Kit for detecting thyroglobulin gene and application

Abstract

The invention relates to the technical field of biological detection, in particular to a kit for detecting thyroglobulin genes and application. The composition for detecting thyroid cancer neck lymph node metastasis comprises a specific detection primer pair aiming at thyroglobulin genes, the primer pair comprises an upstream primer and a downstream primer, and the sequences of the upstream primer and the downstream primer are shown as SEQ ID NO: 1-2. The invention further comprises a kit for detecting thyroid cancer neck lymph node metastasis, the primer probe of the kit is designed in an area with stable RNA and not easy to degrade, the kit has higher detection sensitivity for low-quality RNA samples, the detected false negative is reduced, the overall detection performance is improved, a positive judgment value is delimited by delta Ct through one-step multiple qPCR, and the detection sensitivity is improved. The accuracy of the detection result reaches 98.6%, and the kit has a clear positive judgment value and is convenient for clinical application.

Description

Technical Field

[0001] The present invention relates to the technical field of biological detection, and in particular to a kit for detecting thyroglobulin gene and its application. Background Art

[0002] Lymph node metastasis in thyroid cancer is crucial for patient management. Preoperative evaluation of suspected malignant thyroid tumor metastasis and postoperative follow-up of cervical lymph node metastasis in thyroid cancer patients can effectively guide clinical management strategies.

[0003] Thyroglobulin (TG) is specifically expressed in thyroid follicular cells and can be expressed continuously when tumor cells originating from thyroid follicular cells metastasize. Thyroid cancer is the solid malignancy with the fastest annual growth rate, represented by papillary thyroid carcinoma (PTC) and follicular thyroid carcinoma (FTC), which account for more than 90% of cases, of which PTC accounts for 85%. In most cases, it has a satisfactory long-term survival rate, but there is a certain risk of spread and metastasis. Approximately 12-80% of PTC patients may develop cervical lymph node metastasis in the early stage or during postoperative follow-up. Cervical lymph node metastasis is closely related to the poor prognosis of thyroid cancer, increasing the risk of local recurrence and reducing the overall survival rate. For suspicious lymph nodes on ultrasound imaging, TG mRNA expression detection can be performed simultaneously with FNA cytology examination to increase the accuracy of diagnosis of metastatic lymph nodes.

[0004] Currently, follow-up methods mainly combine clinical symptoms, signs, ultrasound, and lymph node puncture cytology. Ultrasound can accurately identify metastatic lymph nodes, but suspicious ultrasound features (including calcification, cystic changes, peripheral or diffuse blood vessels, and echogenicity) are not specific, cannot be quantitatively described, and are highly dependent on the operator. Combining fine needle aspiration (FNA) cytology (FNAC) can improve diagnostic capabilities, but the non-diagnostic rate of this method is still 5-10%, and the false negative rate is 6-8%; in addition, for small lymph nodes, aspiration is difficult, and it is difficult to obtain a sufficient amount of cells for cytological diagnosis, and the aspirated cells will also contain some complex cytological features, making the sensitivity of FNAC unsatisfactory (75-85%). Therefore, there is currently a lack of effective means to predict cervical lymph node metastasis of thyroid cancer.

[0005] Currently, serum TG protein levels are sometimes used during postoperative follow-up to assess whether lymph node metastasis has occurred. However, thyroglobulin antibodies (TGAb) are present in 10% of normal individuals, and 20-40% of thyroid cancer patients have TGAb antibodies. Therefore, the presence of TGAb antibodies can interfere with TG detection, resulting in decreased sensitivity and specificity of TG detection. If the thyroid gland is not completely removed, serum TG does not represent the lymph node FNA-TG level. This makes it difficult to use TG to standardize the diagnosis of thyroid cancer metastasis. In particular, there is currently no TG diagnostic method for lymph node tissue fluid.

[0006] In contrast, the expression spectrum at the transcriptional level can more directly indicate whether thyroid follicular epithelial cells are present in the lymph node tissue. Quantitative analysis of metastasis marker mRNA is a test at the gene level and is a more sensitive means of early diagnosis of cancer cell proliferation. Real-time fluorescence quantitative PCR (RT-qPCR) is the gold standard method for quantitative detection of mRNA. RT-qPCR has relatively low sample volume requirements and can be detected with a small amount of tissue, which is especially suitable for the detection of FNA samples. This can improve the diagnostic efficiency in postoperative follow-up, especially in cases where the sample is insufficient or atypical, providing a quantitative diagnostic basis and avoiding diagnostic surgery. There are reports at home and abroad that use reverse transcription PCR (RT-PCR) to detect the expression level of TG or TSH-R, and display the test results by agarose gel electrophoresis, but this method cannot quantify and obtain the positive judgment value required for clinical application; there are also studies that use RT-qPCR to detect the expression of TG, but a more complex algorithm is required (2 -ΔΔCt The results were interpreted by the PCR method, and its accuracy was also unsatisfactory, less than 80%.

