Application of OsCPS4 gene in regulating plant salt tolerance

Abstract

This invention discloses the application of the OsCPS4 gene in regulating plant salt tolerance, belonging to the field of biotechnology. Increasing the expression level of the OsCPS4 gene enhances the plant's salt tolerance; decreasing the gene's expression level reduces salt tolerance. This invention provides a breakthrough technical solution for crop stress resistance breeding by deeply analyzing the regulation and mechanism of the OsCPS4 gene in plant salt stress response. Overexpression of OsCPS4 not only improves the salt tolerance of rice seedlings but also significantly enhances the plant's recovery ability after stress. This characteristic is of great value in addressing intermittent salt stress in practical agricultural production. This invention is expected to play an important role in stress resistance breeding of rice and other important crops.

Description

Technical Field

[0001] This invention relates to the field of biotechnology, and in particular to the application of the OsCPS4 gene in regulating plant salt tolerance. Background Technology

[0002] Salt stress is a major abiotic stress factor restricting crop production, affecting plant growth and development through multiple pathways. Physiologically, salt stress disrupts normal photosynthesis and transpiration, interfering with water and mineral nutrient transport. Morphologically, it leads to phenotypic defects such as decreased germination rate, reduced plant height, and fewer tillers. As a salt-sensitive crop, understanding the salt tolerance mechanisms of rice is crucial for unlocking its stress resistance potential.

[0003] The CPS family consists of key initiating enzymes in the biosynthesis of diterpenoids in plants, catalyzing the formation of CPP precursors with different structures from GGPP. The rice genome contains several functionally differentiated members of the CPS gene family, among which OsCPS1, OsCPS2, and OsCPS4 have been confirmed to participate in different diterpenoid metabolic pathways. OsCPS4 specifically catalyzes the synthesis of syn-CPP from GGPP, thereby participating in the biosynthesis of phytoalexins such as momilactones. Studies have found that OsCPS4 plays an important role in plant responses to various environmental stresses, including responses to pathogens such as rice blast and bacterial blight, and the regulation of drought stress adaptation, indicating that this gene has multiple regulatory functions in plant stress resistance mechanisms.

[0004] However, current research on this gene family in rice salt stress is relatively limited. Therefore, in-depth research on the correlation between the CPS4 gene and salt stress response mechanism in rice can provide new gene resources for crop stress resistance genetic improvement and a theoretical basis for molecular target research. Summary of the Invention

[0005] The purpose of this invention is to provide the application of the OsCPS4 gene in regulating plant salt tolerance, thereby addressing the problems existing in the prior art. This invention provides a breakthrough technical solution for crop stress resistance breeding by deeply analyzing the regulation and mechanism of the OsCPS4 gene in plant salt stress response. Overexpression of OsCPS4 not only improves the salt tolerance of rice seedlings but also significantly enhances the plant's recovery ability after stress. This characteristic is of great value in addressing intermittent salt stress in practical agricultural production. This invention is expected to play an important role in stress resistance breeding of rice and other important crops.

[0006] To achieve the above objectives, the present invention provides the following solution:

[0007] This invention provides the application of the OsCPS4 gene and related biological materials in regulating plant salt tolerance. Increasing the expression level of the OsCPS4 gene increases the plant's salt tolerance; decreasing the expression level of the gene decreases the plant's salt tolerance. The nucleotide sequence of the OsCPS4 gene is shown in SEQ ID NO.1.

[0008] Optionally, the relevant biological material includes a protein encoded by the OsCPS4 gene, a recombinant vector containing the OsCPS4 gene, or a recombinant microorganism.

[0009] Optionally, the amino acid sequence of the protein is shown in SEQ ID NO.2.

[0010] Optionally, the plant includes rice.

[0011] The present invention also provides a method for improving the salt tolerance of plants, comprising the step of introducing the OsCPS4 gene into the plant to achieve stable overexpression of the OsCPS4 gene; the nucleotide sequence of the OsCPS4 gene is shown in SEQ ID NO.1.

