Oligonucleotide blockers for protein detection systems and methods for reducing background in ortho-reaction-based ultrasensitive protein detection systems
By designing oligonucleotide blockers to occupy the extension sites of free antibody-probe conjugates, the background noise problem in the PEA system was solved, achieving efficient reduction of background signal, improving detection sensitivity and specificity, and making it suitable for ultrasensitive protein detection.
Patent Information
- Application Number
- CN202510957038.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-07-11
- Publication Date
- 2025-10-31
- Estimated Expiration
- 2045-07-11
AI Technical Summary
In existing ortho-extension reaction (PEA) systems, non-specific extension between free antibody-probe conjugates leads to background noise issues. Existing strategies such as washing or blocking agents are either inefficient or lack site specificity, making it difficult to effectively reduce background signals.
Design an oligonucleotide blocker comprising a core blocking sequence and a supporting sequence. The core blocking sequence is complementary to the probe extension site, while the supporting sequence is not complementary. This blocker is used to occupy the extension site of the targetless free antibody-probe conjugate, competitively replacing non-specific binding and reducing background signal.
Without relying on enzymes or washing steps, it significantly reduces the background signal of the ortho-extension method, improves detection sensitivity and specificity, and is suitable for high-throughput, ultrasensitive protein detection.
Smart Images

Figure CN120442620B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biotechnology, specifically relating to oligonucleotide blockers for protein detection systems and methods for reducing background in ultrasensitive protein detection systems based on ortho-reactions. Background Technology
[0002] Protein detection technology plays a crucial role in biomedical research and clinical diagnosis, particularly in the early screening, disease monitoring, and efficacy evaluation of major diseases. Detection sensitivity directly determines the depth and accuracy of its application. Traditional detection techniques, such as ELISA (enzyme-linked immunosorbent assay) and chemiluminescence, while possessing some quantitative capabilities, typically have detection limits at the pM level, failing to meet the need for accurate detection of low-abundance protein biomarkers in plasma at fg / mL or even ag / mL levels. With the continuous advancement of precision medicine and early intervention, developing protein detection methods with higher sensitivity, smaller sample requirements, and faster response times has become a shared demand in both clinical and research settings.
[0003] In recent years, ultrasensitive detection technologies have emerged, such as Quanterix's single-molecule immunoassay (Simoa), which has detection limits down to the fM or even aM level and sensitivity 100 to 1000 times higher than traditional techniques. This allows for the detection and analysis of protein biomarkers with extremely low abundance in plasma. However, methods based on the Simoa technology platform involve multiple cleaning steps, require sophisticated chips, and expensive instruments, resulting in high detection costs and making them unsuitable for large-scale clinical diagnostics.
[0004] Besides the Simoa technology platform, other rapidly developing protein detection technologies based on proximity reactions, such as the Proximity Ligation Assay (PLA) and Proximity Extension Assay (PEA), can also achieve ultrasensitive plasma protein detection. They offer advantages such as wash-free processing and compatibility with qPCR, making them suitable for rapid detection and integration into automated platforms. Both PLA and PEA are homogeneous systems that rely on dual antibodies to recognize the target and trigger nucleic acid signal amplification, but their enzymatic reaction mechanisms differ fundamentally. PLA relies on DNA ligase for nucleic acid ligation, and its reaction efficiency is often inhibited by interfering substances in complex samples such as plasma. PEA, on the other hand, uses DNA polymerase instead of ligase, improving reaction efficiency and making it widely applicable to liquid environments such as plasma. However, both PLA and PEA suffer from background noise issues caused by non-specific binding of free probes.
[0005] To reduce background signal in adjacent reaction systems, two strategies exist: one is to use solid-phase PLA washing to reduce background, and the other is to block non-specific proteins in the sample. For example, patent CN117431300A proposes a method to improve detection sensitivity by blocking hybridization sites between probes and capture probes, supplemented by washing. However, this method introduces multiple washing operations, undermining the inherent advantages of PLA's wash-free and rapid detection capabilities. Patent CN103154266B discloses a protein-nucleic acid conjugate blocking agent that prevents false-positive signal amplification by binding to non-target proteins in the sample. While these strategies alleviate background noise to some extent, the former relies on a solid-phase system and physical washing, while the latter lacks site specificity; neither is suitable for background control caused by non-specific extension between free antibody-probe conjugates. Summary of the Invention
[0006] To address the background noise issue caused by non-specific extension between free antibody-probe conjugates in the ortho-extension reaction (PEA) system, this invention provides an inhibitor based on short-chain oligonucleotide design. This inhibitor can specifically occupy a pair of probe extension sites, achieving effective background control in a liquid-phase system that does not rely on washing.
