Application of SNP (Single Nucleotide Polymorphism) marker related to horse body height character

Abstract

The invention relates to the field of molecular biology and genetic breeding, and provides application of an SNP (Single Nucleotide Polymorphism) marker related to a horse body height character. The SNP marker is located at the 16200793bp position of a chromosome 4 of a horse, and is Agt; and C base mutation (rs1138581426) is carried out. Experiments show that the developed SNP marker has significant influence on the horse body height character (Plt; 0.05), and the allele A has more excellent body height character, so that the SNP molecular marker in the IGFBP1 gene can be applied to horse body height character molecular marker breeding. The molecular marker provided by the invention is not limited by the age, sex and the like of the horse, can be used for breeding an excellent and high horse variety, and even can be accurately screened when the horse is newly born, so that the breeding process of the excellent and high horse variety is greatly accelerated.

Description

Technical Field

[0001] The present invention relates to the fields of molecular biology and genetic breeding, and in particular to the application of a SNP marker associated with horse height traits. Background Art

[0002] The IGF family consists of insulin-like growth factor-I ( IGF1 ) and insulin-like growth factor-II ( IGF2 ) are small molecule peptide hormones that are highly homologous to insulin. They regulate cell proliferation, differentiation and survival by binding to type 1 IGF receptors on the cell surface, and have both metabolic regulation (such as lowering blood sugar) and growth-promoting functions. The activity of IGF is strictly regulated by insulin-like growth factor binding proteins (IGFBPs). There are currently 6 known IGFBPs ( IGFBP1, IGFBP2, IGFBP3, IGFBP4, IGFBP5, IGFBP6 ), which bind to IGF with high affinity (higher than the receptor binding capacity), preventing IGF from interacting with the receptor by forming a complex, thereby limiting its biological activity.

[0003] Related research has shown that growth hormone (GH, also known as somatotropin) deficiency can lead to abnormal height. In 1989, a long-term study discovered the first human single gene dwarfism pathogenic variant - Laron syndrome patients with growth hormone receptor encoding gene GHR mutation. Since then, key components of the GH signaling pathway ( GH1, IGF1, IGF2, IGF1R, GHR, STAT3, STAT5 and IGFALS Genetic variants (such as GH, IGF1, and IGF2) have been identified in patients with dwarfism. GH promotes the synthesis of insulin-like growth factors IGF1 / IGF2 and auxiliary proteins (such as IGF-binding protein and acid-labile subunit ALS) by activating GH receptors. These auxiliary proteins maintain the stability of IGF in the circulation by forming a complex. In the growth plate, IGF1 and IGF2 act as endocrine factors to activate pro-proliferative pathways, and GH has also been shown to directly stimulate local IGF1 production. Consistent with known single-gene dwarfism variants, genes encoding multiple components of the GH-IGF1 growth axis are also associated with height, with dozens of independent signals observed in different GWAS studies.

[0004] horse( Equus caballusThe horse is one of the world's most important domesticated animals, with its domestication dating back approximately 5,500 years to the Botai culture site in northern Kazakhstan. The origins of the modern domestic horse are concentrated in the western Eurasian steppes 4,200 years ago. As a crucial partner in the development of human civilization, the horse not only served as a military transporter, rider, and chariot driver in ancient warfare, but also provided humans with livestock products such as meat, milk, and hides. Its economic value spanned from agricultural civilization to the Industrial Revolution. China has a long history of horse breeding, resulting in a rich genetic resource, including the cold-resistant Mongolian horse, the plateau-adapted Tibetan horse, the mountain-traveling southwestern pony, and the Ili horse, renowned for its size. As one of the most geographically adaptable domestic animals, the horse is widely distributed across ecological zones such as the Qinghai-Tibet Plateau, the cold regions of Northeast China, the humid and hot southern regions, and the northwestern deserts. Under long-term natural selection and artificial breeding, different breeds have evolved unique phenotypic characteristics: for example, the Mongolian horse is sturdy and resistant to rough feed, but has the characteristics of low birth weight, long growth cycle, and limited meat production efficiency; while breeds such as the Sanhe horse and Tieling draft horse bred through hybridization and improvement show the advantages of large size and strong pulling power.

[0005] With the intensive development of modern animal husbandry and the upgrading of consumption, the market demand for tall, fast-growing meat horses has increased dramatically. TBX3 、 HMGA2 major effect genes) and environmental factors, among which it was found that TBX3 A gene enhancer mutation, which can explain the 10-centimeter height variation, first appeared in ancient horse populations 2,300 years ago. Breakthroughs in marker-assisted selection (MAS) technology are providing new avenues for precision breeding. Genome-wide selection (GS) has been successfully applied to improve traits such as lactation performance and athletic endurance, and CRISPR / Cas9 gene editing has made progress in disease resistance and muscle development. Current research focuses on developing horse-specific SNP microarrays and constructing high-density genetic maps, aiming to shorten the improvement cycle through marker-assisted breeding and improve meat production and economic benefits. Summary of the Invention

[0006] The purpose of the present invention is to provide an application of a SNP marker related to horse height traits.