[0012] Optionally, the plant includes rice.

[0013] The present invention also provides the application of the OsCPS4 gene and related biological materials in the cultivation of highly salt-tolerant plants, wherein the nucleotide sequence of the OsCPS4 gene is shown in SEQ ID NO.1.

[0014] Optionally, the plant includes rice.

[0015] The present invention also provides a method for cultivating highly salt-tolerant plants, comprising the step of introducing the OsCPS4 gene into the plant to obtain a plant capable of stably overexpressing the OsCPS4 gene; the nucleotide sequence of the OsCPS4 gene is shown in SEQ ID NO.1.

[0016] Optionally, the plant includes rice.

[0017] The present invention discloses the following technical effects:

[0018] This invention provides a breakthrough technical solution for crop stress resistance breeding by deeply elucidating the regulation and mechanism of the OsCPS4 gene in plant salt stress response. Biological experiments show that the expression level of the OsCPS4 gene is significantly positively correlated with plant salt tolerance; overexpressing lines showed a nearly 60% higher survival rate after salt stress treatment compared to wild-type lines, and exhibited stronger ion homeostasis regulation capabilities. This invention not only reveals the molecular mechanism by which OsCPS4 enhances plant salt tolerance by regulating ion balance, but also suggests that it may play a key role in plant stress signaling pathways.

[0019] Overexpression of OsCPS4 not only enhances salt tolerance in rice seedlings but also significantly improves the plant's recovery ability after stress. This characteristic is of great value in addressing intermittent salt stress in practical agricultural production. This invention is expected to play an important role in stress-resistance breeding of rice and other important crops. Attached Figure Description

[0020] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0021] Figure 1 Sequencing results of OsCPS4 gene knockout lines at the editing target site;

[0022] Figure 2 Expression analysis of OsCPS4 at different time points under salt stress in wild-type Kitaake;

[0023] Figure 3 Phenotypic diagrams of wild-type Kitaake, Oscps4-2 and Oscps4-11 mutants and OE-CPS4-4 and OE-CPS4-10 overexpression lines under normal conditions, after 14 days of salt stress treatment and after 7 days of recovery.

[0024] Figure 4 Survival (A) and water content (B) of wild-type Kitaake, Oscps4-2 and Oscps4-11 mutants and OE-CPS4-4 and OE-CPS4-10 overexpression lines were analyzed.

[0025] Figure 5 Na for OsCPS4-related genetic material under salt stress + and K + Content analysis; where A, B, and C represent the Na content in the aboveground parts of wild-type Kitaake, Oscps4-2, Oscps4-11 mutants, and OE-CPS4-4 and OE-CPS4-10 overexpression materials, respectively. + K + Content and Na + / K + D, E, and F represent the underground Na cells of wild-type Kitaake, Oscps4-2, Oscps4-11 mutants, and OE-CPS4-4 and OE-CPS4-10 overexpression materials, respectively. + K + Content and Na + / K+ . Detailed Implementation

[0026] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0027] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0028] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.

[0029] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be apparent to those skilled in the art. This specification and embodiments are merely exemplary.

[0030] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.

[0031] The following examples are for illustrative purposes only and are not intended to limit the scope of the invention. Unless otherwise specified, all examples were conducted under conventional experimental conditions, such as those described in Sambrook et al.'s Molecular Cloning: A Laboratory Manual (Sambrook J & Russell DW, 21), or according to the manufacturer's instructions. The main reagents used in the following examples were: various restriction endonucleases, Taq DNA polymerase, T4 ligase, Pyrobest Taq enzyme, and KOD were purchased from NEB, Toyobo, and other biotechnology companies; dNTPs were purchased from Genestar; plasmid miniprep kits and agarose gel extraction kits were purchased from Shanghai Jierui Biotechnology Co., Ltd.; agar powder, agarose, ampicillin (Amp), kanamycin (Kan), gentamicin sulfate (Gen), rifampin (Rif), and other antibiotics, as well as glucose, BSA, LB medium, etc., were purchased from Sigma, Bio-Rad, and other companies; reagents used in real-time quantitative PCR were purchased from TaKaRa; and all other chemical reagents used in the examples were imported or domestically produced analytical grade reagents. The primers used in the examples were synthesized by Beijing Ruiboxingke Biotechnology Co., Ltd., and related sequencing was performed.