[0007] To achieve the above-mentioned objectives, the technical solution of the present invention is as follows:
[0008] The oligonucleotide blocking agent used in the protein detection system includes at least one pair of oligonucleotide sequences, each oligonucleotide sequence including a core blocking sequence and support sequences located at the 5' end and 3' end of the core blocking sequence, respectively, and only the core blocking sequence is partially or completely complementary to the extension site in the probe.
[0009] This invention designs a universally applicable oligonucleotide single-chain oligonucleotide blocking agent structure by analyzing the nucleic acid sequence of the extension site in antibody-probe conjugates used in the adjacent extension method. The single chain of this oligonucleotide blocking agent has a core blocking sequence that is partially or completely complementary to the probe and a support sequence that is completely non-complementary to the probe. The core blocking sequence occupies the extension site of untargeted free antibody-probe conjugates, preventing them from binding and extending, thereby reducing the background of the PEA system (while the affinity between a pair of antibody-probe conjugates that have captured the target is stronger than the affinity between the oligonucleotide blocking agent and the antibody-probe conjugate, thus the oligonucleotide blocking agent is competitively displaced, exposing the extension site). The support sequence effectively prevents the formation of secondary structures in the core region and alleviates the decrease in pairing efficiency caused by spatial conformational stress, thereby enhancing the structural stability and functional persistence of the blocking agent.
[0010] In the oligonucleotide blocker of this invention, the core blocking sequence is designed based on the nucleotide sequence of the probe used. The nucleotide sequence of the probe is universal in the PEA system and does not change due to different target analytes. Therefore, it can be considered that this invention does not impose any restrictions on the specific nucleotide sequence of the core blocking sequence; it only needs to be designed according to the conditions defined in this invention and based on the selected probe sequence.
[0011] Preferably, in the above-mentioned oligonucleotide blockers, the core blocking sequence has 10 or fewer nucleotides.
[0012] In two oligonucleotide sequences belonging to the same pair, the lengths of the two core blocking sequences can be the same or different, and it is preferable to control the length to less than 10 nucleotides. Experiments have shown that when the length of the core blocking sequence is too large, not only does the blocking effect decrease, but the synthesis cost also increases.
[0013] Preferably, in the above-mentioned oligonucleotide blocking agents, there are at least 4 consecutive complementary bases between the core blocking sequence and the extension site of the probe; that is, there are 4-10 consecutive complementary bases between the core blocking sequence and the extension site of the probe.
[0014] However, in two oligonucleotide sequences belonging to the same pair, the two core blocking sequences can be independently partially or completely complementary to the extension site of the probe, and this invention does not have any special requirements in this regard. In a more preferred case, making the core blocking sequence of at least one oligonucleotide sequence completely complementary to the extension site in the probe will result in better blocking effect.
[0015] Preferably, in the above-mentioned oligonucleotide blocking agents, in the two oligonucleotide sequences belonging to the same pair, there are at least 4 consecutive complementary bases between the two core blocking sequences, and the number of consecutive complementary bases between the two core blocking sequences is less than the number of consecutive complementary bases between the core blocking sequence and the extension site of the probe; more preferably, there are 4-6 consecutive complementary bases between the two core blocking sequences.
[0016] The number of complementary bases between core blocking sequences is usually less than the number of complementary bases between the core blocking sequence and the probe. On the one hand, this reduces the possibility of complementarity between oligonucleotide blockers, and on the other hand, it ensures that the core blocking sequence preferentially binds to the extension site of the probe.
[0017] Preferably, in the above-mentioned oligonucleotide blockers, the supporting sequence has at least 3-6 consecutive T bases.
[0018] This invention also provides a method for reducing the background of ultrasensitive protein detection systems based on ortho-reactions, the method comprising:
[0019] (1) Incubate the above oligonucleotide blocking agent with the antibody-probe conjugate and the sample to be analyzed together;
[0020] (2) Add the extension solution, mix well, and then carry out the extension reaction;
[0021] (3) Continue to add qPCR system, mix well and carry out qPCR reaction, and analyze qPCR detection results.