[0007] In addition, for the preservation of lymph node fine needle aspiration samples, the hospital generally uses RNAstore / RNAlater, liquid-based cell preservation fluid, etc. Except for specific preservation fluids such as RNAstore / RNAlater that are specifically for RNA detection samples, other preservation fluids contain organic solvents such as formaldehyde and methanol, which have a great damage to the integrity of the RNA molecules in the sample. Often only certain regional fragments will be preserved intact, and most areas will be degraded to varying degrees. The reverse transcription system and amplification primer design of the detection methods or kits reported in the past are based on conventional design rules, and are mainly designed for samples with good RNA quality. They do not take into account the situation in actual clinical application scenarios where most preservation fluids will significantly damage the quality of RNA samples. Therefore, in order to meet real clinical needs and better match existing clinical diagnosis and treatment scenarios, it is urgently necessary to develop a TG RNA detection kit with a higher tolerance for RNA sample quality and greater durability and robustness. Summary of the Invention

[0008] In view of the shortcomings of the prior art described above, the purpose of the present invention is to provide a kit and application for detecting the thyroglobulin gene, which is used to solve the problems of low sensitivity, low stability and specificity, poor durability and robustness, high cost, and complex operation in the prior art for detecting most poor RNA quality samples in real clinical application scenarios, and provide a clinical molecular diagnostic basis for cervical lymph node metastasis of thyroid cancer.

[0009] To solve the above technical problems, the first aspect of the present invention provides a composition for detecting cervical lymph node metastasis of thyroid cancer, wherein the composition comprises a specific detection primer pair for the thyroglobulin gene, the primer pair comprising an upstream primer and a downstream primer, and the sequences of the upstream primer and the downstream primer are as shown in SEQ ID NOs: 1 to 2.

[0010] A second aspect of the present invention provides a kit for detecting cervical lymph node metastasis of thyroid cancer, wherein the kit comprises the aforementioned composition.

[0011] The third aspect of the present invention provides use of the aforementioned composition and the aforementioned kit in preparing a product for detecting thyroid cervical lymph node metastasis.

[0012] In summary, the present invention discloses a kit for detecting thyroglobulin gene and its application, and achieves the following beneficial effects:

[0013] 1) The present invention provides a biomarker thyroglobulin gene for diagnosing thyroid cancer lymph node metastasis, and a primer probe composition for detecting the expression of the target gene and the internal reference gene β-2-microglobulin (B2M), wherein the primer probe composition is designed in an area where RNA is stable and not easily degraded, has a higher sensitivity for detecting low-quality RNA samples, can still efficiently detect in samples that have undergone severe degradation, has better compatibility with samples of poor quality, reduces false negatives, improves overall detection performance, and avoids missed detections and medical accidents caused thereby. The present invention has significantly higher accuracy and stability in detecting targets of samples preserved in liquid-based cell preservation fluid than existing systems. The overall performance of the kit is significantly better than that of reported reaction systems for detecting low-quality RNA samples, is more suitable for real clinical application scenarios, and has a higher cost-effectiveness;

[0014] 2) This invention uses one-step RT-qPCR technology, performing both reverse transcription and PCR amplification simultaneously in a single reaction system, which reduces contamination risks and reduces time and economic costs. Furthermore, a dual PCR reaction system is used to simultaneously detect the relative expression levels of the target gene and an internal reference gene in a single reaction tube, simplifying the process and improving both the accuracy of the results and the detection throughput. The efficient and rapid reverse transcription system employed in the reaction provides high detection sensitivity.

[0015] 3) The kit of the present application uses single-target TG RNA detection, which is lower in cost; special additives are added to the reaction system to improve the reverse transcription efficiency; the positive judgment value of the kit of the present application uses the ΔCt algorithm, which makes the result interpretation simpler and more efficient.

[0016] 4) The present invention is the first to construct a diagnostic product based on TG for detecting cervical lymph node metastasis of thyroid cancer. The present invention uses a one-step multiplex qPCR method and uses ΔCt to define the positive judgment value, and the detection result reaches 98.6% accuracy. The detection performance of the present invention is significantly higher than the 71.4%, 73% and 88% reported in the relevant literature. In addition, the ease of application of the present invention is much better than agarose electrophoresis and 2 -ΔΔCt This method does not require additional electrophoresis instruments or complex algorithms, has a clear positive judgment value, and is easy to use in clinical practice. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1-1 This is the amplification curve diagram of the duplex PCR system of Group 1 in Example 1 of the present application, the blue is the TG gene amplification curve, and the green is the internal reference gene amplification curve.