[0032] The carrier used in the following embodiments:

[0033] pENTR-gRNA and pBY02-Cas are disclosed in the non-patent literature “Large chromosomal deletions and heritable small genetic changes induced by CRISPR / Cas9 in rice”, Huanbin Zhou et., Nucleic acids research, 2014, Vol.42, No.1710903–10914;

[0034] pBY02 is disclosed in the non-patent document "Gene targeting by the TAL effector PthXo2reveals cryptic resistance gene for bacterial blight of rice", Junhui Zhouet., The Plant journal: for cell and molecularbiology, The Plant Journal (2015) 82, 632-643.

[0035] Example 1: Construction and genetic transformation of rice OsCPS4 gene knockout and overexpression vector.

[0036] 1. Construction of rice OsCPS4 gene knockout vector

[0037] OsCPS4 gene knockout vectors were constructed using CRISPR / Cas9 technology. Sequence analysis of the rice OsCPS4 gene showed that it contains 13 exons. Two target sites were designed in the first exon, resulting in two OsCPS4 gene mutation types in rice. The target site sequences are as follows:

[0038] Target 1: GTTTGGGCAGCCAGCATCGGCGG, SEQ ID NO.3;

[0039] Target 2: GACGCCCAGCCATTGCTGCAAGG, SEQ ID NO.4.

[0040] The nucleotide sequence of the OsCPS4 gene is shown in SEQ ID NO.1:

[0041] SEQ ID NO.1:

[0042]

[0043] The amino acid sequence of the protein encoded by this gene sequence is shown in SEQ ID NO.2:

[0044] SEQ ID NO.2:

[0045] MPVFTASFQCVTLFGQPASAADAQPLLQGQRPFLHLHARRRRPCGPMLISKSPPYPASEETREWEADGQHEHTDELRETTTTMIDGIRTALRSIGEGEISISAYDTSLVALLKRLDGGDGPQFPSTIDWIVQNQLPDGSWGDASFFMMGDRIMSTLACVVALKSWNIHTDKCERGLLFIQENMWRLAHEEEDWMLVGFEIALPSLLDMAKDLDLDIPYDEPALKAIYAERERKLAKIPRDVLHSMPTTLLHSLEGMVDLDWEKLLKLRCLDGSFHCSPASTATAFQQTGDQKCFEYLDGIVKKFNGGVPCIYPLDVYERLWAVDRLTRLGISRHFTSEIEDCLDYIFRNWTPDGLAHTKNCPVKDIDDTAMGFRLLRLYGYQVDPCVLKKFEKDGKFFCLHGESNPSSVTPMYNTYRASQLKFPGDDGVLGRAEVFCRSFLQDRRGSNRMKDKWAIAKDIPGEVEYAMDYPWKASLPRIETRLYLDQYGGSGDVWIGKVLHRMTLFCNDLYLKAAKADFSNFQKECRVELNGLRRWYLRSNLEKFGGTDPQTTLMTSYFLASANIFEANRAAERLGWARVALLADAVSSHFRRIGGPKNSTSNLEELISLVPFDDAYSGSLREAWKQWLMAWTAKESSQESIEGDTAILLVRAIEIFGGRHVLTGQRPDLWEYSQLEQLTSSICCKLSRRVLAQENGESTEKVEEIDQQVDLEMQELTRRVLQGCSAINRLTRETFLHVVKSFCYVAYCSPETIDSHIDKVIFQDVI。

