PegRNA of specific targeting PMEL gene, pilot editing system and application
By designing a pegRNA and PE pilot editing system that specifically targets PMEL genes, targeted editing of PMEL genes is realized, solving the problems of PMEL gene editing in the existing technology, improving gene editing efficiency and heat stress resistance, and supporting the breeding of light-haired transgenic cattle.
Patent Information
- Application Number
- CN202510941611.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-07-09
- Publication Date
- 2025-08-08
- Estimated Expiration
- Not applicable · inactive patent
AI Technical Summary
The existing technology lacks pegRNA and its pilot editing system that specifically targets PMEL genes, making it difficult to accurately edit the PMEL gene, affecting the breeding and heat stress resistance of light-colored transgenic cattle.
A pegRNA specifically targeting the PMEL gene was designed and constructed. Combined with a PE pilot editing system, the combination of Cas9 nickase and pegRNA was used to achieve targeted editing of the PMEL gene, reduce the mRNA and protein expression, and achieve targeted knockout of the PMEL gene.
The gene editing efficiency of 16% of the PMEL gene was achieved, the mRNA and protein expression of positive cloned cell lines was reduced, technical support was provided for the breeding of light-colored transgenic cattle, and the anti-thermal stress ability was improved.
Smart Images

Figure CN120442631A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the field of gene editing technology, and more specifically to a pegRNA specifically targeting the PMEL gene, a lead editing system and applications. Background Art
[0002] Coat color is an important economic trait. In animals, coat color and its pigmentation pattern play a crucial role in survival and reproduction, predator avoidance, interspecies recognition, protection from ultraviolet radiation, and skin cancer. Research has shown that coat color is a crucial phenotype and a key genetic marker. Melanin production in animals is determined by the interaction of multiple genes and environmental factors, regulated by multiple transcription factors. Eumelanin and pheomelanin are produced, and the ratio of these two pigments determines coat color in mammals. Excessive eumelanin generally results in brown and black, while excessive pheomelanin results in yellow and reddish-brown. Compared to lighter colors, melanin absorbs more solar radiation, which is a contributing factor to heat stress in cattle. Under specific temperature and humidity conditions, when the heat transferred to beef cattle exceeds their ability to dissipate heat, varying degrees of heat stress may occur. Cattle may experience heat stress when the temperature in the rearing environment exceeds 20°C. With every 1°C increase in perceived temperature, animals' feed intake decreases by 3-5%, leading to severe impairments in breathing, feeding, and reproduction. Heat stress costs the global beef industry over $500 million annually. Exposure to increased radiant heat reduces the ability of dark-coated cattle to regulate their body temperature, negatively impacting their reproductive performance. Lightening coat coloration should help mitigate these effects.
[0003] The premelanosome protein gene (PMEL) is a key coat color regulatory gene, crucially influencing the synthesis and deposition of melanin in mammals. It directly initiates the formation of fibers within the melanin tract and promotes melanosome synthesis. Inhibition, disruption, or deletion of the PMEL gene results in reduced melanin content in hair fibers, indicating a crucial role for epidermal pigment deposition and considerable potential for development and application. PMEL mutations have been shown to be associated with a color dilution effect across various species.
[0004] Prime editing (PE) is a next-generation gene editing technology, following CRISPR / Cas9. It can achieve precise base substitutions and fragment editing without requiring double-strand breaks in DNA, thus demonstrating enormous potential for application. PE consists of the Cas9 nickase (with the H840A mutation) fused to the reverse transcriptase domain and a guide RNA (pegRNA). The pegRNA comprises a spacer sequence and a 3' extension. The spacer is complementary to the target DNA and guides the complex to the editing site. The 3' extension contains two key regions: a primer binding site (PBS), which is complementary to the exposed single-stranded DNA after cleavage and initiates reverse transcription; and a reverse transcription template (RT), which encodes the desired editing sequence (e.g., point mutation, insertion, or deletion) and guides RT synthesis of the new DNA strand. Guided by the pegRNA, the H840A nCas9 cleaves the non-target strand, revealing a 3' hydroxyl group. The reverse transcriptase then edits the target site through the pegRNA sequence. However, there are currently few studies on pegRNA that specifically targets the PMEL gene and its lead editing system.
