A premature aging mouse and its application
By introducing a two-site mutation in the mouse Lmna gene, the lifespan of Hutchinson-Gilford premature aging mice was extended, solving the problem of a short research window, providing a longer research period, and enhancing the practicality of premature aging mice in aging research.
Patent Information
- Application Number
- CN202510940468.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-07-08
- Publication Date
- 2025-11-28
- Estimated Expiration
- 2045-07-08
AI Technical Summary
The existing Hutchinson-Gilford premature aging mouse model exhibits aging phenotypes around one month after birth and has a lifespan of only three months. This short research window makes it difficult to observe drug effects in a short period of time, and the difficulty in reproduction limits the in-depth development of aging research.
By introducing a two-site mutation (T at bases 1811 and 1827) into the mouse Lmna gene, the lifespan of premature aging mice was extended to 5-12 months, providing a longer research window.
It extended the lifespan of premature aging mice, causing them to exhibit aging phenotypes around 3 months after birth, with a lifespan of 5-12 months. This increased the practicality and feasibility of the research, making it suitable for studying aging mechanisms and screening drugs for aging diseases.
Smart Images

Figure CN120442640B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application belongs to the field of genetic engineering, and particularly relates to a premature aging mouse and application thereof. BACKGROUND
[0002] Aging is a universal and irreversible biological process, which refers to the gradual deterioration of the structure and function of an organism over time, eventually leading to death. The aging process includes the accumulation of cellular damage, the decline of organ function, and the weakening of the immune system, and is a major risk factor for many common diseases such as cardiovascular disease, neurodegenerative disease, osteoporosis, metabolic disorder, and cancer.
[0003] The mechanism of aging is particularly complex and is influenced by genetic, environmental, and lifestyle factors. There are currently multiple theories about the causes of aging, such as the genetic theory at the individual level, the telomere shortening, heterochromatin loss, and mitochondrial damage theory at the cellular level, and the DNA damage and free radical oxidative stress theory at the molecular level. However, the underlying mechanisms of aging are still not fully understood, and further exploration of methods to delay aging is needed. Compared to in vitro cell culture, the biological processes in tissues, organs, and living organisms, such as the interaction of multiple organs and multiple types of cells, material exchange, and response to external signals, are more complex. Therefore, it is of great significance to study the mechanism of aging, explore the changing patterns of the aging process, and develop anti-aging drugs from the individual level, in order to fully understand and effectively intervene in aging.
[0004] Hutchinson-Gilford progeria syndrome (HGPS) is a rare genetic disease with clinical phenotypes including small body size, weight loss, and short life span, which is very similar to natural aging. In normal individuals, lamin A / C is produced by selective splicing of the Lmna gene and exists in the nuclear lamina and the entire nucleus, with high expression in multiple tissues. The C.1824C>T point mutation in exon 11 of the Lmna gene activates a cryptic splice site, ultimately translating an abnormal protein called progerin. Due to the lack of cleavage sites for the endogenous protease Zmpste24, its farnesylation modification cannot be removed, thus permanently anchoring it to the nuclear membrane. In mouse models, the corresponding mutation occurs at position 1827, affecting amino acid 609 (G609G). Due to the rapid and obvious aging symptoms of HGPS progeria, it provides a unique window for researchers to observe the cellular and molecular changes during the aging process in a relatively short period of time, and is considered an ideal model for aging research. In recent years, many studies have applied HGPS progeria cells, tissues, and mice models to simulate the process of natural aging, and have made important research achievements. However, HGPS progeria mice begin to exhibit aging phenotypes around 1 month after birth, with a lifespan of only 3 months, resulting in a relatively short research window. SUMMARY
[0005] In view of the deficiencies in the prior art, the present application provides a premature aging mouse with double site mutation, which exhibits a senile phenotype at about 2 months after birth, and has a lifespan of about 5-12 months, thus prolonging the window period for research and further increasing the practicability of the premature aging mouse.
[0006] According to an aspect of the present application, there is provided a nucleic acid molecule encoding Lmna, wherein the 1811th and 1827th bases of the nucleic acid molecule are T, and the numbering of the bases corresponds to the numbering of the nucleotide sequence shown in SEQ ID NO: 1.