[0046] Based on the aforementioned target design, the corresponding sgRNAs were synthesized. This invention uses the intermediate vector pENTR-gRNA for two gRNAs, containing two cloning sites (BtgZI and BsaI) following the rice U6 promoter. For the BtgZI cloning site, the sense strand contains a 5'4-nt TGTT, and the antisense strand contains a 5'4-nt AAAC. For the BsaI cloning site, the sense strand contains a 5'4-nt GTGT, and the antisense strand contains a 5'4-nt AAAC.

[0047] The primers for synthesizing sgRNA1 are as follows:

[0048] gOsCPS4-1-F:5'-tgttGTTTGGGCAGCCAGCATCGG-3', SEQ ID NO.5;

[0049] gOsCPS4-1-R: 5'-aaacCCGATGCTGG CTGCCCAAAC-3', SEQ ID NO. 6.

[0050] The primers for synthesizing sgRNA2 are as follows:

[0051] gOsCPS4-2-F:5'-gtgtGACGCCCAGCCATTGCTGCA-3', SEQ ID NO.7;

[0052] gOsCPS4-2-R:5'-aaacTGCAGCAATGGCTGGGCGTC-3', SEQ ID NO.8.

[0053] Two sgRNA sequences were synthesized by annealing at 95℃ for 10 min and then at 55℃ for 10 min. The first sequence was cloned into the BtgZI restriction site, and the second sequence was inserted into the BsaI restriction site. The structures were then verified by sequencing. The two sgRNA fragments were then subcloned into the CRISPR vector pBY02-Cas9 using LR cloning enzyme to obtain the OsCPS4 gene knockout vector.

[0054] 2. Construction of rice OsCPS4 gene overexpression vector

[0055] The open reading frame of OsCPS4 was amplified from the cDNA of japonica rice Kitaake by PCR. The primer sequences are as follows.

[0056] OsCPS4-CDS-F:CCCATGCTAATAAGCAAATC,SEQ ID NO.9

[0057] OsCPS4-CDS-R:AAGGTCGGGAATTGGTAGTG,SEQ ID NO.10

[0058] The PCR fragment was cloned into the KpnI and XbaI restriction sites of the vector pBY02, so that its expression was controlled by the promoter of the maize ubiquitin 1 gene, thus obtaining the OsCPS4 gene overexpression vector.

[0059] The cloning primer sequences are as follows:

[0060] OsCPS4-F: CGGGGTACCATGCCGGTCTTCACTGCGTC, SEQ ID NO.11;

[0061] OsCPS4-R: GCTCTAGACTAAATCACATCTTGGAATATGAC, SEQ ID NO. 12.

[0062] 3. Genetic transformation of OsCPS4 gene knockout and overexpression vector in rice

[0063] The OsCPS4 gene knockout mutant and overexpression material were created by transforming immature rice embryo-derived callus cells using Agrobacterium-mediated genetic transformation. The specific steps are as follows:

[0064] (1) Using japonica rice Kitaake seeds as material, after removing the outer husk and disinfecting, they were placed in an induction medium and cultured in a 28℃ light incubator for 3-4 weeks. Then, naturally divided embryogenic callus tissue was picked and placed in a subculture medium for 7 days. After three subcultures, naturally dispersed, bright yellow, granular callus tissue with a diameter of about 2-3 mm was selected for Agrobacterium transformation.

[0065] (2) The constructed OsCPS4 gene knockout vector and overexpression vector were transferred into Agrobacterium competent cells EHA105 by electroporation to obtain Agrobacterium suspension.

[0066] (3) Soak the callus tissue obtained in step (1) in the Agrobacterium suspension in step (2), let it stand for 30-40 minutes, dry it on sterile filter paper, and inoculate it on co-culture medium. Incubate in the dark at 25°C for 3 days.