[0005] Therefore, how to provide a pegRNA, a lead editing system and its application that specifically targets the PMEL gene is a technical problem that needs to be solved urgently by those skilled in the art. Summary of the Invention
[0006] In view of this, the present invention provides a pegRNA, a lead editing system and an application that specifically targets the PMEL gene, constructs a pegRNA that specifically targets the PMEL gene, and constructs a PE lead editing system, successfully achieving targeted knockout of the PMEL gene, providing technical support for the breeding of light-haired transgenic cattle.
[0007] In order to achieve the above object, the present invention adopts the following technical solutions:
[0008] A pegRNA specifically targeting the PMEL gene, comprising an sgRNA and a 3' extension, wherein the 3' extension is composed of an RT template and a PBS:
[0009] The sequence of the sgRNA is shown in SEQ ID NO.1;
[0010] The sequence of the RT template is shown in SEQ ID NO.2;
[0011] The sequence of the PBS is shown in SEQ ID NO.3;
[0012] The sequence of the 3' extension is shown in SEQ ID NO.4.
[0013] As a preferred technical solution, the nucleotide sequence of the pegRNA is shown as SEQ ID NO.5.
[0014] Another object of the present invention is to provide: a DNA molecule encoding the above-mentioned pegRNA.
[0015] Another object of the present invention is to provide: a biomaterial, wherein the biomaterial is any one of the following:
[0016] 1) An expression cassette containing the above-mentioned DNA molecule;
[0017] 2) a recombinant vector containing the aforementioned DNA molecule, or a recombinant vector containing the expression cassette described in 1);
[0018] 3) A transgenic cell line containing the aforementioned DNA molecule, or a transgenic cell line containing the recombinant vector described in 2);
[0019] 4) A recombinant bacterium containing the aforementioned DNA molecule, or a recombinant bacterium containing the expression cassette described in 1), or a recombinant bacterium containing the recombinant vector described in 2).
[0020] Another object of the present invention is to provide: an application of the above-mentioned pegRNA, the above-mentioned DNA molecule or the above-mentioned biomaterial, wherein the application is any one of the following:
[0021] 1) Application in the specific identification and / or targeting of the premelanosome protein PMEL gene;
[0022] 2) Application in knockout of the premelanosome protein PMEL gene;
[0023] 3) Application in breeding of light-coat transgenic cattle;
[0024] 4) Application in breeding cattle for heat stress resistance;
[0025] 5) Application in the preparation of a lead editing system for editing the premelanosome protein PMEL gene.
[0026] Another object of the present invention is to provide a lead editing system comprising at least one of the following:
[0027] 1) The above-mentioned pegRNA;
[0028] 2) the above expression cassette;
[0029] 3) The above-mentioned recombinant vector.
[0030] As a preferred technical solution, the lead editing system further includes a lead editing protein.
[0031] Another object of the present invention is to provide: an application of the above-mentioned lead editing system, wherein the application is any one of the following:
[0032] 1) Application in knockout of the premelanosome protein PMEL gene;
[0033] 2) Application in breeding of light-coat transgenic cattle;
[0034] 3) Application in breeding cattle for heat stress resistance;
[0035] 4) Application in lead editing of the premelanosome protein PMEL gene.
[0036] Another object of the present invention is to provide: a lead editing method for knocking out the premelanosome protein PMEL gene, the method comprising the step of performing lead editing using the above-mentioned pegRNA, the above-mentioned DNA molecule, the above-mentioned expression cassette, the above-mentioned recombinant vector or the above-mentioned lead editing system.