[0007] In some embodiments, the nucleic acid molecule comprises a nucleotide sequence of gTgggagcccaggtgggT (SEQ ID NO: 5).
[0008] In some embodiments, the nucleic acid molecule comprises a nucleotide sequence of:
[0009] agcctgctgacaaggctgccggtggaGTGGGAGCCCAGGTGGGTggatccatctcctctg (SEQ ID NO: 8).
[0010] In some embodiments, the nucleic acid molecule comprises a nucleotide sequence shown in SEQ ID NO: 9.
[0011] According to an aspect of the present application, there is provided a mutant of Lmna, wherein the 604th alanine A of the mutant is mutated to valine V, relative to wild-type Lmna.
[0012] In some embodiments, the wild-type Lmna has an amino acid sequence shown in SEQ ID NO: 2.
[0013] According to yet another aspect of the present application, there is provided a tissue, body fluid, cell or broken product thereof or extract thereof of a premature aging mouse, wherein the tissue, body fluid, cell or broken product thereof or extract thereof comprises the nucleic acid molecule according to the present application.
[0014] In some embodiments, the cell or tissue cannot develop into an animal individual, and the cell does not comprise a germ cell.
[0015] In some embodiments, the premature aging mouse has a lifespan of greater than 3 months, preferably greater than 4 months, and more preferably 5-12 months.
[0016] In some embodiments, the Lmna of the progeria mouse has mutations of A604V and G609G as compared to a wild type mouse.
[0017] In some embodiments, the Lmna of the wild type mouse has an amino acid sequence as set forth in SEQ ID NO: 2.
[0018] According to still another aspect of the present application, there is provided use of the nucleic acid molecule, the mutant, the progeria mouse prepared by the method, the tissue, body fluid, cell or its broken product or extract thereof of the present application in constructing a progeria mouse model, researching a mechanism of aging or screening and / or evaluating a drug for an aging disease.
[0019] In some embodiments, the aging disease comprises one or more of progeria, arteriosclerosis, myocardial infarction, stroke, lipodystrophy, hair loss, osteoporosis, chronic inflammation, cardiac fibrosis, liver fibrosis, pulmonary fibrosis, renal fibrosis or splenic fibrosis.
[0020] The progeria mouse of the present application exhibits an aging phenotype at about 3 months after birth, and has a lifespan of about 5-12 months, thereby prolonging the window period for research and increasing the practicability of the progeria mouse. BRIEF DESCRIPTION OF DRAWINGS
[0021] Figure 1 The position information of the primer of the present application is shown.
[0022] Figure 2 The gel map of the PCR identification results of different mouse tails of the present application is shown.
[0023] Figure 3 The sequencing results of the double-site mutation heterozygous mouse of the present application are shown, wherein the base C at position 1827 is mutated to T homozygously, and the base C at position 1811 is mutated to T heterozygously.
[0024] Figure 4 The sequencing results of the double-site mutation homozygous mouse of the present application are shown, wherein the base C at position 1827 is mutated to T homozygously, and the base C at position 1811 is mutated to T homozygously.
[0025] Figure 5 The death curves of the double-site mutation heterozygous mouse (HGPS plus / - ), the double-site mutation homozygous mouse (HGPS plus / plus ) and the single-site mutation homozygous mouse of the present application are shown.
[0026] Figure 6 The photo of the 3-month-old progeria mouse of the present application is shown.
[0027] Figure 7Body size differences in 3-month-old progeroid mice of the present application are shown.
[0028] Figure 8 HGPS of the present application is shown. plus Transcriptome sequencing results of heart tissue of progeroid mice.
[0029] Figure 9 HGPS of the present application is shown. plus Transcriptome sequencing results of brain tissue of progeroid mice.
[0030] Figure 10 HGPS of the present application is shown. plus Normal splicing and abnormal splicing ratio changes of exon 11 of progeroid mice.
[0031] Figure 11 HGPS of the present application is shown. plus / plus SA-βgal staining results of aging markers of progeroid mice. DETAILED DESCRIPTION
[0032] Animal aging models refer to animal models that can simulate the appearance of similar aging phenotypes to humans, and have certain conservation of underlying mechanisms with humans, and are commonly used methods for studying aging. Among them, mice have the advantages of shorter lifespan, easy to breed, and 99% of genes homologous to humans, etc., and are commonly used animal models in aging research.
