Kit and method for rapidly identifying culex fatigans based on RAA technology

Through the combination of RAA technology and specific primers, the problem of low efficiency and low accuracy in mosquito identification is solved, and rapid and accurate mosquito population identification is achieved, which is suitable for mosquito samples at different developmental stages.

CN120442802APending Publication Date: 2025-08-08青岛国际旅行卫生保健中心
0 Cites 0 Cited by

Patent Information

Application Number
CN202311360939.4
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2023-10-19
Publication Date
2025-08-08

AI Technical Summary

Technical Problem

In the prior art, mosquito identification mainly relies on morphological methods, which have long identification cycles, low efficiency, shortage of professional talents, difficulty in identifying complex populations and underdeveloped samples, and molecular biological methods have problems such as high cost, long time-consuming and unstable results.

Method used

Using recombinase-mediated strand replacement nucleic acid amplification (RAA) technology based on mitochondrial DNA cytochrome oxidase I gene, specific primers are designed for mosquito identification, and combined with traditional morphological methods to improve identification efficiency and accuracy.

Benefits of technology

Fast, accurate and safe mosquito population identification is achieved, reducing identification errors, and is suitable for mosquito samples at different developmental stages.

✦ Generated by Eureka AI based on patent content.
Patent Text Reader

Abstract

The invention relates to a rapid identification kit and an identification method for culex fatigans based on an RAA technology. The sequence of the rapid identification kit is culex fatigans F2: AGGAGGAGATCAATTTTATATCAACATTT; the culex fatigan-R2 is characterized in that the culex fatigan-R2 is TCAAACAATAAACCCTAATAAACCAATAGC. Traditional mosquito identification is mainly based on morphological identification, but morphological characteristics of vector organisms are possibly damaged in the collection or storage process, and all development stages cannot be identified at the same time, and the RAA technology based on the mitochondrial DNA cytochrome oxidase I gene is applied to mosquito identification and used together with the traditional morphological identification method, so that the identification efficiency is greatly improved. Identification errors can be effectively reduced, and identification efficiency and accuracy are improved.
Need to check novelty before this filing date? Find Prior Art