[0007] In order to achieve the purpose of the present invention, in the first aspect, the present invention provides a SNP marker associated with horse height traits, wherein the SNP marker contains IGFBP1 The gene has a nucleotide sequence with a polymorphism of A / C at position 183 of the sequence shown in SEQ ID NO: 1 (N is A or C); the genotype of the site with the polymorphism is AA, corresponding to the tall body height trait; the genotype of the site with the polymorphism is CC, corresponding to the short body height trait.

[0008] described IGFBP1The reference sequence number of the gene at NCBI is ENSECAG00000014889.

[0009] The SNP site (polymorphic site) of the present invention is located at 16200793bp of horse chromosome 4 and is an A>C base mutation (rs1138581426).

[0010] In a second aspect, the present invention provides primers for amplifying the SNP marker, preferably including primers as shown in SEQ ID NO: 2-3.

[0011] In a third aspect, the present invention provides a detection reagent or kit containing the primers.

[0012] In a fourth aspect, the present invention provides any of the following uses of the SNP marker, the primer, or a detection reagent or kit containing the primer: (1) Used for breeding horses for high-quality traits; (2) Used for early prediction of horse individuals with high body height traits; (3) Used for identification of high-body and high-trait horse breeds; (4) For genetic improvement of horse breeds; (5) Used for IGFBP1 Genotyping.

[0013] In a fifth aspect, the present invention provides a method for breeding horses for high-quality traits, comprising the following steps: 1) Detecting SNP markers associated with horse height traits in reserve stallions; 2) Select individuals with genotype AA in step 1) as stallions and eliminate stallions with AC or CC genotypes.

[0014] In a sixth aspect, the present invention provides a method for breeding a horse breed having high body and high trait, comprising the steps of: 1) Detecting SNP markers associated with horse height traits in reserve stallions; 2) Selecting individuals with AA genotype in step 1) as breeding horses, and breeding the breeding stallions and mares; 3) Detecting the SNP markers in the horses born from the mating in step 2), retaining individuals with the AA genotype, eliminating individuals with the AC or CC genotype, and then breeding to obtain a horse breed with a high body height trait.

[0015] In a seventh aspect, the present invention provides a method for genetic improvement of a horse, comprising the following steps: 1) Detection of SNP markers associated with horse height traits in reserve stallions; 2) Retain individuals with genotype AA in step 1) and eliminate individuals with genotype AC or CC; 3) Using the individuals with genotype AA in step 2) as stallions for breeding, continue to select stallion individuals with genotype AA in the offspring, and eliminate individuals with genotype AC or CC; thereby increasing the frequency of allele A in the offspring horse population generation by generation, thereby reducing the proportion of low body height in the offspring stallions.

[0016] In an eighth aspect, the present invention provides a method for screening young horses with tall stature and high traits, comprising the following steps: 1) Detecting SNP markers associated with horse height traits in young horses to be screened; 2) When the genotype of the SNP marker detected in step 1) is AA, the young horse to be screened has the genetic trait of high body height and is retained; when the genotype detected is AC or CC, the young horse to be screened has the genetic trait of low body height and is eliminated.

[0017] By means of the above technical solution, the present invention has at least the following advantages and beneficial effects: (1) This invention screened and identified a molecular marker, rs1138581426, associated with horse height. Horses with different genotypes of this marker showed highly significant differences in height. The average height for males with the AA genotype of the rs1138581426 marker was 175.17 cm, and for females it was 159.42 cm. The average height for males with the CC genotype was 119.85 cm, and for females it was 115.67 cm. The A allele significantly increased horse height, thereby affecting meat production, with the AA genotype being the dominant genotype. Therefore, by applying this molecular marker, horse height can be increased, thereby accelerating the genetic improvement and breeding process of stallions.

[0018] (2) By detecting the genotype of the rs1138581426 molecular marker to assist in the selection of stallions, selecting stallions with the AA genotype can effectively increase the stallion's height and facilitate subsequent comprehensive breeding.

[0019] (3) The rs1138581426 molecular marker is applied to the selection of horses for the height trait. The selected horses can significantly increase their height, thereby improving the production performance of stallions.

[0020] (4) Applying the rs1138581426 molecular marker to the breeding of horse breeds with high body height traits can produce horse breeds with significantly increased body height, thereby increasing carcass weight and net meat weight, thereby improving the production performance of this breed of horses and accelerating the genetic improvement and breeding process of stallions.