[0033] Aging models mainly include natural aging and induced progeria. Although the natural aging model is closest to the aging process of humans, the relatively long animal feeding period, poor health, and large individual differences limit its widespread application in aging research. Progeria syndrome is a rare genetic disease, and patients show accelerated aging and premature death. For example, Hutchinson-Gilford progeria syndrome (HGPS) is an autosomal dominant disease that can cause accelerated aging, as well as diseases related to aging such as heart disease, atherosclerosis, osteoporosis, and diabetes. HGPS patients show clinical manifestations such as short stature, low body weight, gray hair loss, and thinning of skin wrinkles at puberty, which are very similar to physiological aging. HGPS has been widely studied in the field of aging and is recognized as one of the best disease models for studying human physiological aging.
[0034] Classical HGPS is caused by a C<T mutation at position 1824 of the human Lmna gene, which is located in exon 11 of the Lmna gene and induces a splicing site in the precursor mRNA, causing Lmna150 bases after the mRNA deletion mutation site. This abnormal mRNA will then be translated to produce a truncated lamin A protein with a deletion of approximately 50 amino acids at the near C-terminus, called progerin. Progerin cannot be cleaved by the protease ZMPSTE24 and cannot form a mature Lamin A protein, which in turn leads to various phenotypes such as abnormal nuclear lamina structures, loss of heterochromatin, and DNA damage.
[0035] So far, the treatment of HGPS patients has been limited to the alleviation of phenotypes and the prevention of secondary complications, and there is no truly definite cure. Moreover, HGPS itself is a rare genetic disease, and the sources of clinical samples are very limited, increasing the difficulty of its research work. In 2011, Osorio et al. obtained the first HGPS mouse model by introducing a C>T mutation at the 1827th site (corresponding to the 1824th site of the human Lmna gene). Homozygous mutant mice showed phenotypes such as a short lifespan (about 12 weeks), dwarfism, and weight loss, which are very similar to the clinical phenotypes of HGPS patients and are ideal models for HGPS disease research. However, the model mice age rapidly after puberty, the research window period is short, the effects of some drugs cannot be exerted or produce phenotypes in a short time, and it is difficult to reproduce due to rapid aging, which imposes certain limitations on the research of aging or premature aging diseases. Lmna
[0036] Lmna During the research process, the inventors screened mice with double-site mutations in the Lmna gene. In addition to the C>T mutation at the 1827th site, these mice also have a C>T mutation at the 1811th site. The double-site mutant mice (named HGPS plus mice) show aging phenotypes around 3 months after birth and can live up to about 5 - 12 months, extending the research window period available.
[0037] To make the objectives, technical solutions, and advantages of the present invention clearer and more understandable, the present invention will be further described in detail below with reference to the accompanying drawings and embodiments. The specific embodiments described herein are only used to explain the present invention and do not constitute any limitation to the present invention. In addition, in the following description, the description of well-known structures and technologies is omitted to avoid unnecessarily confusing the concepts of the present invention. Such structures and technologies have also been described in many publications.
[0038] Definitions
[0039] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs. For purposes of interpreting this specification, the following definitions will apply and whenever appropriate, terms used in the singular will include the plural and vice versa.
[0040] Unless the context clearly dictates otherwise, the expressions "a" and "an" as used herein include the plural as well as the singular. For example, reference to "a cell" includes a plurality of such cells, equivalents thereof known to those skilled in the art, and so on.
[0041] In the present application, the term "about" denotes a range of ±20% of the numerical value that follows it. In some embodiments, the term "about" denotes a range of ±10% of the numerical value that follows it. In some embodiments, the term "about" denotes a range of ±5% of the numerical value that follows it.
[0042] Progeria syndrome is a rare genetic disease, patients show accelerated aging, premature death and other phenomena. For example, Hutchinson-Gilford progeria syndrome (HGPS) is an autosomal dominant disease that can cause accelerated aging, as well as diseases related to aging such as heart disease, atherosclerosis, osteoporosis, and diabetes.