[0037] It can be seen from the above technical solutions that compared with the prior art, the present invention has the following beneficial effects:
[0038] The present invention discloses a pegRNA, a lead editing system, and applications that specifically target the PMEL gene. A pegRNA was successfully designed at the pre-mutation position based on the NCBI reference sequence: NC_037332. Based on this, a PE-pegRNA expression vector and a lead editing system were constructed. Directed editing of the PMEL gene was performed at the cellular level, reducing the mRNA expression level and PMEL protein translation level of positive clone cell lines, achieving PMEL gene targeting and knockout, with a gene editing efficiency of 16%, providing technical support for PMEL gene editing. BRIEF DESCRIPTION OF THE DRAWINGS
[0039] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments or the description of the prior art. Obviously, the drawings described below are merely embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on the provided drawings without paying any creative work.
[0040] Figure 1 : The sequencing results of the PE-pegRNA expression vector in Example 2.
[0041] Figure 2 : Sequencing diagram of the wild-type cell line in PMEL gene editing in Example 3.
[0042] Figure 3: Sequencing diagram of the homozygous deletion cell line in PMEL gene editing in Example 3.
[0043] Figure 4 : Sequencing diagram of the heterozygous deletion cell line in PMEL gene editing in Example 3.
[0044] Figure 5 For: Bovine fetal fibroblasts with homozygous deletion of PMEL gene in PMEL gene editing in Example 3.
[0045] Figure 6 Figure 3: The expression of PMEL gene mRNA in the gene-edited cells of Example 3, where 1 is a PMEL homozygous deletion strain, and 2, 3, and 4 are PMEL heterozygous deletion strains.
[0046] Figure 7 : The expression of PMEL gene protein in the gene-edited cells of Example 4, where 1 is a PMEL homozygous deletion strain, and 2, 3 and 4 are PMEL heterozygous deletion strains.
[0047] Figure 8 For: PMEL knockout bovine blastocyst and gene-edited cow.
[0048] Figure 9 Figure 1: Sequencing peak map of gene-edited cattle.
[0049] Figure 10 Figure 1: TA cloning sequencing results.
[0050] Figure 11 Figure 2: PMEL mRNA expression in the skin of gene-edited cows.
[0051] Figure 12 Figure 2: PMEL protein expression in the skin of gene-edited cows. DETAILED DESCRIPTION
[0052] The following will clearly and completely describe the technical solutions in the embodiments of the present invention in conjunction with the accompanying drawings. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative efforts are within the scope of protection of the present invention.
[0053] Example 1
[0054] Design of pegRNA specifically targeting the bovine PMEL gene
[0055] The pegRNA sequence was designed near the premutation position (PMEL p.Leu18del) according to the NCBI reference sequence: NC_037332.
[0056] Among them, the sgRNA sequence (PAM: NGG), RT template and PBS sequence information are as follows:
[0057] sgRNA: CTTCTCCATGTGGCCTGAT, SEQ ID NO.1;
[0058] RT template (11 nt): GAACACCCATC, SEQ ID NO. 2;
[0059] PBS (14 nt): AGAGCCACATGGAG, SEQ ID NO.3;
[0060] Sense 3' extension: GAACACCCATCAGAGCCACATGGAG, SEQ ID NO .4;
[0061] Full-length pegRNA: 5'-CTTCTCCATGTGGCTCTGATGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCGAACACCCATCAGAGCCACATGGAG-3', SEQ IDNO.5.
[0062] Example 2
[0063] Construction of PE-pegRNA expression vector
[0064] (1) Construction of PE gene editing vector
[0065] First, using pCMV-PE2 (Addgene #132775) as a template, the Cas9 (H840A)-MMLV RT fragment was cloned. The PCR reaction system and primer sequences are as follows:
[0066] Table 1 PCR reaction system
[0067]
[0068] Primer F: 5'-agccgctagtcgacaGACAAGAAGTACAGCATCGG-3', SEQ ID NO.6;
[0069] Primer R: 5'-caaagtctgtttcacGGGTGATGAATTTTCTATGA-3', SEQ ID NO.7;
[0070] Then, pCRISPR-S12 (Addgene #84031) was used as the backbone of the gene editing vector. After being linearized by double digestion with AgeI and FseI, the Cas9 (H840A)-MMLV RT fragment was inserted using a homologous recombination kit (system as follows) to obtain a PE gene editing vector (PE-epi vector). The PE-epi vector was then double digested with NheI and XhoI to obtain a linearized PE-epi expression vector.