[0018] Figure 1-2 This is the amplification curve diagram of the duplex PCR system of Group 2 in Example 1 of the present application, the blue is the TG gene amplification curve, and the green is the internal reference gene amplification curve.

[0019] Figure 1-3 This is the amplification curve diagram of the duplex PCR system of Group 3 in Example 1 of the present application, the blue is the TG gene amplification curve, and the green is the internal reference gene amplification curve.

[0020] Figure 2 This is the amplification curve diagram of the double PCR system of the positive control group in Example 4 of the present application, the blue is the TG gene amplification curve, and the green is the internal reference gene amplification curve.

[0021] Figure 3 This is a graph of the amplification curves of the duplex PCR system in the sample with a positive pathological result in Example 4 of the present application. The blue color represents the amplification curve of the TG gene, and the green color represents the amplification curve of the internal reference gene.

[0022] Figure 4 This is a graph of the amplification curves of the duplex PCR system in the sample with a negative pathological result in Example 4 of the present application. The blue color represents the amplification curve of the TG gene, and the green color represents the amplification curve of the internal reference gene. DETAILED DESCRIPTION

[0023] The following is a clear and complete description of the technical solution of the present invention. Obviously, the embodiments described are only some embodiments of the present invention, not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making any creative efforts are within the scope of protection of the present invention.

[0024] Before further describing the specific embodiments of the present invention, it should be understood that the scope of protection of the present invention is not limited to the specific specific embodiments described below; it should also be understood that the terms used in the examples of the present invention are for describing specific specific embodiments rather than for limiting the scope of protection of the present invention; in the present specification and claims, unless otherwise expressly stated herein, the singular forms "a", "an" and "the" include plural forms.

[0025] When the embodiments provide numerical ranges, it should be understood that, unless otherwise specified in the present invention, both endpoints of each numerical range and any numerical value between the two endpoints may be selected. Unless otherwise defined, all technical and scientific terms used in the present invention have the same meaning as those generally understood by those skilled in the art. In addition to the specific methods, equipment, and materials used in the embodiments, according to the understanding of the prior art by those skilled in the art and the description of the present invention, any methods, equipment, and materials of the prior art similar or equivalent to the methods, equipment, and materials described in the embodiments of the present invention may also be used to implement the present invention.

[0026] During the process of screening a large number of primer probes for detecting the thyroglobulin gene, this study accidentally discovered that the kit composed of the primer probes of this application can have better compatibility with samples of poor quality and improve the overall detection performance. On this basis, this application was completed.

[0027] The present invention first provides a composition for detecting cervical lymph node metastasis of thyroid cancer, which comprises a specific detection primer pair for the thyroglobulin gene. The primer pair comprises an upstream primer and a downstream primer. The sequences of the upstream primer and the downstream primer are shown in SEQ ID NOs: 1-2.

[0028] In another embodiment of the present application, the above composition further comprises a specific detection probe for the thyroglobulin gene, and the probe sequence is shown in SEQ ID NO: 5.

[0029] The specific detection primer pair for the thyroglobulin gene (TG) is shown in SEQ ID NO: 1-2:

[0030] SEQ ID NO: 1 Thyroglobulin gene (TG) upstream primer

[0031] CTCTGAAGCCTGGGCTAATG

[0032] SEQ ID NO: 2 Thyroglobulin gene (TG) downstream primer

[0033] CCTGCTGAAAATTGGTAAAGG

[0034] The specific detection probe for the thyroglobulin gene (TG) has a sequence as shown in SEQ ID NO: 5:

[0035] SEQ ID NO: 5 Thyroglobulin gene (TG) probe

[0036] (FAM)TGTGACATATGACCAGGAGAGCCACC(BHQ1);

[0037] In another embodiment of the present application, the above-mentioned composition further includes specific detection primers and specific detection probes for the internal reference gene β-2-microglobulin (B2M), and the above-mentioned internal reference primer pair includes an upstream primer and a downstream primer, wherein: the sequences of the upstream primer and the downstream primer are as shown in SEQ ID NOs: 3 to 4; the TaqMan probe sequence is as shown in SEQ ID NO: 6.

