Application of OsUBC27 gene or its encoded protein in improving salt tolerance in rice
By silencing or overexpressing the OsUBC27 gene in rice and regulating its salt tolerance, the problem of rice growth inhibition under salt stress was solved, and the salt tolerance and yield of rice were improved.
Patent Information
- Application Number
- CN202510960584.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-07-11
- Publication Date
- 2025-09-23
- Estimated Expiration
- 2045-07-11
AI Technical Summary
Under salt stress, rice growth is inhibited, cell ion imbalance and nutrient imbalance occur, leading to physiological metabolic disorders and reduced yield. Existing technologies make it difficult to effectively improve its salt tolerance.
By silencing or overexpressing the OsUBC27 gene or its encoded protein in rice, RNA interference or antisense RNA technology is used to regulate the salt tolerance of rice. The protein encoded by the OsUBC27 gene has a ubiquitin-binding enzyme UBCc domain and is involved in plant stress response.
It improves the salt tolerance of rice, enhances its resistance to salt stress, and improves its growth conditions and yield.
Smart Images

Figure FT_1 
Figure FT_2 
Figure FT_3
Abstract
Description
Technical Field
[0001] This specification relates to the field of biological gene technology, and in particular to the use of an OsUBC27 gene or its encoded protein in improving the salt tolerance of rice. Background Art
[0002] Rice is one of the most important food crops in the world, and more than half of the world's population relies on rice as their staple food.
[0003] Soil salinization is one of the major factors restricting the development of rice production worldwide. The main effects of salt stress on rice are osmotic water shortages caused by increased salt concentrations, which make it difficult for rice to absorb water and rapidly slow its physiological metabolic processes. Excessive concentrations of sodium and chloride ions inhibit rice's absorption of other nutrients (such as potassium and calcium), leading to cellular ion imbalance and nutrient imbalance. Rice cells produce large amounts of reactive oxygen species, exacerbating membrane lipid peroxidation, destroying the structure of rice cells and organelles, and causing metabolic disorders. Photosynthesis is reduced, and the supply of assimilates and energy decreases, affecting rice growth, development, and yield. As the preferred crop for saline-alkali land improvement, in-depth research on the mechanism of rice salt tolerance, exploring and analyzing the key factors and molecular regulatory pathways of rice's response to salt stress, and improving rice salt tolerance through genetic improvement are effective ways to expand the cultivated area of saline-alkali land, improve salinized soils, and increase rice yield.
[0004] Based on this, the embodiments of this specification provide an application of the OsUBC27 gene or the encoded protein in improving the salt tolerance of rice. Summary of the Invention
[0005] To solve the above technical problems, the embodiments of this specification are implemented as follows:
[0006] The present invention provides an application of an OsUBC27 gene or its encoded protein in improving salt tolerance of rice. The nucleotide sequence of the OsUBC27 gene is shown in SEQ ID NO: 1.
[0007] The amino acid sequence of the protein encoded by the OsUBC27 gene is shown in SEQ ID NO: 2;
[0008] The protein encoded by the OsUBC27 gene contains a low complexity region and a ubiquitin-conjugating enzyme UBCc domain. The low complexity region is the 17th to 34th amino acid residues of the protein encoded by the OsUBC27 gene, and the ubiquitin-conjugating enzyme UBCc domain is the 50th to 191st amino acid residues of the OsUBC27 protein.
[0009] Furthermore, the amino acid sequence of the protein encoded by the OsUBC27 gene is substituted, and / or deleted, and / or one or more amino acids are added, and the protein derived from SEQ ID NO: 2 has the same function.
[0010] Furthermore, the protein encoded by the OsUBC27 gene is a salt tolerance-related protein, and the protein encoded by the OsUBC27 gene is expressed by fusion with a tag;
[0011] in,
[0012] The tag is any one of Poly-Arg, Poly-His, FLAG, Strep-tag II, and c-myc.
[0013] Furthermore, the protein encoded by the OsUBC27 gene negatively regulates rice salt tolerance.