[0071] Table 2 Homologous recombination reaction system
[0072]
[0073] (2) Annealing of pegRNA sequence
[0074] 1.0 μL Oligo F (100 μM)
[0075] 1.0 μL Oligo R (100 μM)
[0076] 8.0 μL 1× Annealing Buffer
[0077] The above solutions were mixed in a PCR tube and the temperature was gradually decreased from 95°C to 22°C at 1.5°C per minute in a PCR instrument to prepare annealing products;
[0078] The primer sequences for Oligo F and Oligo R are as follows:
[0079] Oligo F: 5'-ctagCTTCTCCATGTGGCTCTGATGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCGAACACCCATCAGAGCCACATGGAG-3', SEQ ID NO.8;
[0080] Oligo R: 5'-tcgaCTCCATGTGGCTCTGATGGGTGTTCGCACCGACTCGGTG
[0081] CCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAACATCAGAGCCACATGGAGAAG-3', SEQ ID NO.9;
[0082] (3) pegRNA ligation
[0083] 0.5 μL annealing product
[0084] 1.0 μL linearized PE-epi expression vector
[0085] 1.0 μL T4 ligase
[0086] 2.0 μL 5×T4 Buffer
[0087] 5.5 μL HO (ultrapure water)
[0088] The above solutions were mixed in a 1.5 mL EP tube and incubated at room temperature for 30 min to prepare the ligation product;
[0089] (4) Conversion
[0090] 10 μL of ligation product was added to 50 μL of E. coli DH5α competent cells (pfu×10 8 ) for transformation. Then, the cells were plated on LB plates containing ampicillin (50 μg / mL) and incubated inverted at 37°C overnight. Single clones were amplified and sequenced for verification. The experimental results are shown in Figure 2. Figure 1 shown.
[0091] Result analysis: Through sequence alignment, it can be determined that the pegRNA was successfully linked to the PE gene editing vector, and the PE-pegRNA expression vector was obtained.
[0092] Example 3
[0093] Screening and identification of PE-PMEL gene-edited monoclonal cells
[0094] (1) Isolation and culture of bovine fetal fibroblast cell lines
[0095] Cows at 42 days of gestation were slaughtered, the placenta was removed, the afterbirth was torn open, the fetus was removed and placed in a new 100 mm cell culture dish containing 5× double-antibody DPBS, the head, limbs, tail, internal organs and cartilage tissue of the fetus were removed, and the remaining tissue was placed in a new 100 mm cell culture dish and minced;
[0096] Add 1 mL of complete culture medium, transfer the tissue fragments and culture medium to a 15 mL centrifuge tube, add 7 mL of DPBS, wait for the tissue fragments to sink, aspirate and discard the supernatant, and repeat the washing process once;
[0097] Add 10 mL of 0.25% trypsin to a 15 mL centrifuge tube, seal the tube with parafilm, and place in a 37°C water bath for 30 min. Mix every 5 min. When floccules appear, carefully pipette the supernatant cell suspension into another 15 mL centrifuge tube and centrifuge at 1500 rpm for 5 min to collect the cells. Add another 10 mL of 0.05% trypsin to the remaining tissue and repeat the above steps until the tissue is completely digested. Centrifuge at 1500 rpm for 5 min to collect the cells.
[0098] The cells obtained by centrifugation were inoculated into cell culture dishes at an appropriate density and cultured in a 37.5°C, 5% CO2 incubator. The medium was changed every two days. After the cells were fully grown, they were frozen or subcultured.