[0043] The LMNA gene encodes lamin A / C, which is the main component of the nuclear lamina, belongs to the nuclear envelope protein, participates in the control of cell nucleus elasticity and deformability, cell cycle regulation, DNA transcription expression, connection of nuclear pore complex, nuclear stability and signal transduction, etc. In humans, mutations in this gene can cause several diseases: Emery-Dreifuss muscular dystrophy, familial partial lipodystrophy, limb girdle muscular dystrophy, dilated cardiomyopathy, Charcot-Marie-Tooth disease, and Hutchinson-Gilford progeria syndrome, etc.
[0044] The "percent sequence identity" or "percent identity" between two polynucleotide or polypeptide sequences refers to the number of identical matches between the sequences within a comparison window, taking into account any additions or deletions (i.e., gaps) that must be introduced in order to align the two sequences for optimal comparison. A match is any position where the nucleotide or amino acid in the target sequence and the reference sequence are the same. Since gaps are not nucleotides or amino acids, gaps present in the target sequence are not counted. Likewise, since only the nucleotides or amino acids from the target sequence are counted, and not those from the reference sequence, gaps present in the reference sequence are not counted.
[0045] The percentage sequence identity can be calculated by determining the number of positions at which the same amino acid residue or nucleic acid base occurs in both of the sequences to be compared, dividing the number of matching positions by the total number of positions in the comparison window, and multiplying the result by 100 to yield the percentage of sequence identity. The comparison of sequences and determination of the percentage sequence identity between two sequences can be accomplished using software programs commonly available to those skilled in the art for online use and download. Suitable software programs are available from various sources for the alignment of protein and nucleotide sequences. One suitable program for determining percentage sequence identity is bl2seq, which is part of the BLAST suite of programs available on the BLAST website (blast.ncbi.nlm.nih.gov). Bl2seq uses either the BLASTN or BLASTP algorithm for comparison between two sequences. BLASTN is used for comparing nucleic acid sequences, while BLASTP is used for comparing amino acid sequences. Other suitable programs are, for example, Needle, Stretcher, Water or Matcher, which are part of the EMBOSS suite of bioinformatics programs, and are also available from the European Bioinformatics Institute (EBI) on www.ebi.ac.uk / Tools / psa.
[0046] In the present application, the term "nucleic acid", "gene" or "nucleotide" sequence refers to any form of RNA or DNA molecule having more than one nucleotide, including single-stranded, double-stranded, oligonucleotide or polynucleotide.
[0047] In the present application, the term "exon" refers to both the DNA sequence within a gene and the corresponding sequence in the RNA transcript.
[0048] The following examples and figures are provided to aid the understanding of the present application, but should not be construed as limiting in any way. The actual scope of the application is set forth in the appended claims. It should be understood that any modifications and variations thereof can be made without departing from the spirit of the present application.
[0049] The reagents and / or kits used in the following examples are either commercially available or can be synthesized by known methods.
[0050] Example
[0051] Example 1 Screening and identification of premature aging mice
[0052] During the breeding of HGPS mice (C57B / 6J-Lamin A Tm1 / MC, MBL), the inventors found a batch of mice that did not die around 100 days, but around half a year to a year. These mice with extended age were identified and bred, and named HGPS plusMice.
[0053] 1.1 Mouse genotype identification:
[0054] The pups were bred up to two weeks old, the mouse toes of about 0.5 cm were cut and placed at the bottom of a 200 μL PCR tube, 100 μL of lysis solution (VIAGEN DirectPCR cat#102-T) containing 1% proteinase K (V900887 Sigma-Aldrich) was added, 55°C lysis for 8h, then 85°C treatment for 45min, 500g centrifugation for 5min, and the obtained supernatant was identified.
[0055] The mouse toes after lysis were used as templates to perform PCR on the Lmna gene (SEQ ID NO: 1, the encoded amino acid sequence is shown in SEQ ID NO: 2) of the mouse by using Phanta Max Super-Fidelity DNA Polymerase (Novozyme) according to the manufacturer's instructions.