[0038] The primer pair for the internal reference gene β-2-microglobulin (B2M) has the sequence shown in SEQ ID NOs: 3-4:

[0039] SEQ ID NO: 3 β-2-microglobulin (B2M) upstream primer

[0040] CCACTGAAAAAGATGAGTATGCCT

[0041] SEQ ID NO: 4β-2-microglobulin (B2M) downstream primer

[0042] CCAATCCAAATGCGGCATCTTCA

[0043] The probe for β-2-microglobulin (B2M) has a sequence as shown in SEQ ID NO: 6:

[0044] SEQ ID NO: 6 beta-2-microglobulin (B2M) probe

[0045] (VIC)CCTCCATGATGCTGCTTACATGTCTCG(TAMRA)

[0046] The probe used in the present invention is a Taqman probe, with a fluorescent reporter group added to the 5' end and a fluorescent quencher group added to the 3' end. The fluorescent reporter group is selected from one or more of FAM, HEX, TET, JOE, CY3, CY5, ROX, Texas Red, or ROX, and the fluorescent quencher group is selected from BHQ or ECLIPSE. In some embodiments, when the fluorescent reporter group is selected from FAM, HEX, TET, JOE, CY3, CY5, ROX, TAMRA, or Texas Red, the corresponding fluorescent quencher group is BHQ. In some embodiments, when the fluorescent reporter group is selected from FAM, HEX, TET, JOE, TAMRA, or ROX, the corresponding fluorescent quencher group is ECLIPSE. As a further improvement of the present invention, the fluorescent reporter group FAM is added to the 5' end of the TG probe, and the fluorescent quencher group BHQ-1 is added to the 3' end; the fluorescent reporter group VIC is added to the 5' end of the B2M probe, and the fluorescent quencher group TAMRA is added to the 3' end.

[0047] The present invention also provides a kit for detecting thyroglobulin gene, which comprises the above composition.

[0048] In the embodiments of the present application, the above-mentioned kit uses cervical lymph node puncture samples as the detection object.

[0049] In a specific embodiment, the kit further comprises a PCR reaction solution, a primer-probe mixture, a reaction enzyme solution, a positive control substance, and a negative control substance.

[0050] In the entire detection system, the working concentration of the primers in the composition can be 200-240, 240-280, 280-320, 320-360, 360-400 nM, specifically 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 400 nM. Preferably, it is 200-400 nM. As a further improvement of the present invention, the working concentration of each upstream and downstream primer of TG is 400 nM; the working concentration of each upstream and downstream primer of B2M is 200 nM.

[0051] The working concentration of each probe is 100-200 nM; it can be 100-120, 12-140, 140-160, 160-180, 180-200 nM; specifically, it can be 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200 nM. Preferably, it is 150-200 nM. As a further improvement of the present invention, the working concentration of each probe for TG is 150 nM; the working concentration of each probe for B2M is 200 nM.

[0052] The PCR reaction solution of the present invention comprises dNTPs, dUTP, a buffer solution and additives required for a real-time fluorescence quantitative PCR (RT-qPCR) detection reagent reaction.

[0053] In the entire RT-qPCR detection system, the working concentration of dNTPs is 0.05-0.3 mM, and can be 0.05, 0.10, 0.15, 0.20, or 0.30 mM. In a preferred embodiment, the working concentration of dNTPs is 0.2 mM.

[0054] In the entire RT-qPCR detection system, the working concentration of dUTP is 0.025-0.3 mM, and can be 0.025, 0.05, 0.10, 0.15, 0.20, 0.25, or 0.30 mM. In a preferred embodiment, the working concentration of dUTP is 0.15 mM.

[0055] In the entire RT-qPCR detection system, there is no limitation on the composition of the buffer, as long as it is a buffer suitable for RT-qPCR reactions. In some preferred embodiments, the buffer is composed of Tris-HCl, KCl, MgCl2, and (NH4)2SO4. In some more preferred embodiments, the buffer is composed of 20mM Tris-HCl (pH 8.0), 50mM KCl, 3mM MgCl2, and 5mM (NH4)2SO4 at a working concentration.

[0056] In a preferred embodiment, the additive is selected from bovine serum albumin.

[0057] In the entire RT-qPCR detection system, the working concentration of the bovine serum albumin is 300-500 μg / mL. In a preferred embodiment, the working concentration of the bovine serum albumin is 500 μg / mL.

[0058] In this article, working concentration refers to the concentration based on the RT-qPCR reaction system. Unless otherwise specified, working concentration and final concentration have the same meaning.

[0059] The reaction enzyme solution includes UDG enzyme, reverse transcriptase and hot-start DNA polymerase.