[0099] (2) Transfection of bovine fetal fibroblasts with PE-pegRNA expression vector
[0100] 24 h before transfection, subculture bovine fetal fibroblasts in DMEM + 10% FBS without antibiotics. After 24 h of subculture, discard the cell culture medium and wash twice with 2 mL of PBS. Add 1 mL of 0.05% trypsin and digest in an incubator for 2-3 min. Add 2 times the volume of culture medium to terminate digestion. Gently pipette the bottom of the culture dish to suspend the cells and collect them in a 1.5 mL centrifuge tube. Centrifuge at 1000 rpm for 5 min, resuspend the cells in PBS, and aspirate a portion for cell counting, preferably 1 × 106 cells. Wash the cells twice with Opti-MEM.
[0101] The electroporation cup was cleaned with 75% alcohol, placed in a clean bench, and irradiated with ultraviolet light for 30 min. 10 μg of PE-pegRNA expression vector was co-transfected into bovine fetal fibroblasts using the electroporation method at a voltage of 200 V and an interval of 5 ms.
[0102] After transfection, cells were immediately transferred to DMEM F12 + 15% FBS and cultured in a 37°C CO2 incubator. Forty-eight hours after transfection, monoclonal cells were selected using a BD FACSAria™ III flow cytometer. A total of 65 monoclonal cell lines were sorted and transferred to 96-well plates. When the cells reached 80%-90% confluence, they were passaged to 24-well plates and then to 6-well plates. One-third of the cells were harvested for genomic extraction upon transfer to the 6-well plates, and the remaining cells were frozen for future use. Finally, 25 surviving and well-functioning monoclonal cell lines were isolated and subsequently characterized.
[0103] (3) Identification of positive cells
[0104] A: PCR identification
[0105] Using the genomic DNA of monoclonal cells as a template, according to the principles of PCR primer design, PCR primers for site-specific integration detection were designed (Table 3) to detect whether site-specific deletions occurred in the genome.
[0106] Table 3 PCR amplification primer sequences
[0107]
[0108] The PCR amplification reaction system was as follows: 50 μL, Green Taq 25 μL, template DNA 1 μL, forward primer 2 μL, reverse primer 2 μL, and sterile water 20 μL;
[0109] The PCR amplification reaction program was as follows: 95°C for 3 min, 35 cycles of (95°C for 15 s, 55°C for 15 s, and 72°C for 15 s), 72°C for 5 min, and 4°C ∞;
[0110] The PCR products were detected by 2% agarose gel electrophoresis and then sequenced. The sequencing results were analyzed by sequence alignment using Vector NTI 11.5.1 software to detect positive clones. The experimental results are as follows Figure 2-Figure 4 shown.
[0111] Result analysis: Compared with wild type ( Figure 2 ) were compared and the positive monoclonal clones were obtained as follows: 1 PMEL CTT homozygous deletion strain ( Figure 3 ), 3 heterozygous deletion strains ( Figure 4 ), the gene editing efficiency was 16%, and the sequencing results showed that the target genome had achieved targeted deletion. After the positive cell lines with homozygous deletion were thawed and cultured, the morphology was good; the cells of the homozygous deletion line were observed, and the experimental results were as follows Figure 5 As shown, this indicates that the cells after gene editing are in good condition and can be used for cloning.
[0112] B: RT-PCR identification
[0113] Total RNA was extracted from monoclonal cells, genomic DNA was removed and reverse transcribed, and mRNA was converted to cDNA. PCR amplification was then performed to verify whether the mRNA of the target gene (PMEL) was normally expressed, using GAPDH as the internal reference gene. The specific process is as follows:
[0114] a: Removal of genomic DNA
[0115] Genomic DNA removal system: 5× gDNA Eraser Buffer 2 μL, gDNA Eraser 1 μL, Total RNA 1000 ng, RNase-free H2O to 10 μL;
[0116] Genomic DNA removal procedure: 42°C for 2 min, 4°C for ∞;
[0117] b: cDNA acquisition
[0118] Reversal system: Prime Script RT Enzyme Mix 1 1 μL, RT Prime Mix 1 μL, 5× PrimeScript Buffer 24 μL, RNase-free H2O 4 μL;
[0119] Reversal program: 37°C for 15 min, 85°C for 5 s, 4°C ∞;
[0120] c: RT-PCR reaction
[0121] Take 20 μL of cDNA reversed in the previous step and dilute it with 180 μL of water. The diluted liquid is used as a template for RT-PCR reaction. The RT-PCR primer information is shown in Table 4.