[0014] Furthermore, the silencing of the OsUBC27 gene or the protein encoded by it in rice can obtain transgenic plants with improved salt tolerance of rice.
[0015] Furthermore, the silencing of the OsUBC27 gene or the protein encoded by it in rice is achieved by RNA interference or antisense RNA.
[0016] The present specification also provides a method for improving salt tolerance of rice, characterized in that the OsUBC27 gene or the protein encoded by it is silenced in rice, wherein the nucleotide sequence of the OsUBC27 gene is shown in SEQ ID NO: 1;
[0017] The amino acid sequence of the protein encoded by the OsUBC27 gene is shown in SEQ ID NO: 2.
[0018] This study identifies for the first time that expression of the rice ubiquitin ligase protein OsUBC27 gene can reduce seedling tolerance to salt stress and improve rice salt tolerance. Furthermore, when exposed to abiotic stresses such as salt, the overexpressing transgenic strains show increased growth inhibition compared to the wild type after a period of stress treatment. The protein and its encoding gene of this invention have important theoretical and practical implications for the study of plant stress tolerance mechanisms and for improving plant stress tolerance. They will play an important role in crop genetic breeding and have broad application prospects. BRIEF DESCRIPTION OF THE DRAWINGS
[0019] In order to more clearly illustrate the embodiments of this specification or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments or the description of the prior art. Obviously, the drawings described below are only some embodiments recorded in this specification. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative labor.
[0020] Figure 1 Shown are the results of analysis of the inducible expression characteristics of the OsUBC27 gene;
[0021] Figure 2 Shown are the statistical results of yield traits of OsUBC27 CRISPR / CAS9 gene-edited mutants and overexpression transgenic plants;
[0022] Figure 3 Shown are the phenotypes of OsUBC27 CRISPR / CAS9 gene-edited mutants and overexpressing transgenic plants subjected to salt stress. DETAILED DESCRIPTION
[0023] In order to help those skilled in the art better understand the technical solutions in this specification, the technical solutions in the embodiments of this specification will be clearly and completely described below in conjunction with the drawings in the embodiments of this specification. Obviously, the embodiments described are only part of the embodiments of this application, not all of the embodiments. Based on the embodiments of this specification, all other embodiments obtained by ordinary technicians in this field without making creative efforts should fall within the scope of protection of this application.
[0024] The experimental methods used in the examples of this specification are conventional methods unless otherwise specified. The experimental materials used are commercially available unless otherwise specified.
[0025] The present invention provides an application of an OsUBC27 gene or its encoded protein in improving salt tolerance of rice. The nucleotide sequence of the OsUBC27 gene is shown in SEQ ID NO: 1.
[0026] The amino acid sequence of the protein encoded by the OsUBC27 gene is shown in SEQ ID NO: 2;
[0027] The protein encoded by the OsUBC27 gene contains a low complexity region and a ubiquitin-conjugating enzyme UBCc domain. The low complexity region is the 17th to 34th amino acid residues of the protein encoded by the OsUBC27 gene, and the ubiquitin-conjugating enzyme UBCc domain is the 50th to 191st amino acid residues of the OsUBC27 protein.
[0028] A protein derived from SEQ ID NO: 2 having the same function as that of a protein encoded by the OsUBC27 gene, wherein the amino acid sequence of the protein is substituted, and / or deleted, and / or one or more amino acids are added.
[0029] In the examples of this specification, the protein encoded by the OsUBC27 gene is a salt tolerance-related protein, and the protein encoded by the OsUBC27 gene is expressed by fusion with a tag;
[0030] in,
[0031] The tag is any one of Poly-Arg, Poly-His, FLAG, Strep-tag II, and c-myc.
[0032] Specifically, the tag sequence is shown in Table 1, and the tag sequence can be connected to the amino terminus or carboxyl terminus of the OsUBC27 gene.