[0060] The hot-start DNA polymerase is selected from HotStarTaq DNA Polymerase (Qiagen, Germany), PlatinumII Taq Hot-Start DNA Polymerase (Invitrogen, ThermoFisher Scientific, CA, USA), Ace Taq DNA polymerase (Novozymes Biotech Co., Ltd., China), Champagne Taq DNA polymerase (Novozymes), Hotstart HiTaq DNA polymerase (PhiPeng Biotech Co., Ltd., China), HieffUnicon Hotstart K-Taq DNA Polymerase (YiSheng Biotech Co., Ltd., China), etc. Preferably, the hot-start DNA polymerase is Champagne Taq DNA polymerase or Hotstart HiTaq DNA polymerase.

[0061] The reverse transcriptase is selected from HiScript II Reverse Transcriptase (Novozyme), Super MMLV reverse transcriptase (Phipeng), Hifair V reverse transcriptase (Yishen), etc. Preferably, the reverse transcriptase is Hifair V reverse transcriptase.

[0062] In the reaction enzyme solution, the ratio of the amount (U) of hot-start DNA polymerase, reverse transcriptase, and UDG enzyme is 10:50:1. In a preferred embodiment, in 1 μL of enzyme solution, the amount of hot-start DNA polymerase is 1 U, the amount of reverse transcriptase is 5 U, and the amount of UDG enzyme is 0.1 U.

[0063] In a preferred embodiment, in the entire RT-qPCR detection system, the working concentrations of hot-start DNA polymerase, reverse transcriptase, and UDG enzyme are 0.05 U / μL, 0.25 U / μL, and 0.005 U / μL, respectively.

[0064] Preferably, the reaction enzyme solution further comprises an RNase inhibitor. More preferably, the volume ratio of the reverse transcriptase to the RNase inhibitor is 1:1 to 2:1; specifically, it can be 1:1 to 1.2:1, 1.2:1 to 1.5:1, or 1.5:1 to 2:1.

[0065] In a preferred embodiment, the positive control is an RNA sample containing thyroglobulin gene (TG) mRNA, preferably human thyroid cancer cell line RNA; and the blank control is RNase-free water (H2O).

[0066] When the kit for detecting cervical lymph node metastasis of thyroid cancer is used to test the sample to be tested, the test result of the sample to be tested is valid only when the thyroglobulin gene and internal reference gene of the positive control are positive and the thyroglobulin gene and internal reference gene of the blank control are without signal.

[0067] The VIC channel of the sample to be tested should have a clear amplification curve; if there is no obvious amplification curve in the VIC channel, it indicates that the reaction template contains PCR inhibitors or the concentration is insufficient, and the experiment needs to be repeated or the RNA needs to be re-extracted.

[0068] In a specific embodiment, the aforementioned kit is based on the Ct value method, and the test results are analyzed according to ΔCt to determine whether the sample to be tested is negative or positive. When the Ct value of the VIC channel is less than 30, and the ΔCt is less than the positive judgment value (8), the sample to be tested is positive, indicating that TG mRNA is detected in the sample; when the Ct value of the VIC channel is less than 30, the ΔCt is greater than 8, or there is no obvious amplification curve in the FAM channel, the sample to be tested is negative, indicating that TG mRNA is not detected in the sample.

[0069] The present invention also provides a use of the aforementioned composition or the aforementioned kit in preparing a product for detecting thyroid cervical lymph node metastasis.

[0070] In a specific embodiment of the present invention, the above-mentioned detection product uses cervical lymph node puncture samples as detection objects.

[0071] The following describes the embodiments of the present invention through specific examples. Those skilled in the art will readily understand the other advantages and benefits of the present invention from the disclosure herein. The present invention may also be implemented or applied through various other specific embodiments, and the details in this specification may be modified or altered based on different viewpoints and applications without departing from the spirit of the present invention.

[0072] Example 1 - Primer-probe combination screening

[0073] This embodiment provides a primer-probe mixture for detecting thyroglobulin.

[0074] 1. Primer probe sequence screening

[0075] The present invention uses TG (sequence number GenBank accession no. NM_003235.5) and internal reference gene B2M (sequence number GenBank accession no. NM_004048.4) sequences as templates to design specific primer probe combinations.

[0076] The primers are designed to span introns to prevent genomic DNA contamination. The upstream and downstream primers contain a pre-sequence, an intermediate sequence, and a post-sequence; the pre-sequence completely matches the template, the intermediate sequence has a base mismatch with the template, and the post-sequence completely matches the template.

[0077] The target gene probe has a fluorescent reporter group FAM added to the 5' end and a fluorescent quencher group added to the 3' end; the internal reference gene probe has a fluorescent reporter group VIC added to the 5' end and a fluorescent quencher group added to the 3' end.