[0067] (4) Collect the callus tissue obtained in step (3), wash it thoroughly with sterile water, and then wash it twice with sterile water containing 300 mg / L carbenicillin sodium. Finally, place it on sterile filter paper to drain; transfer the drained callus to a selection medium containing 300 mg / L carbenicillin sodium for the first round of selection, and culture at 28°C under light for 14 days. Transfer the initial callus with resistant callus to a selection medium containing 300 mg / L carbenicillin sodium for the second round of selection, until granular resistant callus tissue grows.

[0068] (5) Transfer 3-7 callus tissues obtained in step (4) to a differentiation tank containing differentiation medium and place it in a constant temperature culture room at 25℃. When the seedlings grow to the top of the differentiation tank lid, place them in the rooting medium to root and strengthen the seedlings. After 7 days, open the sealing film, add an appropriate amount of sterile water to prevent bacterial growth, harden the seedlings for about 3 days until they stand upright, then wash off the agar, and transplant after 7-14 days of solution culture.

[0069] 4. Detection of gene knockout and overexpression lines

[0070] (1) Detection of OsCPS4 gene knockout lines

[0071] After the transplanted rice plants have formed ears, the following methods are adopted: Genomic DNA (gDNA) was extracted from the leaves of T0 transgenic rice seedlings using reagents (Invitrogen) for genotyping. The amplification primer sequences are designed as follows:

[0072] Forward primer: ATCATTCATCCCAATATCTATTG, SEQ ID NO.13;

[0073] Reverse primer: AACGTTAACTATTTATCTTA, SEQ ID NO.14.

[0074] PCR amplification products were treated with ExoSAPIT (Affymetrix, Santa Clara, CA, USA) and then Sanger sequencing was performed.

[0075] The two homozygous gene knockout mutant rice strains obtained in the above steps were harvested and sown to obtain the homozygous T1 generation mutants. To obtain Cas9-Free gene knockout homozygous plants, the same genotyping method was used on the homozygous T1 generation transgenic rice. Homozygous mutant lines were screened, and the Cas9 gene was screened by PCR using the following primers:

[0076] Forward primer: GGGTAATGAACTCGCTCTGC, SEQ ID NO.15;

[0077] Reverse primer: TGGCGTCAAGAACTTCCTTTG, SEQ ID NO.16.

[0078] The amplified products, after Sanger sequencing, no longer contained the exogenous Cas9 gene and sgRNA expression element, ultimately yielding two homozygous plants, Oscps4-2 and Oscps4-11, retaining only the target gene knockout mutation. Sequencing results of the two OsCPS4 gene knockout lines at the editing target site are as follows: Figure 1 As shown.

[0079] (2) Detection of OsCPS4 gene overexpression lines

[0080] After the transplanted rice plants had set panicles, the overexpression of the OsCPS4 gene was confirmed by semi-quantitative reverse transcription polymerase chain reaction. Three generations of selection were then performed to obtain non-segregating homozygous CPS4-OE lines OE-CPS4-4 and OE-CPS4-10. The semi-quantitative primer sequences for detecting OsCPS4 gene overexpression are as follows:

[0081] Forward primer OsCPS4-RT-F: ATGCTAATAAGCAAATCACCG, SEQ ID NO.17;

[0082] Reverse primer OsCPS4-RT-R: GGCATAGAGTGTAGCACGTCTC, SEQ ID NO.18.