[0021] (5) Applying the rs1138581426 molecular marker to the genetic improvement of horses can greatly shorten the years of genetic breeding, improve horse production performance, and accelerate the genetic improvement and breeding process of stallions.

[0022] (6) The rs1138581426 molecular marker is used to screen young horses with the genetic trait of tall stature and height. Stallions with the trait of tall stature and height can be screened and retained at the young horse stage, thereby breeding for the trait of tall stature and height at the early stage of horse birth, greatly improving breeding efficiency and saving feeding costs. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 This is a statistical diagram of the height and length phenotypes of the tall and short horses in the preferred embodiment of the present invention. P <0.01.

[0024] Figure 2 The Manhattan diagram of the SNP effect distribution of the whole genome of horse high traits in the preferred embodiment of the present invention: ST The Manhattan diagram of the selected signals is shown in the figure below. The middle one is the Manhattan diagram of the selected signals selected by Pi-Ratio, and the lower one is the Manhattan diagram of the selected signals selected by XP-EHH. The selected position in the box indicates IGFBP1 The genomic location of the gene rs1138581426 molecular marker.

[0025] Figure 3 The above picture is F ST The fine positioning map of the selected region of 49.11Kb was screened out. The figure below is the linkage disequilibrium map of the selected region of 49.11Kb before and after the SNP site.

[0026] Figure 4 This is a Venn diagram of genes screened by the three selection signal methods between the high body height group and the low body height group in a preferred embodiment of the present invention, wherein the three methods jointly identified 85 significantly correlated genes (including IGFBP1 Gene).

[0027] Figure 5 This is the functional annotation of the SNP site (rs1138581426) of the present invention. The functional region of the site shows an H3K27ac signal peak.

[0028] Figure 6 In the preferred embodiment of the present invention, the SNP site (rs1138581426) has significant differences between the low body length group and the high body length group ( P <0.01). DETAILED DESCRIPTION

[0029] The present invention aims to provide a SNP marker related to horse height traits and its application.

[0030] The present invention adopts the following technical solutions: The present invention provides a SNP molecular marker that is highly correlated with the horse body. The SNP molecular marker is located at the A>C base mutation at the 16200793bp position of chromosome 4 in the horse reference genome EquCab3.0 version (i.e., the rs1138581426 molecular marker).

[0031] Therefore, by applying this molecular marker, the production performance of horses can be greatly improved. Through continuous selection and breeding, the height of horses can be increased, the meat production can be increased, and the genetic improvement and breeding process of local horse breeds can be accelerated.

[0032] In a specific embodiment of the present invention, the upstream and downstream gene sequences of the SNP molecular marker site are shown in SEQ ID NO: 1, and the SNP molecular marker is located at the 183rd position of the sequence shown in SEQ ID NO: 1, where the A>C base mutation represented by N (i.e., the rs1138581426 molecular marker) occurs.

[0033] The present invention also provides the use of this SNP molecular marker (rs1138581426 molecular marker) in the selection of high-performance horse traits. This SNP molecular marker is located at the 16200793bp position of chromosome 4 in the equine reference genome EquCab version 3.0, representing an A>C base mutation, or the gene sequence upstream and downstream of the SNP molecular marker site is shown in SEQ ID NO:1. This SNP molecular marker is located at the 183rd position of the sequence shown in SEQ ID NO:1, representing an A>C base mutation represented by N. Thus, by using this molecular marker in the selection of high-performance horse traits, the selected horses can significantly improve their height and size, thereby improving their meat production, increasing economic benefits, and accelerating the genetic improvement and breeding process of stallions.

[0034] In a specific embodiment of the present invention, the application includes the following steps: 1) Testing stallions for the following single-nucleotide polymorphism (SNP) marker (rs1138581426): This SNP marker is located at the 16200793 bp position on chromosome 4 of the horse genome (EquCab version 3.0), indicating an A>C mutation; or the upstream and downstream gene sequences of this SNP marker are as shown in SEQ ID NO:1; This SNP marker is located at the 183rd position of the sequence shown in SEQ ID NO:1, indicating an A>C mutation represented by N; The present invention also provides the use of this SNP molecular marker (rs1138581426 molecular marker) in breeding tall and tall horse breeds. This SNP molecular marker is located at the 16200793 bp position on chromosome 4 of the horse genome (EquCab version 3.0), representing an A>C base mutation, or the gene sequence upstream and downstream of the SNP molecular marker site is shown in SEQ ID NO:1. This SNP molecular marker is located at the 183rd position of the sequence shown in SEQ ID NO:1, representing an A>C base mutation represented by N (N is A or C). Thus, by using this molecular marker in breeding tall and tall horse breeds, a tall and tall horse breed can be obtained, thereby improving the slaughter rate and other factors of the horses in this breed, enhancing the production performance of the horses in this breed, and accelerating the genetic improvement and breeding process of stallions.