[0122] Table 4 RT-PCR primer information
[0123]
[0124] Reaction system: 50 μL, Green Taq Mix 25 μL, upstream primer (10 μM) 2 μL, downstream primer (10 μM) 2 μL, template cDNA 1 μL, RNase-free H2O 20 μL;
[0125] Reaction program: 95°C for 3 min, 35 cycles of (95°C for 15 s, 55°C for 15 s, 72°C for 4 min 30 s), 72°C for 5 min, 4°C ∞.
[0126] Result analysis: The changes in PMEL mRNA expression in gene-edited cells were detected. The experimental results are as follows Figure 6 As shown, the results showed that the expression level of PMEL mRNA in CTT mutant cells was significantly reduced compared with that in wild-type cells.
[0127] Example 4
[0128] PMEL protein expression in PE-PMEL gene editing positive monoclonal cells
[0129] In order to verify the expression of PMEL protein in CTT mutant cells, protein expression was detected by Western blot to confirm the PMEL deletion mutation, in which α-Tubulin was used as the internal reference protein. The experimental results are shown in Figure 2. Figure 7 shown.
[0130] Result analysis: The expression level of PMEL protein in mutant cells was significantly reduced.
[0131] Example 5
[0132] Production and testing of PMEL gene-edited cattle
[0133] Nuclear transfer was performed using the PMEL homozygous mutant cells obtained as donor cells. After activation, the reconstructed embryos were cultured in a 38.5°C, 5% CO2 incubator. The cleavage rate was observed after 48 hours, and the blastocyst development rate was observed after 7 days. A total of 245 embryos were nuclear transferred, resulting in 213 2-cell embryos. After in vitro culture, 63 blastocysts were obtained, with a blastocyst development rate of 29.58% (Table 5). Figure 8 The cloned embryos with good development status were selected for embryo transplantation into recipient cows. A total of 57 recipient cows were transplanted. After 60 days, 12 cows tested positive for pregnancy through rectal palpation, with a pregnancy rate of 21.05%. At the end of pregnancy, 2 cloned cows were born, with a birth rate of 5%. One cow died after birth, and one survived ( Figure 8 ).
[0134] Table 5 Statistics of bovine cloned embryo development
[0135]
[0136] DNA-level identification of PMEL gene-edited cattle
[0137] Blood samples were collected from the cloned cows born, and genomic DNA was extracted. PCR identification and sequencing analysis of the PMEL gene were performed. The results showed that the cloned cow (ND1HX2010141F) had a homozygous mutation in the PMEL gene, and the mutation type was CTT deletion ( Figure 9 At the same time, we performed TA cloning and sequencing on the product. The results showed that the gene-edited cattle had a PMEL CTT homozygous deletion, which was consistent with the PCR product sequencing results ( Figure 10 ).
[0138] Because PMEL gene-edited cattle do not overexpress exogenous or endogenous genes, the target gene does not integrate into the animal's genome. However, some base deletions occur at the PMEL gene location in the genome. These small deletions are not reflected in the PMEL gene PCR amplification fragment size results, and base deletions must be analyzed through PCR product sequencing.
[0139] mRNA detection in PMEL gene-edited cattle
[0140] Skin tissue from cloned and wild-type control cattle was collected. mRNA from the tissue was extracted and reverse transcribed in the laboratory. RT-PCR analysis of PMEL gene expression revealed a significant decrease in PMEL gene expression in the skin tissue of gene-edited cattle ( Figure 11 ).
