperature stability of MCC were determined. Optimum temperature: After the purified enzyme obtained in Example 4 was appropriately diluted, the substrate solution prepared in Example 3 was added and placed in a water bath at 20°C, 25°C, 30°C, 35°C, 40°C, 45°C, 50°C, 55°C, and 60°C for 30 minutes. The product formation was detected by gas chromatography, and the enzyme activity at each temperature was calculated according to the standard curve. Figure 2 As shown, the optimum temperature of MCC is 20℃.
[0043] Temperature stability: The purified enzyme obtained in Example 4 was appropriately diluted and incubated in a water bath at 20°C, 25°C, 30°C, 35°C, 40°C, 45°C, 50°C, 55°C, and 60°C for 2 hours. After the incubation, samples were taken and the remaining enzyme activity was tested according to the enzyme activity determination method in Example 3. The highest enzyme activity at 0 hour was taken as 100%, and the relative enzyme activity after incubation at each temperature was calculated to plot the change curve of the residual enzyme activity under different incubation conditions. The results are shown in Figure 2. Figure 3 As shown, after MCC was kept in the range of 20-30℃ for 2h, the original enzyme activity lost little and retained 80% of the enzyme activity.
[0044] Example 6 Hydroxylation of Fatty Acids of Different Chain Lengths by Cytochrome P450 Monooxygenase MCC
[0045] To explore the differences in the catalytic activity of MCC towards fatty acids of different chain lengths, this example selected seven saturated fatty acids: Hexanoic acid (C6), Octanoic acid (C8), Decanoic acid (C10), Dodecanoic acid (C12), Myristic acid (C14), Palmitic acid (C16), and octadecanoic acid (C18) as substrates for catalytic reactions. The reaction system contained 2 mM substrate (100 mM substrate dissolved in DMSO), 0.5 mg / mL purified MCC enzyme solution, and H2O2 was added to a final concentration of 5 mM to activate the enzyme reaction. The reaction was carried out at 30°C and 1000 rpm for 2 h, and an inactivated enzyme was set as a blank control. After the reaction, the product concentration was determined by gas chromatography (GC). The GC analysis conditions were as follows: the chromatographic column was an HP-5 capillary column (30 m × 0.320 mm id × 0.25 μm), and the detector was a hydrogen flame ionization detector (FID).
[0046] Experimental results ( Figure 4-8 ) showed that MCC was capable of catalyzing the hydroxylation of fatty acids with varying carbon chain lengths, ranging from C8 to C16. Comparison with standards and GC-MS spectral analysis confirmed that MCC specifically catalyzed the terminal (ω-position) hydroxylation of these fatty acids. The highest catalytic efficiency was achieved for C10 fatty acids (Table 1), demonstrating a clear dependence on substrate chain length. This result provides important insights for further investigation of MCC's substrate specificity and catalytic mechanism.
[0047] In addition, referring to the method disclosed in Chem. Commun., 2012, 48, 5115-5117, the catalytic performance of MCC in the NADPH-redox chaperone system for the conversion of lauric acid to dodecanoic acid (C12) was further evaluated. Figure 9 As shown, the results showed that 12-Hydroxydodecanoic acid could not be detected in this system.
[0048] Output calculation formula:
[0049]
[0050] A(mesh): target peak area
[0051] A(in): internal standard peak area
[0052] k: slope
[0053] C: Target concentration
[0054] b: intercept
[0055] Table 1 Production of fatty acids with different chain lengths catalyzed by cytochrome P450 monooxygenase MCC
[0056]
Claims
1. A cytochrome P450 monooxygenase, characterized in that The amino acid sequence is shown in SEQ ID NO:
1.
2. A DNA molecule encoding the cytochrome P450 monooxygenase according to claim 1.
3. The DNA molecule according to claim 2, characterized in that The nucleotide sequence is shown in SEQ ID NO:
2.
4. An expression vector for cytochrome P450 monooxygenase, expressing the cytochrome P450 monooxygenase according to claim 1.
5. The expression vector according to claim 4, characterized in that The vector is a plasmid, a phage, a virus or a host cell.
6. The expression vector according to claim 5, characterized in that The host cell is a prokaryotic cell or a eukaryotic cell.
7. The expression vector according to claim 6, characterized in that The host cell is selected from Escherichia coli, yeast, Bacillus, Lactobacillus, Aspergillus or Trichoderma.
8. Use of the cytochrome P450 monooxygenase according to claim 1, the DNA molecule according to claim 2 or 3, or the expression vector according to any one of claims 4 to 7 in catalyzing the synthesis of ω-hydroxy fatty acids.
9. The use according to claim 8, characterized in that The cytochrome P450 monooxygenase utilizes H2O2 to catalyze the oxidation of the ω end of a medium-chain fatty acid to generate a hydroxyl group, and the medium-chain fatty acid is a saturated fatty acid of C8 to C16.
Citation Information
Cited By
Thermostable high-enzyme-activity P450 monooxygenase mutant and application thereof
CN121343938A
Cytochrome p450 enzyme cyp153d40 and use thereof
CN122484064A