[0078] Table 1 Primer and probe sequences

[0079]

[0080] 2. Primer-probe mixture test

[0081] Primer and probe mixtures were prepared using the basic PCR reaction system formula. The amplification efficiency and specificity of the primers and probes were tested. The target gene and reference gene duplex PCR combinations are shown in Table 2. Positive samples were diluted in four gradients (3 ng / μL, 0.3 ng / μL, 0.03 ng / μL, and 0.003 ng / μL).

[0082] Table 2 Combination scheme of target gene and reference gene

[0083]

[0084] Test results such as Figure 1-1 、 1-2 Figures 1-3 show that for positive samples of the same concentration, the FAM channel Ct values for Groups 2 and 3 are approximately 4 Ct values higher than those for Group 1, indicating that primer and probe set 1 has a higher amplification capacity for the target gene TG than Groups 2 and 3. Furthermore, the amplification curves show that the FAM and VIC amplification curves for Group 3 exhibit an S-shaped distribution, while the other groups do not exhibit an "S"-shaped amplification curve at low concentrations.

[0085] Two biopsy specimens (labeled S1 and S2) stored in liquid-based cell preservation medium at 2–8°C for 30 days were used. Primer-probe combinations from Groups 1, 2, 3, and 4 were used for detection. The results are shown in Table 3. When testing liquid-based samples, the primer-probe combination from Group 1 consistently detected the target; however, the Ct values for Groups 2 and 3 were approximately 3–5 Ct values higher than those for Group 1, potentially leading to missed detections.

[0086] Table 3 Results of testing puncture samples preserved in liquid-based preservation fluid

[0087]

[0088] Based on the results of the FAM and VIC channel Ct values and the amplification curve morphology results, as well as the results of amplification of liquid-based samples, the primer-probe combination preferably selects Group 1. This primer-probe combination is designed in the high-abundance region of the target RNA transcript and adopts a long primer / probe design strategy. Therefore, the primer-probe combination for TG and B2M detection of the present invention has better compatibility with samples of poor quality, reduces false negatives, and improves overall detection performance.

[0089] Example 2- Optimization of detection reaction solution and enzyme solution

[0090] In this example, in order to find the most suitable detection reaction scheme for the target gene TG, improve the amplification efficiency, and be compatible with the reverse transcription reaction and amplification reaction, the detection reaction solution and enzyme solution were optimized.

[0091] 1. Study on the concentration of DNA polymerase and reverse transcriptase in the enzyme solution

[0092] Five concentration gradients of DNA polymerase and reverse transcriptase were set in the enzyme solution (DNA polymerase: 0.5U, 0.75U, 1U, 1.25U, 1.5U; reverse transcriptase: 4U, 4.5U, 5U, 5.5U, 6U).

[0093] The results of the DNA polymerase study are shown in Table 4. For very low-concentration positive samples (10 copies, 0.01 ng / μL), the average differences in the FAM channel Ct values (TG) for experimental groups 1, 2, 4, and 5 compared to the Ct value for group 3 were 0.62, 0.08, 0.53, and 0.51, respectively. Group 3 had the lowest Ct value, the best amplification efficiency, and the highest fluorescence intensity during the plateau phase of the amplification curve. Therefore, both excessively low enzyme dosages (0.5 U) and excessively high enzyme dosages (1.25 U and 1.5 U) are detrimental to the amplification of low-concentration samples. Therefore, the optimal amount of DNA polymerase added to the reaction system is between 0.75 U and 1 U.

[0094] The results of the reverse transcriptase study are shown in Table 5. The Ct values for experimental group 3 were consistently lower than those for experimental groups 6, 7, 8, and 9. For example, in the extremely low-concentration positive sample group (10 copies, 0.01 ng / μL), the average differences between the FAM channel Ct values for experimental groups 6 and 9 and the Ct value for group 3 were 1.07 and 3.08, respectively, indicating that group 3 had the lowest Ct value. Therefore, both too low an enzyme dosage (4 U) and too high an enzyme dosage (6 U) are detrimental to RNA amplification. Therefore, the optimal amount of reverse transcriptase added to the reaction system is between 4.5 and 5 U.

[0095] Table 4 DNA polymerase screening results

[0096]

[0097] Table 5 Reverse transcriptase screening results

[0098]

[0099] 2. Study on additives in reaction solution

[0100] 500 μg / mL bovine serum albumin was added to the detection reaction solution as an additive, and the results were compared with those without the addition of additives. The results are shown in Table 6. When detecting positive samples of the same concentration and copy number (stored in liquid-based preservation solution), the Ct value of this embodiment was 3 Ct values ahead of the Ct value of the control group. In particular, when detecting low-concentration weak positive samples (100 copies, 0.1 ng / μL), the control group would have no amplification signal (NoCt). Therefore, this embodiment performs better than the control group when detecting low-concentration weak positive samples.