[0083] Example 2: Analysis of OsCPS4 gene expression pattern under salt stress in wild-type individuals

[0084] Wild-type japonica rice (Kitaake) seedlings at the two-leaf-one-heart stage were treated with 100 mM NaCl. 0.1 g of aboveground and root tissues were collected at 0 h, 3 h, 6 h, 9 h, 12 h, 24 h, 36 h, and 48 h, and flash-frozen in liquid nitrogen for OsCPS4 gene expression analysis. Total RNA was extracted from rice leaves and roots at different time points using Trizol reagent (Invitrogen, USA). cDNA was then synthesized using 5×All-in-One RTMaster Mix (ABM, Canada). TBGreen was used for the analysis. TM PreMix Ex Taq TM (TaKaRa, Japan) Quantitative reverse transcription polymerase chain reaction (RT-PCR) was performed on the QuantStudio 5 Real-Time PCR System (ABI, USA). The amplification primer sequences for OsCPS4 quantification are as follows:

[0085] qOsCPS4-F: 5'-CCCAGGCGAGGTTGAGTAT-3', SEQ ID NO.19;

[0086] qOsCPS4-R: 5'-TGAGGTACAGGTCGTTGCAG-3', SEQ ID NO. 20.

[0087] Using OsActin as an internal reference gene, the amplification primer sequences are as follows:

[0088] OsActin-F: 5'-CTCAGCACATCCAGCAGAT-3', SEQ ID NO. 21;

[0089] OsActin-R: 5'-ACAGATAGGCCGGTTGAAAA-3', SEQ ID NO. 22.

[0090] Each time point sample included three biological replicates, and each sample had three technical replicates; data were processed using 2... -ΔΔCt The data were analyzed using the method described above, and the results of the quantitative fluorescence experiment were presented in the form of mean ± standard deviation (Means ± SD).

[0091] The results are as follows Figure 2 As shown, NaCl treatment affected the expression of OsCPS4 in both the aboveground and underground parts of the plant. In the underground parts, OsCPS4 expression was continuously upregulated from 0 to 36 hours after treatment with 100 mM NaCl; while in the aboveground parts, OsCPS4 expression was downregulated from 0 to 6 hours after treatment with 100 mM NaCl, but was induced to be upregulated between 6 and 12 hours. These results indicate that the expression level of OsCPS4 responds to NaCl treatment, suggesting that the OsCPS4 gene is likely involved in the salt stress signaling pathway.

[0092] Example 3: Analysis of salt stress phenotypes in OsCPS4 gene knockout mutants and overexpression lines.

[0093] In order to further investigate whether OsCPS4 plays a role in regulating salt tolerance and the specific degree of regulation, salt stress experiments were conducted on seedlings of OsCPS4 knockout mutants Oscps4-2 and Oscps4-11 and overexpression lines OE-CPS4-4 and OE-CPS4-10.

[0094] 1. Rice material cultivation

[0095] Seeds of the wild-type japonica rice variety Kitaake, OsCPS4 gene overexpression lines (OE-CPS4-4 and OE-CPS4-10), and OsCPS4 gene knockout lines (Oscps4-2 and Oscps4-11) were selected for germination and seedling culture. The seeds were disinfected by first soaking in 70% alcohol for 1 min, then transferring to 1.5% NaClO for 30 min, followed by rinsing several times with sterile water to remove the sodium hypochlorite solution. The seeds were then sown on 1 / 2 MS medium and cultured at 28℃ for 7 days with a light / 10h illumination and a relative humidity of 65%. Once the seedlings reached a height of 4 cm, they were transplanted. Seedlings with uniform growth were selected and transferred to perforated rice culture boxes. The transplanted rice was cultured in nutrient solution (pH = 5.8) from the International Rice Research Institute, with the nutrient solution being changed every three days.

[0096] 2. Phenotypic Analysis

[0097] Rice seedlings from the Kitaake wild type, OsCPS4 gene overexpression lines (OE-CPS4-4 and OE-CPS4-10), and OsCPS4 gene knockout lines (Oscps4-2 and Oscps4-11) in Example 2 were cultured to the two-leaf-one-heart stage. They were then treated with hydroponic nutrient solution containing 100mM NaCl for 14 days, followed by recovery with normal hydroponic nutrient solution for 7 days. The salt stress phenotype was then observed and photographed, and the survival rate and water content were recorded.