[0141] Protein expression detection in PMEL gene-edited cattle
[0142] To determine whether PMEL protein expression persists after PMEL knockout, we first extracted total protein from skin tissue using the RIPA lysis method, determined total protein concentration using the BCA assay, and finally performed a Western blot assay to detect PMEL expression. Using 30 μg of total protein as the sample load, we separated various protein components of varying molecular weights using 12% SDS-PAGE, then used antibodies to detect PMEL expression. α-Tubulin was also detected as an internal control. The results showed that PMEL protein expression in skin tissue was significantly lower than that in control cattle ( Figure 12 ).
[0143] The various embodiments in this specification are described in a progressive manner, and each embodiment focuses on the differences from other embodiments. The same or similar parts between the various embodiments can be referenced to each other.
[0144] The above description of the disclosed embodiments is intended to enable one skilled in the art to implement or use the present invention. Various modifications to these embodiments will be readily apparent to one skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the present invention. Therefore, the present invention is not limited to the embodiments shown herein but is intended to conform to the widest scope consistent with the principles and novel features disclosed herein.
Claims
1. A pegRNA specifically targeting the PMEL gene, characterized in that: Includes sgRNA and 3' extension, the 3' extension consists of RT template and PBS: The sequence of the sgRNA is shown in SEQ ID NO.1; The sequence of the RT template is shown in SEQ ID NO.2; The sequence of the PBS is shown in SEQ ID NO.3; The sequence of the 3' extension is shown in SEQ ID NO.
4.
2. A pegRNA specifically targeting the PMEL gene according to claim 1, characterized in that The nucleotide sequence of the pegRNA is shown in SEQ ID NO.
5.
3. A DNA molecule, characterized in that The DNA molecule encodes the pegRNA according to claim 1 or 2.
4. A biomaterial, characterized in that The biological material is any one of the following: 1) An expression cassette containing the DNA molecule of claim 3; 2) a recombinant vector containing the DNA molecule of claim 3, or a recombinant vector containing the expression cassette of 1); 3) A transgenic cell line containing the DNA molecule of claim 3, or a transgenic cell line containing the recombinant vector of 2); 4) A recombinant bacterium containing the DNA molecule of claim 3, or a recombinant bacterium containing the expression cassette of 1), or a recombinant bacterium containing the recombinant vector of 2).
5. Use of the pegRNA according to claim 1 or 2, the DNA molecule according to claim 3, or the biomaterial according to claim 4, characterized in that: The application is any of the following: 1) Application in the specific identification and / or targeting of the premelanosome protein PMEL gene; 2) Application in knockout of the premelanosome protein PMEL gene; 3) Application in breeding of light-coat transgenic cattle; 4) Application in breeding cattle for heat stress resistance; 5) Application in the preparation of a lead editing system for editing the premelanosome protein PMEL gene.
6. A pilot editing system, characterized in that: Include at least one of the following: 1) The pegRNA of claim 1 or 2; 2) the expression cassette of claim 4; 3) The recombinant vector according to claim 4.
7. The lead editing system according to claim 6, characterized in that Prime editing proteins are also included.
8. The use of the lead editing system according to any one of claims 6 to 7, characterized in that: The application is any of the following: 1) Application in knockout of the premelanosome protein PMEL gene; 2) Application in breeding of light-coat transgenic cattle; 3) Application in breeding cattle for heat stress resistance; 4) Application in lead editing of the premelanosome protein PMEL gene.
9. A lead editing method for knocking out the premelanosome protein PMEL gene, characterized in that: The method comprises the step of performing lead editing using the pegRNA of claim 1 or 2, the DNA molecule of claim 3, the expression cassette of claim 4, the recombinant vector, or the lead editing system of any one of claims 6-7.
Citation Information
Patent Citations
Pilot editing system and gene editing method
CN116396952A
Editing guiding system and application thereof
CN116555252A
PegRNA of targeted TRPV4 gene, pilot editing system and application of pegRNA and pilot editing system
CN119220536A
Application of knock-down CDYL gene in improvement of cattle meat production performance
CN119776436A
Lipid nanoparticles comprising coding RNA molecules for use in gene editing and as vaccines and therapeutic agents
WO2024263729A1