[0056] The sequences of the PCR identification primers are as follows:
[0057] LMNA-seqF: agtcagtcccaaactcgctg (SEQ ID NO: 3)
[0058] LMNA-seqR: caagagggactgcaaggagg (SEQ ID NO: 4)
[0059] The positions of the PCR identification primers are shown by green arrows. Figure 1
[0060] Different HGPS plus The results of mouse tail PCR identification are shown in Figure 2 , and the correct bands after PCR were sequenced.
[0061] Exemplary results are shown in Figure 3 and Figure 4 HGPS plus The Lmna gene of the mouse has a double-site mutation, in the double-site mutation heterozygous mouse (HGPS plus / - ) and the double-site mutation homozygous mouse (HGPS plus / plus ), in addition to the 1827th base C<T mutation, there is also a 1811th base C<T mutation, i.e. having the following nucleotide sequence:
[0062] gTgggagcccaggtgggT (SEQ ID NO: 5), the corresponding amino acid sequence is mutated from AGAQVG (SEQ ID NO: 6) to VGAQVG (SEQ ID NO: 7); or
[0063] has a nucleotide sequence as follows:
[0064] agcctgctgacaaggctgccggtggaGTGGGAGCCCAGGTGGGTggatccatctcctctg (SEQ ID NO: 8).
[0065] wherein the nucleotide sequence of the Lmna gene of the wild-type mouse is SEQ ID NO: 1 as follows:
[0066]
[0067] wherein the amino acid sequence encoded by the Lmna gene of wild-type mice is SEQ ID NO: 2 as shown below:
[0068] METPSQRRATRSGAQASSTPLSPTRITRLQEKEDLQELNDRLAVYIDRVRSLETENAGLRLRITESEEVVSREVSGIKAAYEAELGDARKTLDSVAKERARLQLELSKVREEFKELKARNTKKEGDLLAAQARLKDLEALLNSKEAALSTALSEKRTLEGELHDLRGQVAKLEAALGEAKKQLQDEMLRRVDAENRLQTLKEELDFQKNIYSEELRETKRRHETRLVEIDNGKQREFESRLADALQELRAQHEDQVEQYKKELEKTYSAKLDNARQSAERNSNLVGAAHEELQQSRIRIDSLSAQLSQLQKQLAAKEAKLRDLEDSLARERDTSRRLLAEKEREMAEMRARMQQQLDEYQELLDIKLALDMEIHAYRKLLEGEEERLRLSPSPTSQRSRGRASSHSSQSQGGGSVTKKRKLESSESRSSFSQHARTSGRVAVEEVDEEGKFVRLRNKSNEDQSMGNWQIRRQNGDDPLMTYRFPPKFTLKAGQVVTIWASGAGATHSPPTDLVWKAQNTWGCGSSLRTALINSTGEEVAMRKLVRSLTMVEDNEDDDEDGEELLHHHRGSHCSGSGDPAEYNLRSRTVLCGTCGQPADKAAGGAGAQVGGSISSGSSASSVTVTRSFRSVGGSGGGSFGDNLVTRSYLLGNSSPRSQSSQNCSIM.
[0069] wherein the HGPS plus mouse Lmna The nucleotide sequence of the gene of the mouse is SEQ ID NO: 9 as shown below:
[0070]
[0071] wherein HGPS plus Mice of Lmna The amino acid sequence encoded by the gene is shown below as SEQ ID NO: 10, with the mutation points in bold:
[0072] METPSQRRATRSGAQASSTPLSPTRITRLQEKEDLQELNDRLAVYIDRVRSLETENAGLRLRITESEEVVSREVSGIKAAYEAELGDARKTLDSVAKERARLQLELSKVREEFKELKARNTKKEGDLLAAQARLKDLEALLNSKEAALSTALSEKRTLEGELHDLRGQVAKLEAALGEAKKQLQDEMLRRVDAENRLQTLKEELDFQKNIYSEELRETKRRHETRLVEIDNGKQREFESRLADALQELRAQHEDQVEQYKKELEKTYSAKLDNARQSAERNSNLVGAAHEELQQSRIRIDSLSAQLSQLQKQLAAKEAKLRDLEDSLARERDTSRRLLAEKEREMAEMRARMQQQLDEYQELLDIKLALDMEIHAYRKLLEGEEERLRLSPSPTSQRSRGRASSHSSQSQGGGSVTKKRKLESSESRSSFSQHARTSGRVAVEEVDEEGKFVRLRNKSNEDQSMGNWQIRRQNGDDPLMTYRFPPKFTLKAGQVVTIWASGAGATHSPPTDLVWKAQNTWGCGSSLRTALINSTGEEVAMRKLVRSLTMVEDNEDDDEDGEELLHHHRGSHCSGSGDPAEYNLRSRTVLCGTCGQPADKAAGGVGAQVGGSISSGSSASSVTVTRSFRSVGGSGGGSFGDNLVTRSYLLGNSSPRSQSSQNCSIM.