[0098] Phenotypic observations were conducted on wild-type, OsCPS4 gene overexpression, and OsCPS4 gene knockout lines under salt stress treatment. The focus was on observing differences in salinization phenotypes such as leaf wilting, yellowing, curling, and dehydration. Seedling survival rate was used to evaluate salt stress tolerance. The survival rate was defined as the number of seedlings with new green leaves, and the ratio of surviving plants to the number of treated plants was also considered the seedling survival rate.

[0099] Fresh weight measurement: The aboveground parts and roots of wild-type Kitaake, Oscps4-2 and Oscps4-11 mutants and OE-CPS4-4 and OE-CPS4-10 overexpression lines were separated with a blade, and the separated aboveground parts were weighed and the data were recorded. Each six plants constituted a biological replicate, and each line included three biological replicates.

[0100] Dry weight measurement: The aboveground materials of wild-type Kitaake, Oscps4-2 and Oscps4-11 mutants and OE-CPS4-4 and OE-CPS4-10 overexpression lines, which had been weighed fresh, were dried in an oven at 65℃ until constant weight, and then weighed and recorded. Each six plants constituted a biological replicate, and each line included three biological replicates.

[0101] Survival rate analysis: After rice seedlings have grown in the recovery nutrient solution for 7 days, the survival rate of each variety is calculated by counting the number of surviving plants, based on the emergence of new leaves.

[0102] Survival rate (%) = Number of surviving plants / Total number of surviving plants before treatment × 100%

[0103] Moisture content analysis: The moisture content of each strain was calculated by statistically analyzing the dry weight and fresh weight. Moisture content (%) = (fresh weight - dry weight) / fresh weight × 100%.

[0104] The results are as follows Figure 3 and Figure 4 As shown, under normal nutrient solution culture conditions, there was no significant difference in growth between Oscps4-2 and Oscps4-11 mutants and OE-CPS4-4 and OE-CPS4-10 overexpression lines. Two-week-old seedlings of wild-type (Kitaake), OsCPS4 gene knockout lines, and OsCPS4 gene overexpression lines were treated with 100 mM NaCl for 14 days. Wild-type Kitaake, gene knockout mutants, and overexpression lines all showed varying degrees of wilting, but the mutants Oscps4-2 and Oscps4-11 showed more severe wilting than the wild-type, while the overexpression materials showed the opposite. When the lines treated with salt for 14 days were transferred to normal nutrient solution for 7 days of recovery, most OsCPS4 gene knockout mutant lines failed to recover growth, while some overexpression lines were able to recover growth. Figure 3 Further analysis of survival rates revealed that the wild-type survival rate was 42%, while the survival rates of the gene knockout mutant lines Oscps4-2 and Oscps4-11 were 27% and 31%, respectively, significantly lower than the wild-type. The overexpression lines OE-CPS4-4 and OE-CPS4-10 had survival rates of 67% and 70%, respectively, significantly higher than the wild-type. Figure 4 Further statistical analysis of water content revealed no significant difference in water content among the strains under normal conditions. Under 100 mM NaCl treatment, the water contents of Oscps4-2 and Oscps4-11 were 63% and 73%, respectively, lower than the wild type (79%). The water contents of OE-CPS4-4 and OE-CPS4-10 strains were 82% and 81%, respectively, higher than the wild type (A). Figure 4 (B). In summary, both overexpression lines showed better salt tolerance than the wild type, while the Oscps4 loss-of-function mutant line showed a salt-sensitive phenotype compared to the wild type, indicating that OsCPS4 may be involved in the salt stress response process and positively regulate salt stress.