[0022] As can be seen, the oligonucleotide blocker of the present invention is very easy to use and can effectively reduce the background signal of the ortho-extension method analysis system without relying on specific enzymes or additional washing steps, thereby improving the sensitivity and specificity of detection. It provides a new solution for high-throughput, ultrasensitive protein detection and is suitable for analyzing a wide range of samples.
[0023] Preferably, in step (1) of the above method, the concentration ratio of the oligonucleotide blocker to the antibody-probe conjugate is (100-2000): 1; the working concentration of the antibody-probe conjugate is 100-500 pM.
[0024] In step (1), incubate at 37°C for 10-20 min.
[0025] In step (1) of the above method, the antibody-probe conjugate can be prepared using any existing or unknown method. This invention does not require this. As an example of a specific implementation, it can be prepared using the following method:
[0026] (a) The antibody was activated using TCO-PEG4-NHS reagent to obtain activated antibody;
[0027] (b) The amino-modified probe was activated using Tz-PEG4-NHS reagent to obtain the activated probe;
[0028] (c) The activated antibody and the activated probe are coupled together to obtain the antibody-probe conjugate. Preferably, in step (2) of the above application, the extension solution consists of: 4 μL 10× buffer, 4 μL 100 μM equimolar mixture of four deoxynucleotide triphosphates, 2 μL 8000U / mL Bst extension enzyme, and 26 μL deionized water;
[0029] The extension reaction procedure is as follows: 37℃ extension for 20 min, 80℃ inactivation for 20 min;
[0030] In step (3), the qPCR system consists of: 0.4 μL each of the qPCR detection primers, 0.2 μL of 6-carboxyfluorescein, 10 μL of a commercial qPCR mixture containing fluorescent dye and polymerase, and 5 μL of deionized water.
[0031] Compared with the prior art, the beneficial effects of the present invention are reflected in:
[0032] (1) This invention designs a novel oligonucleotide blocker in the form of a single-chain oligonucleotide by analyzing the nucleic acid sequence of the extension site in the antibody-probe conjugate used in the adjacent extension method. The single chain of the oligonucleotide blocker has a core blocking sequence that is partially or completely complementary to the probe and a support sequence that is not complementary to the probe. The core blocking sequence can occupy the extension site of the targetless free antibody-probe conjugate, so that the targetless free antibody-probe conjugate cannot bind to each other for extension, thereby reducing the non-specific background of the PEA system (the affinity between a pair of antibody-probe conjugates that capture the target is stronger than the affinity between the oligonucleotide blocker and the antibody-probe conjugate, so the oligonucleotide blocker will be competitively displaced, exposing the extension site); while the support sequence can not only prevent the core blocking sequence from forming a secondary structure itself, but also prevent the decrease in nucleic acid pairing efficiency caused by spatial distortion or rigid tension, thus stabilizing the blocking effect of the oligonucleotide blocker.
[0033] (2) The oligonucleotide blocker of the present invention is very easy to use and can effectively reduce the background signal of the ortho-extension method analysis system without relying on specific enzymes or additional washing steps, thereby improving the sensitivity and specificity of detection. It provides a new solution for high-throughput and ultrasensitive protein detection and is suitable for analyzing a wide range of samples.
[0034] (3) When the oligonucleotide blocking agent of the present invention is used for protein detection by the ortho-extension method, the signal of the target protein can be enhanced by more than 2.5 times. Attached Figure Description
[0035] Figure 1 This is a schematic diagram illustrating the working principle of the oligonucleotide blocker of the present invention;
[0036] Where Cycles represents the cycle number, Fluorescence represents the fluorescence signal, Negative represents negative, Threshold represents the critical value, and Positive represents positive.
[0037] Figure 2 The blocking effect of different concentrations of the oligonucleotide inhibitors of the present invention on IL-6 was analyzed by the ortho-extension method.
[0038] Wherein, Concentration refers to IL-6 concentration, and the same applies below;
[0039] Figure 3 To illustrate the blocking effect of the oligonucleotide blockers of the present invention with different nucleotide sequences on IL-6 using the adjacent extension method;
[0040] Figure 4 To illustrate the blocking effect of the oligonucleotide blocker of the present invention on IL-6 using the ortho-extension method at different antibody-probe conjugate concentrations;
[0041] Figure 5 The blocking effect of the oligonucleotide inhibitor of the present invention on PSA analysis by the ortho-extension method;
[0042] Figure 6 This invention demonstrates the blocking effect of oligonucleotide inhibitors on IL-17 using the ortho-extension method. Detailed Implementation
[0043] The technical solution of the present invention will be further described in detail below with reference to the accompanying drawings and embodiments.