[0101] Table 6 Ct value data of the control group and the embodiment group for the detection of the same sample

[0102]

[0103]

[0104] Example 3 - Kit Composition and Use

[0105] 1. Kit Composition

[0106] The kit in this embodiment includes a detection reaction solution, a detection enzyme solution, a positive control substance and a blank control substance.

[0107] The detection reaction solution is shown in Table 7 and consists of TG primer-probe combination, B2M primer-probe combination, dNTP Mix, dUTP, buffer, and additives.

[0108] Table 7 Composition of detection reaction solution

[0109]

[0110] The detection enzyme solution is shown in Table 8 and includes UDG enzyme, reverse transcriptase, RNase inhibitor, and hot-start DNA polymerase. UDG enzyme is used to prevent aerosol contamination of laboratory amplification products. In this example, the hot-start DNA polymerase is Hotstart HiTaq DNA polymerase. The reverse transcriptase is HiFair V reverse transcriptase.

[0111] Table 8 Detection enzyme solution composition

[0112]

[0113] The positive control was RNA from a human thyroid cancer cell line, and the blank control was RNase-free H2O.

[0114] 2. Instructions for using the kit

[0115] This example shows how to use the test kit, including the following steps:

[0116] (1) Lymph node puncture samples were collected from the patients to be tested, and total RNA was extracted and stored at -80°C until use. Total RNA was extracted using a nucleic acid extraction kit (spin column method) (Shanghai Ruijing Biotechnology Co., Ltd., China) according to the manufacturer's instructions.

[0117] (2) PCR reaction systems (composition as shown in Table 9) were prepared using the total RNA obtained above, the positive control substance in the kit, and the blank control substance as templates. After thorough mixing, RT-qPCR was performed.

[0118] Table 9 RT-qPCR reaction system

[0119] Component name volume Detection reaction solution 13μL Detection enzyme solution 2μL RNA template 5μL Total 20 μL

[0120] (3) The RT-qPCR reaction procedure is shown in Table 10. The first stage is for anti-contamination and reverse transcription; the second stage is for pre-denaturation; and the third stage is for amplification and signal collection. FAM and VIC fluorescence signals are collected at 60°C. Detection is performed using the ABI7500 System or SLAN 96S.

[0121] Table 10 Reaction procedure

[0122]

[0123] (4) Data processing

[0124] RT-qPCR test results are expressed as Ct values. The Ct value is determined by taking the fluorescence value of the first 3-15 cycles of the amplification process as the threshold, which is 10 times the standard deviation. The Ct value is the cycle number at which the fluorescence signal reaches the set threshold. The relative expression of the target gene in the sample is calculated using the ΔCt method:

[0125] ΔCt=Ct(TG)-Ct(B2M)

[0126] Among them, Ct(TG) refers to the Ct value corresponding to the TG gene (FAM signal) in the sample; Ct(B2M) refers to the Ct value corresponding to the internal reference gene (VIC signal) of the sample. The test results of the sample to be tested are valid only when the target gene and internal reference gene of the positive control are positive and the target gene and internal reference gene of the blank control are without signal. After meeting the above conditions, when the Ct value of the VIC channel is less than 30 and ΔCt is less than the positive judgment value (8), the sample to be tested is positive, indicating that TG mRNA is detected in the sample; when the Ct value of the VIC channel is less than 30 and ΔCt is greater than 8 or there is no obvious amplification curve in the FAM channel, the sample to be tested is negative, indicating that TG mRNA is not detected in the sample; when the Ct value of the VIC channel is ≥30, it indicates that the sample quality is poor and the nucleic acid needs to be re-extracted for testing.

[0127] Example 4 - Kit Detection Performance

[0128] In this example, clinical samples were tested. Ten cervical lymph node puncture specimens were selected. The specimens were stored at 2-8°C for 6 months using a liquid-based cell preservation medium (Hangzhou Anping Pharmaceutical Technology Co., Ltd., China). After total RNA was extracted, the specimens were tested using the kit and operating protocol shown in Example 3. Among the 10 samples, the pathological results of 5 cases showed that thyroid cancer had metastasized to the cervical lymph nodes (metastasis-positive), and the pathological results of 5 cases showed that thyroid cancer had not metastasized to the cervical lymph nodes (metastasis-negative).