[0073] Figure 2 Death curve of double site mutant mice and unit point mutant homozygous mice
[0074] The double site mutant mice (HGPS plus ) and unit point mutant mice (HGPS) obtained in Example 1 were observed every week, and the offspring of the mice showed symptoms such as white hair, rickets, and small body size, indicating that the corresponding mice began to show the aging phenotype.
[0075] In addition, the death time of the double-site mutation heterozygous mouse (HGPS plus / - ), the double-site mutation homozygous mouse (HGPS plus / plus ) and the single-site mutation homozygous mouse (HGPS) obtained in Example 1 was recorded, and the results are shown in Tables 1-3 below, wherein the death curves drawn according to Tables 1-3 are shown in Figure 5
[0076] The results show that the single-site mutation homozygous mouse begins to show the aging phenotype at about 1 month after birth, and the lifespan is only 3 months. The double-site mutation heterozygous mouse prepared in the present application shows the aging phenotype at about 3 months after birth, and the lifespan is about 6 months. The double-site mutation homozygous mouse shows the aging phenotype at about 3 months after birth, and the lifespan is about 10 months.
[0077] Table 1: Death time of HGPS plus double-site mutation heterozygous mouse
[0078] Mouse number Date of birth Time of death Life span (days) 1 24.04.20 24.10.28 192 2 24.04.20 24.10.15 179 3 24.04.20 24.10.16 180 4 24.04.29 24.10.14 179 5 24.04.29 24.10.29 194 6 24.04.15 24.10.29 199 7 24.04.15 24.10.05 185 8 24.04.15 24.10.15 195 9 24.04.15 24.10.14 194 10 24.04.15 24.10.15 195 11 24.04.15 24.10.05 185 12 24.04.15 24.10.15 195 13 24.04.15 24.10.14 194 14 24.04.15 24.10.29 159 15 24.05.30 24.10.30 158 16 24.05.24 24.10.22 158 17 24.05.30 24.10.22 150 18 24.05.30 24.10.15 133 19 24.05.30 24.10.15 133
[0079] Table 2: Death time of HGPS plus double-site mutation homozygous mouse
[0080] Mouse number Date of birth Time of death Life span (days) 1 24.05.27 25.03.11 288 2 24.04.15 25.02.14 305 3 24.05.24 25.03.07 287 4 24.05.24 25.03.11 288 5 24.04.2 25.03.01 333 6 24.04.20 25.02.11 300 7 24.04.20 25.02.03 290 8 24.04.20 25.02.03 290 9 24.05.24 25.02.05 257 10 24.05.18 25.02.21 279
[0081] Table 3: Death time of HGPS single-site mutation homozygous mouse
[0082] Mouse number Date of birth Time of death Life span (days) 1 24.05.05 24.08.08 95 2 24.05.18 24.07.04 47 3 24.05.18 24.08.24 98 4 24.06.15 24.09.06 83 5 24.10.30 24.02.17 110 6 24.03.03 24.05.20 78 7 24.03.03 24.05.28 86 8 24.03.03 24.06.05 94 9 24.05.17 24.07.17 61 10 24.05.20 24.08.24 96 11 24.05.20 24.08.15 87 12 24.05.20 24.09.23 126 13 24.10.30 24.02.23 116 14 24.11.03 24.02.16 105
[0083] Example 3: Identification of mouse aging phenotype
[0084] The 3-month-old double-site mutation progeria mouse obtained in Example 1 has white hair (HGPS plus / - , Figure 6 ), and the body size is significantly smaller than that of the wild type (HGPS plus / plus , Figure 7 ), indicating that the progeria mouse with the aging phenotype is successfully obtained.