[0044] Examples 1-7: Design of Oligonucleotide Blockers
[0045] An embodiment of the present invention proposes an oligonucleotide blocking agent comprising at least one pair of oligonucleotide sequences, each oligonucleotide sequence consisting of a core blocking sequence and support sequences located at the 5' end and 3' end of the core blocking sequence, wherein only the core blocking sequence is partially or completely complementary to the extension site of the probe, while the support sequence is not complementary to the extension site of the probe.
[0046] The core blocking sequence consists of 10 or fewer nucleotides, and each core blocking sequence has at least 4 consecutive complementary bases with the extension site in the probe.
[0047] In two oligonucleotide sequences that belong to the same pair, there are 4-6 consecutive complementary bases between the two core blocking sequences.
[0048] The supporting sequence consists of 3-6 consecutive T bases.
[0049] To illustrate the specific performance of this oligonucleotide blocker, embodiments of the present invention, while adhering to the above principles, designed several pairs of oligonucleotide blockers based on the following probes:
[0050] Probe-1: 5'-GTGAGGCCAGCGTCTTTTATATTAGGCCCTGGTATAGCAGACTGAAA-3' (SEQ IDNo. 1);
[0051] Probe-2: 5'-CGCAATGTCGCACATGATTCTCTGACGAACCGCTTTGCCTGATTTCAGTCT-3' (SEQ ID No. 2).
[0052] The nucleotide sequences of each oligonucleotide blocker are shown in Table 1.
[0053] Table 1. Nucleotide sequences of each oligonucleotide blocker
[0054] F(5’→ 3’) R(5’→ 3’) Oligonucleotide blocker 1 <![CDATA[TTT SAC CAGT AC TTT(SEQ ID No.3)]]> <![CDATA[TTT AGACTGAAA TTT(SEQ ID No.4)]]> Oligonucleotide blocker 2 <![CDATA[TTT AAA CAGTCT TTT(SEQ ID No.5)]]> <![CDATA[TTTTT AGACTGAAA T TTTT(SEQ ID No.6)]]> Oligonucleotide blocker 3 <![CDATA[TTT AA TCAGTCT TTT(SEQ ID No.7)]]> <![CDATA[TTTTT AGACTGAAAT TTTTT(SEQ ID No.8)]]> Oligonucleotide blocker 4 <![CDATA[TTT TTTCAGTCT TTT(SEQ ID No.9)]]> <![CDATA[TTTTTT AGACTGAAAT TTTTT(SEQ ID No.10)]]> Oligonucleotide blocker 5 <![CDATA[TTT TTTCAGTCT G TTT(SEQ ID No.11)]]> <![CDATA[TTT AGACTGAAA TTT(SEQ ID No.12)]]> Oligonucleotide blocker 6 <![CDATA[TTT TTTCAGTCT GCT TTT(SEQ ID No.13)]]> <![CDATA[TTT AGACTGAAA TTT(SEQ ID No.14)]]> Oligonucleotide blocker 7 <![CDATA[TTT TTTCAGTCT GCTAT TTT(SEQ ID No.15)]]> <![CDATA[TTT AGACTGAAA TTT(EQ ID No.16)]]>
[0055] Note: The underlined and bolded parts indicate the core blocking sequence, and the italicized parts are bases complementary to the probe extension site.
[0056] The working principle of the oligonucleotide blocker in this embodiment is as follows: Figure 1 As shown, the core blocking sequence of the oligonucleotide blocker first binds to the probe extension site on the antibody-probe conjugate. When the sample to be analyzed is added, the antibody portion of the antibody-probe conjugate binds to the target. At this point, the affinity between the pair of antibody-probe conjugates that have captured the target is stronger than the affinity between the oligonucleotide blocker and the antibody-probe conjugate. Therefore, the oligonucleotide blocker is competitively displaced, exposing the extension site. After the two bind, the extension generates a signal. Meanwhile, the extension site of the free antibody-probe conjugate that has not captured the target remains occupied by the oligonucleotide blocker. This prevents the free antibody-probe conjugate without the target from binding and extending, thereby reducing the background noise of the PEA system.