[0033] Table 1 Tag sequences
[0034]
[0035] Example 1 Analysis of OsUBC27 gene inducible expression characteristics
[0036] 1. Four-day-old wild-type rice (Nip) seedlings were treated with salt (120 mM NaCl), low temperature (4 ℃), polyethylene glycol (20% PEG), abscisic acid (10 μM ABA), ethylene (10 μM ACC), and gibberellin (20 μM GA3). Roots were harvested at 0 h, 30 min, 1 h, 2 h, 3 h, 4 h, 6 h, and 8 h after treatment. mRNA was extracted and reverse transcribed to obtain cDNA. The expression level of the OsUBC27 gene was analyzed by fluorescence quantitative PCR using specific primer pairs XF and XR.
[0037] The specific primer pair XF is shown in SEQ ID NO: 3; the specific primer pair XR is shown in SEQ ID NO: 4
[0038] Test results such as Figure 1 As shown, the OsUBC27 gene was inhibited by salt (NaCl), low temperature (4 ℃), polyethylene glycol (PEG), and gibberellin (GA3), and induced by ethylene (ACC) and abscisic acid (ABA), indicating that the OsUBC27 gene is involved in plant hormone and adverse stress responses.
[0039] Example 2: Obtaining OsUBC27 mutants and overexpressing transgenic plants
[0040] 1. Creation of OsUBC27 CRISPR / CAS9 gene-edited mutants
[0041] SEQ ID NO: 5 was used as the target site for the OsUBC27 gene, which was ligated to the CAS9-containing vector pHUN4c12. The constructed vector was transformed into Agrobacterium tumefaciens EHA105 and then into the Nip variety via callus infection to obtain gene-edited mutants. Two of the gene-edited mutant lines, ubc27-1 and ubc27-2, were generated. Ubc27-1 had an A inserted after position 18 in the coding region, while ubc27-2 had a C inserted after position 20. Both mutations resulted in premature termination of protein translation after a frameshift.
[0042] 3. Creation of OsUBC27 overexpression vector transgenic lines
[0043] The full-length OsUBC27 gene was amplified using the specific primer pair ZF / ZR and ligated into the Cam35S-GFP vector using seamless cloning. The constructed vector was transformed into Agrobacterium tumefaciens EHA105 and then into the Nip variety via callus infection, resulting in two overexpression strains, OE1 and OE2, expressing OsUBC27 at 10-15 times the level in wild-type Nip.
[0044] The ZF primer sequence is shown in SEQ ID NO: 6; the ZR primer sequence is shown in SEQ ID NO: 7, wherein the cgggggacgagctcgggtacc sequence in the ZF primer sequence is the recombinant Cam35S-GFP vector sequence, and the cttgctcaccatggtgtcgac sequence in the ZR primer sequence is the recombinant Cam35S-GFP vector sequence.
[0045] Example 3: Yield Trait Analysis of OsUBC27-Related Mutants and Overexpressing Transgenic Plants
[0046] Yield traits of the OsUBC27 CRISPR / CAS9 gene-edited mutants ubc27-1 and ubc27-2, and overexpressing transgenic plants OE1 and OE2 were analyzed, and panicle traits at maturity were statistically analyzed. Compared with the wild-type Nip, the mutants showed increased grain length, decreased width, and decreased 1000-grain weight and yield per plant. However, the overexpressing plants showed no difference in grain length, width, and 1000-grain weight from Nip, but significantly higher yield per plant than Nip, indicating that OsUBC27 can increase rice yield. Figure 2 shown.
[0047] Example 4: Analysis of salt tolerance of OsUBC27-related mutants and overexpressing transgenic plants
[0048] The salt tolerance of the OsUBC27 CRISPR / CAS9 gene-edited mutants ubc27-1 and ubc27-2 and the overexpressing transgenic plants OE1 and OE2 were identified at the seedling stage. Seeds with uniform germination were soaked at 37°C for one day and then germinated. Seeds with uniform germination were selected and planted in 96-well plates for hydroponics. After culturing in Yashida medium for three days, the nutrient solution was replaced with 50 mM NaCl for treatment. The control group continued to be cultured in Yashida medium and grew to the two-leaf and one-core stage. The aboveground height and fresh weight were calculated. The aboveground height and fresh weight of the OsUBC27 mutant and overexpressing lines cultured in Yashida medium were not different from those of Nip. However, under 50 mM NaCl treatment, the aboveground height of the OsUBC27 mutant was not different from that of Nip, and the aboveground fresh weight was slightly higher than that of Nip. The aboveground height and fresh weight of the OsUBC27 overexpressing lines were significantly lower than those of Nip, indicating that OsUBC27 negatively regulates salt tolerance in rice seedlings. Figure 3 shown.