[0105] Example 4: Na in rice seedlings under salt stress + and K + Physiological index analysis

[0106] Rice seedlings from the Kitaake wild-type, OsCPS4 gene overexpression lines (OE-CPS4-4 and OE-CPS4-10), and OsCPS4 gene knockout lines (Oscps4-2 and Oscps4-11) in Example 2 were cultured to the two-leaf-one-heart stage. They were then treated with a hydroponic nutrient solution containing 100 mM NaCl for 14 days, followed by recovery with normal hydroponic nutrient solution for 7 days. Aboveground and underground samples were collected, dried to constant weight in a 65℃ oven, and ground into powder using a mortar and pestle. 0.1 g of the powder was weighed into a 10 mL tube, dissolved in 10 mL of 1% (V / V) HCl, and soaked overnight at 200 rpm on a shaker at 28℃. The sample was filtered through a 0.22 μm filter into a new 10 mL tube to prepare a stock solution. NaCl was measured using a microwave inductively coupled plasma atomic emission spectrometer (MICAPS) 4100 MP-AE. + and K + Content. All data are from three independent replicate experiments. Graphs were plotted using GraphpadPrism software, and error analysis was performed using SPSS software.

[0107] The sodium and potassium ion content of OsCPS4-related materials was determined under 100 mM NaCl treatment conditions, and the results are as follows: Figure 5 As shown, under normal nutrient solution culture conditions, the Na+ content in the aboveground parts of Oscps4-2 and Oscps4-11 loss-of-function mutant plants... + Content and Na + / K + The ratios were not significantly different from those of the wild-type lines, but under 100 mM NaCl treatment, the Na+ ratios of all lines increased. + The contents of all three types of Na were significantly increased, with wild-type Na being particularly high. + The Na content was 24.76 mg / g, which was found in the aboveground parts of the two loss-of-function mutant lines Oscps4-2 and Oscps4-11. + The contents were 33.04 mg / g and 29.70 mg / g, respectively, significantly higher than those of the wild-type plant. Figure 5 A); K in the loss-of-function mutant lines Oscps4-2 and Oscps4-11 + The contents were 54.66 mg / g and 54.43 mg / g, respectively, significantly lower than those of the wild-type plant (95.57 mg / g). Figure 5 of B); Na + / K + The ratios were 0.64 and 0.51, respectively, which were also significantly higher than those of the wild-type plant (0.23). Figure 5 C);

[0108] Na in the aboveground parts of overexpression lines OE-CPS4-4 and OE-CPS4-10+ The contents were 12.64 mg / g and 9.70 mg / g, respectively, significantly lower than those of the wild type ( Figure 5 A), K + The contents were 73.38 mg / g and 76.96 mg / g, respectively, significantly lower than those of the wild-type plant. Figure 5 B), Na + / K + The ratios were 0.17 and 0.12, respectively, which were also significantly lower than those of the wild-type plants. Figure 5 (C); Analysis of its underground data revealed that the underground data showed a similar trend to the above-ground data (C). Figure 5 These results indicate that the Oscps4-2 and Oscps4-11 mutants are more sensitive to salt stress and that the Na+ content in the mutants is related to their DF (digestive capacity). + Increased content, K + This is related to a decrease in content.

[0109] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.

Claims

1. A method for improving the salt tolerance of plants, characterized in that, The method includes the step of introducing the OsCPS4 gene into the plant to achieve stable overexpression of the OsCPS4 gene; the nucleotide sequence of the OsCPS4 gene is shown in SEQ ID NO.

1. The plant in question is rice; The salt is NaCl.

2. The application of the OsCPS4 gene in the cultivation of highly salt-tolerant plants, characterized in that... Overexpression of the OsCPS4 gene enhances plant salt tolerance; the nucleotide sequence of the OsCPS4 gene is shown in SEQ ID NO.

1. The plant in question is rice; The salt is NaCl.

3. A method for cultivating highly salt-tolerant plants, characterized in that, The method includes the step of introducing the OsCPS4 gene into the plant to obtain a plant that can stably overexpress the OsCPS4 gene; the nucleotide sequence of the OsCPS4 gene is shown in SEQ ID NO.1; The plant in question is rice; The salt is NaCl.

Images