[0057] Examples 8-11: Analysis of the blocking effect of oligonucleotide blocker 1 on IL-6.
[0058] This embodiment provides a method for reducing the background of ultrasensitive protein detection based on ortho-reaction, the method comprising the following steps:
[0059] (1) Incubate oligonucleotide blocking agent 1 with antibody-probe conjugate and the sample to be analyzed together;
[0060] The antibody-probe conjugate can be prepared using the following method:
[0061] (a) The antibody was activated using TCO-PEG4-NHS reagent to obtain activated antibody;
[0062] Specifically, the desalted column that meets the quality requirements of the target antibody is first centrifuged to remove the storage buffer, and then centrifuged three times with 0.1M NaHCO3+ PBS. After centrifugation, 10 µg of antibody (OriGene D624, D623) is added to the filter column and centrifuged. 1 / 10 of the amount of the antibody substance of the coupling agent TCO-PEG4-NHS is added to the filtrate and reacted at room temperature in the dark for 25 min to obtain reaction solution A.
[0063] Then, the desalting column that meets the antibody quality requirements is centrifuged to remove the storage buffer, and then centrifuged three times with PBS buffer; the reaction solution A is desalted using the desalting column to remove excess TCO-PEG4-NHS and obtain activated antibody.
[0064] (b) The amino-modified probe was activated using Tz-PEG4-NHS reagent to obtain the activated probe;
[0065] Specifically, the desalting column that meets the probe quality requirements is first centrifuged to remove the storage buffer, and then replaced three times with borate buffer (0.1 mol / L pH=8.5) by centrifugation; 10 μL of NH2-modified DNA is placed on the filter column, centrifuged, and 1 / 20 of the amount of Tz-PEG4-NHS is added. The reaction is carried out at room temperature in the dark for 25 min to obtain reaction solution B.
[0066] Then, the desalting column that meets the probe quality requirements is centrifuged to remove the storage buffer, and then PBS buffer is centrifuged three times to replace it; the reaction solution B is desalted using the same desalting column to remove excess Tz-PEG4-NHS and obtain the activated probe.
[0067] (c) The activated antibody and the activated probe are coupled together to obtain the antibody-probe conjugate;
[0068] Specifically, the desalted activated antibody and activated probe are mixed evenly in a 1:1 ratio and reacted at room temperature in the dark for 45 minutes to obtain the antibody-probe conjugate.
[0069] In this step, the antibody-probe conjugate was diluted to a concentration of 500 pM with PEA Buffer for later use; then, the oligonucleotide blocking agent and the antibody-probe conjugate were mixed at ratios of 100:1, 300:1, 500:1, 800:1, 1000:1, 1500:1, and 2000:1, respectively, and the sample to be analyzed was added (IL-6 concentrations of 1000, 200, 40, 8, 1.6, 0.32, 0.064, and 0 pg / mL), and incubated at 37°C for 15 min.
[0070] (2) Add the extension solution, mix well, and then carry out the extension reaction;
[0071] In this embodiment, the extension solution consists of: 4 μL 10× buffer, 4 μL A / T / C / GTP, 2 μL 8000U / mL Bst extension enzyme, and 26 μL deionized water.
[0072] After mixing the extension solution with the incubation solution, place it in a PCR instrument for the extension reaction. The extension reaction procedure is as follows: 37℃ extension for 20 min, 80℃ inactivation for 20 min.
[0073] (3) Continue to add to the qPCR system, mix well, perform qPCR reaction, and analyze the qPCR detection results;
[0074] In this embodiment, the qPCR system consists of: 0.4 μL each of qPCR detection primers, 0.2 μL FAM, 10 μL MixBuffer, and 5 μL deionized water.
[0075] The qPCR detection primers include:
[0076] Upstream primer: GTGAGGCCAGCGTCTTTTATATTA (SEQ ID No. 17);
[0077] Downstream primer: CAATGTCGCACATGATTCT (SEQ ID No. 18);
[0078] The qPCR reaction procedure is shown in Table 2:
[0079] Table 2 qPCR reaction procedure
[0080]
[0081] After the qPCR reaction, CT values under different conditions were compared to evaluate the inhibitory effect of oligonucleotide blockers on PEA nonspecific background signals. The results are shown in Table 1 and 2. Figure 2 .