[0085] According to the results of body size and death time, it can be seen that the double-site mutation progeria mouse prepared in the present application is slower in the aging process and has a longer lifespan than the single-site mutation progeria mouse. This indicates that the new mutation site found in the present application, i.e., c.1811 C<T, has the effect of rescuing or improving the progeria phenotype caused by 1827 C<T.
[0086] Example 4: Transcriptome sequencing
[0087] Lmna gene normal splicing and alternative splicing were quantitatively analyzed by RNA-seq method. Different isoforms were identified by comparing the difference of reads counts on Lmna gene exons.
[0088] Three-month-old WT (C57BL / 6J), HGPS, HGPS plus / plus Three mice of each type were dissected and heart and brain tissues were obtained for RNA-seq library sequencing. The transcriptome library was constructed using the NR605 kit of Novogene Co., Ltd., and then the constructed library was subjected to high-throughput sequencing using the Illumina NovaSeq platform.
[0089] The reads obtained by sequencing were aligned to the Lmna genome, and the splicing pattern at exon 11 was observed. Abnormal splicing caused by HGPS mutation occurs at Lmna exons 11-12. The total reads (including normal splicing and mutant splicing, exAll) across Lmna exons 11-12 in the RNA-seq data were quantified, the normal splicing reads (exWT) and the mutant splicing reads (exHGPS) were quantified, and then the ratio of normal splicing to mutant splicing (exWT / exAll, exHGPS / exAll) was calculated.
[0090] The results showed that HGPS plus Compared with HGPS mice, the ratio of normal splicing to abnormal splicing (CS / AS) at exon 11 increased in mice, from 1.18 to 4.3 in the heart ( Figure 8 ), and from 0.64 to 0.88 in the brain ( Figure 9 ). Compared with brain tissue, Lmna had a higher expression level in the heart; HGPS plus Compared with HGPS samples, all samples showed obvious normal splicing compensation characteristics ( Figure 10 ).
[0091] Example 5: Senescence marker SA-βgal staining
[0092] Twelve-week-old WT (C57BL / 6J), HGPS, HGPS plus / plus Three mice were dissected and brain tissues were obtained for senescence marker SA-βgal staining;
[0093] Experimental steps:
[0094] Biopsy samples were obtained and briefly rinsed with PBS to remove blood. The samples were placed in OCT compound and snap-frozen with isopentane and liquid nitrogen. The frozen samples were cut into 4 μιη thick sections. The sections were fixed with 1% formaldehyde in PBS for 1 minute at room temperature. The sections were washed with PBS three times. The sections were immersed in SA-β-gal staining solution overnight and counterstained with eosin. The presence of blue precipitate was observed by brightfield microscopy.
[0095] wherein the SA-β-gal staining solution comprises 1 mg / mL X-gal, 1x citric acid / phosphate sodium buffer (pH 6.0), 5 mM ferric cyanide potassium, 5 mM ferrous cyanide potassium, 150 mM NaCl, and 2 mM MgCl2.
[0096] The results of the staining are shown in FIG. 1, which shows that at the same age, HGPS mice have significantly more SA-β-gal expression than WT mice. Figure 11 plus The SA-βgal expression in the HGPS mice was significantly lower than in the same age HGPS mice, and close to the same age WT mice.
[0097] The technical solutions of the present application are not limited to the above specific embodiments, and any technical variations made according to the technical solutions of the present application fall within the scope of protection of the present application.
Claims
1. A nucleic acid molecule encoding Lmna, characterized in that, The nucleic acid molecule has T bases at positions 1811 and 1827. The base numbers correspond to the nucleotide sequence shown in SEQ ID NO: 1; The nucleotide sequence of the nucleic acid molecule is shown in SEQ ID NO:
9.
2. The application of the nucleic acid molecule according to claim 1 in the construction of a premature aging mouse model.
Citation Information
Patent Citations
Construction method and application of senescence mouse model
CN115181755A
Mouse LMNA gene point mutation targeting composition and mouse model construction method
CN118109519A