[0129] The test results are shown in Table 11. The positive and negative results of the test are consistent with the pathological results. The positive control has obvious S-shaped amplification curves in both the FAM channel and the VIC channel in the amplification system, indicating that the system of the present invention can effectively amplify the target gene ( Figure 2 The blank control showed no amplification signal in all amplification systems, indicating that the system was not contaminated. The samples with positive pathological results showed obvious amplification curves in the FAM channel and VIC channel of the target gene amplification system ( Figure 3 For example, samples with negative pathological results have obvious amplification curves in the VIC channel of the target gene amplification system, while the amplification signal in the FAM channel is very weak or absent ( Figure 4 is one example).

[0130] Table 11 Clinical sample test results

[0131] Sample No. FAM-Ct VIC-Ct ΔCt Interpretation of results Pathological results 1 NoCt 22.99 / Negative Negative 2 27.55 23.72 3.83 Positive Positive 3 27.59 21.25 6.34 Positive Positive 4 NoCt 24.21 / Negative Negative 5 22.14 22.31 -0.17 Positive Positive 6 26.73 24.78 1.95 Positive Positive 7 NoCt 23.39 / Negative Negative 8 33.02 21.11 11.9 Negative Negative 9 NoCt 21.60 / Negative Negative 10 20.47 21.24 -0.77 Positive Positive

[0132] A further 238 clinical samples were tested. As shown in Table 12, the detection performance of this kit was higher than that of other reported methods for detecting TG genes.

[0133] Table 12 Performance comparison

[0134]

[0135]

[0136] Therefore, the present application provides a kit containing a TG primer probe, a B2M primer probe, a detection reaction solution, and a detection enzyme solution, which can detect the metastasis of thyroid cancer cells, and has the characteristics of excellent performance, simple operation, high sensitivity, and strong specificity, thereby providing a reference basis for clinical diagnosis.

[0137] In summary, the above is only a preferred embodiment of the present invention and is not intended to limit the present invention in any form or substance. It should be pointed out that ordinary technicians in this technical field can make several improvements and supplements without departing from the method of the present invention, and these improvements and supplements should also be regarded as the scope of protection of the present invention. Any technician familiar with this profession, without departing from the spirit and scope of the present invention, can make some changes, modifications and equivalent changes made by using the technical content disclosed above, which are all equivalent embodiments of the present invention; at the same time, any changes, modifications and evolutions of any equivalent changes made to the above embodiments based on the essential technology of the present invention are still within the scope of the technical solution of the present invention.

Claims

1. A composition for detecting cervical lymph node metastasis of thyroid cancer, the composition comprising a specific detection primer pair for the thyroglobulin gene, the primer pair comprising an upstream primer and a downstream primer, the sequences of the upstream primer and the downstream primer being as shown in SEQ ID NOs: 1-2.

2. The composition according to claim 1, wherein The composition further comprises a specific detection probe for the thyroglobulin gene, wherein the probe sequence is shown in SEQ ID NO: 5; And / or, the composition further comprises an internal reference primer pair and an internal reference probe, the internal reference primer pair comprises an upstream primer and a downstream primer, the upstream primer and downstream primer sequences are shown in SEQ ID NOs: 3-4, and the probe sequence is shown in SEQ ID NO:

6.

3. A kit for detecting cervical lymph node metastasis of thyroid cancer, comprising the composition according to claim 1 or 2.

4. The kit according to claim 3, wherein The kit uses cervical lymph node puncture samples as detection objects.

5. The kit according to claim 3, wherein The kit also includes PCR reaction solution, reaction enzyme solution, positive control substance and negative control substance.

6. The kit according to claim 5, wherein The PCR reaction solution includes dNTPs, dUTP, buffer and additives required for the real-time fluorescence quantitative PCR detection reagent reaction.

7. The kit according to claim 6, wherein The working concentration of the dNTPs is 0.05-0.3 mM, preferably 0.2 mM; and / or, the working concentration of dUTP is 0.025-0.3 mM, preferably 0.15 mM; and / or, the buffer solution consists of Tris-HCl (pH 8.0), KCl, MgCl2, and (NH4)2SO4; and / or, the working concentration of the additive is 300 to 500 μg / mL, preferably 500 μg / mL; And / or, the additive is selected from bovine serum albumin.

8. The kit according to claim 3, wherein The reaction enzyme solution comprises UDG enzyme, reverse transcriptase and hot start DNA polymerase.

9. The kit according to claim 8, wherein The working concentration of the hot start DNA polymerase is 0.05U / μL; and / or, the working concentration of the reverse transcriptase is 0.25 U / μL; And / or, the working concentration of the UDG enzyme is 0.005 U / μL.

10. Use of the composition according to claim 1 or 2 or the kit according to any one of claims 3 to 9 in preparing a product for detecting thyroid cervical lymph node metastasis.

Images