[0082] Table 3. Blocking effect of different concentrations of oligonucleotide blocker 1 on IL-6 in ortho-extension assay.
[0083]
[0084] Note: The multiple refers to the concentration multiple of the oligonucleotide blocker relative to the antibody-probe conjugate. ΔCT represents the difference between a 1000 pg / mL concentration and a blank background of 0 pg / mL in quantitative detection cycles, which represents the signal intensity of the detection.
[0085] From Table 3 and Figure 2 The results show that the ΔCT value without oligonucleotide blockers was 8.51, while the ΔCT values with 100-fold, 300-fold, 600-fold, 800-fold, 1000-fold, 1500-fold, and 2000-fold oligonucleotide blockers were 9.64, 9.97, 10.15, 9.86, 10.29, 9.78, and 9.58, respectively. This means that due to the blocking effect of the oligonucleotide blockers, the background CT of ultrasensitive protein detection was reduced, resulting in an increase in the signal of the target analyte IL-6 by 2.19-fold, 2.75-fold, 3.11-fold, 2.55-fold, 3.43-fold, 2.41-fold, and 2.10-fold, respectively.
[0086] Furthermore, from Table 2 and Figure 2 The results also show that an appropriate fold increase in oligonucleotide blocking agent is beneficial to further improve the blocking efficiency. At 300-1000-fold, the signal enhancement of the target analyte is more significant.
[0087] Examples 12-17: Analysis of the blocking effects of different oligonucleotide inhibitors on IL-6.
[0088] This embodiment presents a protein detection method based on the adjacent extension method, which is basically the same as that in Embodiment 5, except that the oligonucleotide blocking agents used are, in order: oligonucleotide blocking agent 2, oligonucleotide blocking agent 3, oligonucleotide blocking agent 4, oligonucleotide blocking agent 5, oligonucleotide blocking agent 6, and oligonucleotide blocking agent 7.
[0089] Meanwhile, the cases of oligonucleotide blocker 1 and no oligonucleotide blocker were set up again for comparison.
[0090] The concentration ratio of each oligonucleotide blocker to antibody-probe conjugate was 1000:1.
[0091] The blocking effects of each oligonucleotide blocker are shown in Table 4 and Figure 3 .
[0092] Table 4. Blocking efficacy of different oligonucleotide inhibitors in IL-6 by ortho-extension assay
[0093]
[0094] From Table 4 and Figure 3 As can be seen, the ΔCT value without oligonucleotide blockers was 8.77, while the ΔCT values with oligonucleotide blockers 1, 2, 3, and 4 were 10.08, 10.19, 10.22, and 10.25, respectively. Due to the blocking effect of the oligonucleotide blockers, the background CT of ultrasensitive protein detection was reduced, resulting in an increase in the signal of the target analyte IL-6 by 4.60 times, 4.96 times, 5.06 times, and 5.17 times, respectively.
[0095] However, when oligonucleotide blockers 5, 6, and 7 were added, the ΔCT values were 9.83, 9.20, and 9.04, respectively, and the signal of the target analyte IL-6 was enhanced by 2.08 times, 1.34 times, and 1.21 times, respectively.
[0096] Examples 18-20: Effects of different ratios of oligonucleotide blockers to antibody-probe conjugates on blocking efficacy
[0097] This embodiment presents a protein detection method based on the adjacent extension method, which is basically the same as that in Example 5, except that the concentrations of the antibody-probe conjugates are 100 pM, 200 pM, and 400 pM respectively; and the ratio of oligonucleotide blocker 1 to antibody-probe conjugate is 1000:1.
[0098] Meanwhile, a case was set up with the antibody-probe conjugate concentration at 500 pM for comparison.
[0099] The blocking results are shown in Table 5 and Figure 4 As shown.
[0100] Table 5. Effect of probe concentration on blocking efficacy
[0101]
[0102] From Table 5 and Figure 4 It can be seen that the signal intensity of IL-6 varies by 1.09-1.93 times at different antibody-probe conjugate concentrations, with the best blocking effect when the concentration of antibody-probe conjugate is 100pM.
[0103] Example 21: The blocking effect of oligonucleotide blocker 1 when analyzing PSA.
[0104] This embodiment presents a protein detection method based on the adjacent extension method. This method is basically the same as that in Example 5, except that: the target analyte is PSA, the concentration of the antibody-probe conjugate is 200 pM, and the concentration ratio of oligonucleotide blocker 1 to antibody-probe conjugate is 1000:1.