[0049] In the examples of this specification, the protein encoded by the OsUBC27 gene negatively regulates rice salt tolerance.
[0050] In the examples of this specification, the OsUBC27 gene or the protein it encodes in rice is silenced to obtain transgenic plants with improved salt tolerance of rice.
[0051] In the examples of this specification, the silencing of the OsUBC27 gene or the protein encoded by it in rice is achieved by RNA interference or antisense RNA.
[0052] The present specification also provides a method for improving salt tolerance of rice, characterized in that the OsUBC27 gene or the protein encoded by it is silenced in rice, wherein the nucleotide sequence of the OsUBC27 gene is shown in SEQ ID NO: 2;
[0053] The amino acid sequence of the protein encoded by the OsUBC27 gene is shown in SEQ ID NO: 2.
[0054] This study identifies for the first time that expression of the rice ubiquitin ligase protein OsUBC27 gene can reduce seedling tolerance to salt stress and improve rice salt tolerance. Furthermore, when exposed to abiotic stresses such as salt, the overexpressing transgenic strains show increased growth inhibition compared to the wild type after a period of stress treatment. The protein and its encoding gene of this invention have important theoretical and practical implications for the study of plant stress tolerance mechanisms and for improving plant stress tolerance. They will play an important role in crop genetic breeding and have broad application prospects.
[0055] The various embodiments in this specification are described in a progressive manner. Similar parts between the various embodiments can be referred to in conjunction with each other. Each embodiment focuses on the differences between the other embodiments. In particular, the system embodiments are generally similar to the method embodiments, so the description is relatively simple. For relevant parts, refer to the description of the method embodiments.
[0056] The foregoing is merely an embodiment of the present invention and is not intended to limit the present application. For those skilled in the art, various modifications and variations may be made to the present application. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principles of the present application should be included within the scope of the claims of the present application.
Claims
1. OsUBC27 The application of a gene or a coded protein in improving salt tolerance of rice is characterized in that: described OsUBC27 The nucleotide sequence of the gene is shown in SEQ ID NO: 1; described OsUBC27 The amino acid sequence of the protein encoded by the gene is shown in SEQ ID NO: 2; described OsUBC27 The protein encoded by the gene contains a low complexity region and a ubiquitin conjugating enzyme UBCc domain, wherein the low complexity region is the OsUBC27 The 17th to 34th amino acid residues of the protein encoded by the gene, the ubiquitin-conjugating enzyme UBCc domain is the 50th to 191th amino acid residues of the OsUBC27 protein; described OsUBC27 The protein encoded by the gene negatively regulates salt tolerance in rice.
2. The use according to claim 1, characterized in that described OsUBC27 Gene-encoded protein is expressed in fusion with a tag; in, The tag is any one of Poly-Arg, Poly-His, FLAG, Strep-tag II, and c-myc.
3. The use according to claim 1, characterized in that Silencing rice OsUBC27 The gene or the protein it encodes is used to obtain mutant plants with improved salt tolerance in rice.
4. The use according to claim 3, characterized in that The silenced rice OsUBC27 The gene or its encoded protein is edited by CRISPR / CAS9 in the OsUBC27 gene.
5. A method for improving salt tolerance of rice, characterized in that: Silence in the rice OsUBC27 gene or its encoded protein, the OsUBC27 The nucleotide sequence of the gene is shown in SEQ ID NO: 1; described OsUBC27 The amino acid sequence of the protein encoded by the gene is shown in SEQ ID NO: 2.