Kit and method for rapidly identifying culex fatigans based on RAA technology

Abstract

The invention relates to a rapid identification kit and an identification method for culex fatigans based on an RAA technology. The sequence of the rapid identification kit is culex fatigans F2: AGGAGGAGATCAATTTTATATCAACATTT; the culex fatigan-R2 is characterized in that the culex fatigan-R2 is TCAAACAATAAACCCTAATAAACCAATAGC. Traditional mosquito identification is mainly based on morphological identification, but morphological characteristics of vector organisms are possibly damaged in the collection or storage process, and all development stages cannot be identified at the same time, and the RAA technology based on the mitochondrial DNA cytochrome oxidase I gene is applied to mosquito identification and used together with the traditional morphological identification method, so that the identification efficiency is greatly improved. Identification errors can be effectively reduced, and identification efficiency and accuracy are improved.

Description

Technical Field

[0001] The present invention relates to the field of biological detection, and in particular to a Culex pipiens quinquefasciatus identification and detection kit and an identification and detection method based on RAA technology. Background Art

[0002] The primary method for identifying mosquito populations at ports of entry is morphological identification. This relies on port inspection and quarantine personnel with experience and expertise in morphological identification, using a medical mosquito classification key. However, morphological identification faces numerous challenges: Professional mosquito identification personnel are scarce, and the training cycle is long. Factors such as the identification personnel's experience and expertise, as well as the completeness and developmental stage of the mosquitoes, can lead to long identification cycles and low efficiency. Some complex populations, such as closely related and homomorphic populations, are difficult to identify. Mosquito eggs, larvae, and pupae often require artificial culture for identification in order to obtain reliable identification features. Large numbers of mosquitoes submitted for inspection at ports pose a significant challenge to identification work. Therefore, in addition to improving the identification capabilities of quarantine personnel and developing identification assistance systems, port mosquito identification requires the development of safe, rapid, accurate, and sensitive identification methods to enable rapid mosquito identification.

[0003] Traditional mosquito identification relies primarily on morphology. However, morphological features of vectors can be damaged during collection and storage, and simultaneous identification of all developmental stages is not possible. Therefore, accurate identification requires experienced morphological experts. In recent years, with the advancement of molecular biology techniques, molecular methods such as conventional PCR, restriction endonuclease fragment length polymorphism (RFLP), random amplified polymorphic DNA (RAPD), single-strand conformation polymorphism (SSCP), and DNA barcoding have been applied to mosquito species identification. However, these identification methods all have drawbacks: conventional detection of specific PCR product sequences relies on expensive molecular probes or product sequencing; RFLP identification of mosquito species is time-consuming and requires large sample sizes; RAPD identification is rapid, but results are unstable and sometimes unreproducible; SSCP can only be used to detect genetic mutations in mosquitoes; determining the location and type of mutations requires further sequencing, and the electrophoresis conditions are relatively strict; and DNA barcoding requires subsequent sequencing, which is time-consuming and expensive. Given the limitations of these methods, new molecular identification methods are needed to achieve safe, rapid, accurate, and sensitive molecular identification of mosquito populations. Summary of the Invention

[0004] The present invention provides a rapid identification and detection kit for Culex pipiens quinquefasciatus based on RAA technology and an identification and detection method.

[0005] The present invention is achieved by the following technical solutions: The present invention is based on the recombinase-mediated strand displacement nucleic acid amplification (RAA) technology of mitochondrial DNA cytochrome oxidase I (COI) gene and is applied to mosquito identification.

[0006] The present invention first obtains a set of specific amplification primers for rapid identification of Culex pipiens quinquefasciatus based on RAA technology, the sequences of which are as follows: Culex quinquefasciatus-F2: AGGAGGAGATCCAATTTTATATCAACATTT.

[0007] Culex pipiens quinquefasciatus-R2: TCAAACAATAAACCCTAATAAACCAATAGC.

[0008] The present invention also provides a rapid identification kit for Culex pipiens quinquefasciatus based on the RAA technology, comprising the above primer sequences.

[0009] Compared with existing detection methods, the present invention has the following beneficial effects: Traditional mosquito identification relies primarily on morphology. However, morphological features of vectors can be damaged during collection and storage, and simultaneous identification of all developmental stages is not possible. Therefore, accurate identification requires experienced morphological experts. Recombinase-mediated strand-displacement nucleic acid amplification (RAA) technology, based on the mitochondrial DNA cytochrome oxidase I (COI) gene, has been applied to mosquito identification. Used in conjunction with traditional morphological identification methods, it can effectively reduce identification errors and improve efficiency and accuracy. BRIEF DESCRIPTION OF THE DRAWINGS

[0010] Figure 1 Specificity results of the RAA detection method for Culex pipiens quinquefasciatus DETAILED DESCRIPTION

[0011] The present invention will be further described below using examples. Example 1

[0012] This example provides a set of specific amplification primers for rapid identification of Culex pipiens quinquefasciatus based on RAA technology, the sequences of which are as follows: Culex quinquefasciatus-F2: AGGAGGAGATCCAATTTTATATCAACATTT.

[0013] Culex pipiens quinquefasciatus-R2: TCAAACAATAAACCCTAATAAACCAATAGC.

[0014] Example 2 Specificity and sensitivity detection Nucleic acid extraction The TaKaRa MiniBEST Viral RNA / DNA Extraction Kit Ver.5.0 (Cat. No. 9766) was used to extract mitochondrial genomic nucleic acids from one hind leg of each of the mosquito species Aedes albopictus, Culex pipiens, Anopheles sinensis, Armigeres harassing, and Culex pipiens pallens.

[0015] RAA detection steps The RAA nucleic acid amplification reagent (basic type) of Hangzhou Zhongce Biotechnology Co., Ltd. was used to amplify the DNA nucleic acids of various mosquito species.

[0016] The specificity of the RAA detection method for Culex quinquefasciatus. The results are shown in the figure. The F2-R2 primers of Culex quinquefasciatus ( Figure 1 ) showed better specificity compared with the corresponding controls.

[0017] The sensitivity of the RAA detection method for Culex quinquefasciatus was 10 times diluted with mitochondrial genomic nucleic acid extracted from a hind leg of Culex quinquefasciatus. -5 Dilution.

[0018] Of course, the above description is not a limitation of the present invention, and the present invention is not limited to the above examples. Any changes, modifications, additions or substitutions made by ordinary technicians in this technical field within the essential scope of the present invention should fall within the scope of protection of the present invention.

Claims

1. A specific amplification primer for rapid identification of Culex pipiens quinquefasciatus based on RAA technology, characterized in that: The sequence is as follows: Culex quinquefasciatus-F2: AGGAGGAGATCCAATTTTATATCAACATTT; Culex pipiens quinquefasciatus-R2: TCAAACAATAAACCCTAATAAACCAATAGC.

2. A rapid identification kit for Culex pipiens quinquefasciatus based on RAA technology, characterized in that: Comprising the primer sequence of claim 1.

Images