[0105] The analysis results are shown in Table 6 and Figure 5 .
[0106] Table 6. Blocking effect of oligonucleotide blocker 1 in PSA analysis by ortho-extension assay.
[0107]
[0108] From Table 6 and Figure 5 As can be seen, compared with the absence of oligonucleotide blocker, the addition of oligonucleotide blocker 1 enhanced the PSA signal by 2.08 times.
[0109] Example 22: Analysis of the blocking effect of oligonucleotide blocker 1 on IL-17.
[0110] This embodiment presents a protein detection method based on the adjacent extension method. This method is basically the same as that in Example 5, except that the target analyte is IL-17, the concentration of the antibody-probe conjugate is 100 pM, and the concentration ratio of oligonucleotide blocker 1 to antibody-probe conjugate is 1000:1.
[0111] The analysis results are shown in Table 7 and Figure 6 .
[0112] Table 7. Blocking efficacy of oligonucleotide blocker 1 in IL-17 as analyzed by ortho-extension assay.
[0113]
[0114] From Table 7 and Figure 6 As can be seen, compared with the absence of oligonucleotide blockers, the addition of oligonucleotide blocker 1 enhanced the signal of IL-17 by 2.68 times.
Claims
1. An oligonucleotide blocker for use in protein detection systems, comprising at least one pair of oligonucleotide sequences, characterized in that, Each oligonucleotide sequence includes a core blocking sequence and support sequences located at the 5' and 3' ends of the core blocking sequence, respectively. Only the core blocking sequence is partially or completely complementary to the extension site of the nucleic acid portion of the antibody-probe conjugate. The core blocking sequence consists of 10 or fewer nucleotides. The core blocking sequence has at least four consecutive complementary bases with the extension site of the nucleic acid portion of the antibody-probe conjugate; In two oligonucleotide sequences belonging to the same pair, there are at least 4 consecutive complementary bases between the two core blocking sequences, and the number of consecutive complementary bases between the two core blocking sequences is less than the number of consecutive complementary bases between the core blocking sequence and the extension site of the nucleic acid part of the antibody-probe conjugate. The supporting sequence consists of 3-6 consecutive T bases.
2. The oligonucleotide blocker as described in claim 1, characterized in that, In two oligonucleotide sequences belonging to the same pair, at least one oligonucleotide sequence has a core blocking sequence that is completely complementary to the extension site of the nucleic acid portion of the antibody-probe conjugate.
3. The oligonucleotide blocker as described in claim 1, characterized in that, In two oligonucleotide sequences belonging to the same pair, there are 4-6 consecutive complementary bases between the two core blocking sequences.
4. A method for reducing background in ultrasensitive protein detection systems based on ortho-reactions, characterized in that, include: (1) Incubate the oligonucleotide blocking agent as described in any one of claims 1-3 with the antibody-probe conjugate and the sample to be analyzed; (2) Add the extension solution, mix well, and then carry out the extension reaction; (3) Continue to add qPCR system, mix well and carry out qPCR reaction, and analyze qPCR detection results.
5. The method as described in claim 4, characterized in that, In step (1), the concentration ratio of the oligonucleotide blocker to the antibody-probe conjugate is (100-2000): 1; the working concentration of the antibody-probe conjugate is 100-500 pM. In step (1), incubate at 37°C for 10-20 min.
6. The method as described in claim 4, characterized in that, In step (2), the extension solution consists of: 4 μL 10× buffer, 4 μL 100 μM equimolar mixture of four deoxynucleotide triphosphates, 2 μL 8000U / mL Bst extension enzyme, and 26 μL deionized water. The extension reaction procedure is as follows: 37℃ extension for 20 min, 80℃ inactivation for 20 min; In step (3), the qPCR system consists of: 0.4 μL each of the qPCR detection primers, 0.2 μL of 6-carboxyfluorescein, 10 μL of a commercial qPCR mixture containing fluorescent dye and polymerase, and 5 μL of deionized water.
Citation Information
Patent Citations
Blocking reagents and their usage
CN103154266B
Blocking reagent and methods for the use thereof
CN103154266A
Kits for detecting one or more target analytes in a sample and methods of making and using the same
US20240368676A1
Padlock blocking oligonucleotide
WO2024062116A1