[0035] In a specific embodiment of the present invention, the application comprises the following steps: 1) Testing stallions for the following single-nucleotide polymorphism (SNP) marker (rs1138581426): This SNP marker is located at the 16200793 bp position on chromosome 4 of the horse reference genome (EquCab version 3.0), indicating an A>C mutation; or the upstream and downstream gene sequences of this SNP marker are as shown in SEQ ID NO:1; This SNP marker is located at the 183rd position of the sequence shown in SEQ ID NO:1, indicating an A>C mutation represented by N; 2) selecting the individual with the AA genotype detected in step 1) as a breeding stallion, and breeding the breeding stallion and the mare; 3) The horses born from the mating in step 2) are tested for SNP molecular markers as in step 1), individuals with AA genotypes are retained, individuals with AC or CC genotypes are eliminated, and breeding is performed to cultivate a tall horse breed with high body height during the fattening period.

[0036] The present invention also provides a method for genetic improvement of horses, wherein the method comprises the following steps: 1) Detection of the following SNP molecular marker (rs1138581426 molecular marker) in stallions: This SNP molecular marker is located at the 16200793 bp position on chromosome 4 of the horse reference genome EquCab version 3.0, resulting in an A>C base mutation, or the gene sequence upstream and downstream of the SNP molecular marker site is as shown in SEQ ID NO:1, and this SNP molecular marker is located at the 183rd position of the sequence shown in SEQ ID NO:1, resulting in an A>C base mutation indicated by N; 2) Select stallion individuals with the AA molecular marker genotype in step 1) and eliminate individuals with AC or CC genotypes; 3) Using the individuals selected in step 2) as stallions for breeding, and continuing to select stallion individuals with the molecular marker genotype of AA in step 1) from the offspring, and eliminating individuals with the AC or CC genotype; thereby gradually increasing the frequency of allele A in the offspring horse population, thereby reducing the proportion of short-bodied, tall-legged stallions in the offspring.

[0037] Therefore, by applying the above-mentioned molecular markers to the genetic improvement of horses, the genetic breeding period can be greatly shortened and the meat production rate of horses can be increased.

[0038] The present invention also provides the use of the SNP molecular marker (rs1138581426 molecular marker) in screening young horses for the genetic trait of tall stature. Thus, by using this molecular marker in screening young horses for the genetic trait of tall stature, stallions with tall stature can be screened and selected at the juvenile stage. This allows for the selection of stallions for the trait of tall stature at the juvenile stage, significantly improving breeding efficiency, reducing breeding costs, and increasing economic benefits.

[0039] In a specific embodiment of the present invention, the application includes the following steps: 1) Detecting the following SNP molecular marker (rs1138581426 molecular marker) in the young horses to be screened: the SNP molecular marker is located at the 16200793 bp position on chromosome 4 of the international horse genome EquCab version 3.0, and is an A>C base mutation; or the gene sequence upstream and downstream of the SNP molecular marker site is as shown in SEQ ID NO:1, and the SNP molecular marker is located at the 183rd position of the sequence shown in SEQ ID NO:1, and is an A>C base mutation represented by N; 2) When the genotype of the molecular marker detected in step 1) is AA, the young horse to be screened has a high body height trait and is retained; when the genotype is AC or CC, the young horse to be screened has a low body height genetic trait and is eliminated.

[0040] The following examples are used to illustrate the present invention but are not intended to limit the scope of the present invention. Unless otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art, and the raw materials used are all commercially available products.

[0041] Example 1 Process steps for obtaining molecular markers 1. Based on the National Germplasm Resource Bank, ear tissue samples or blood samples of high-body and high-type groups of horses and low-body and high-type groups were collected, total DNA was extracted, and DNA quality control was performed. The samples were then sent to a sequencing company for high-depth whole-genome resequencing (BGI, T7 platform), with an average sequencing depth of about 10×. Phenotypic data such as growth performance measurements of the corresponding horse breeds were collected. The average height of the high-body and high-type group was 175.17 cm for males and 159.42 cm for females, and the average height of the low-body and high-type group was 119.85 cm for males and 115.67 cm for females. Figure 1 ).

[0042] 2. Organize the fq.gz file downloaded from the sequencing company. Remove substandard and low-quality reads. After quality control and filtering of the raw data, obtain high-quality sequencing data. Use the MEM algorithm in BWA (Version 0.7.15) software to align the clean data to the latest horse reference genome (EquCab 3.0) to generate the initial bam file. Use SAMtools (Version 1.9) software to sequence the bam file and remove PCR duplicates.

[0043] 3. First, variants were called for all individuals using the HaplotypeCaller module of GATK (Version 4.1.4.0) and gvcf files were generated. These gvcf files were then merged using the CombineGVCFs function of GATK, and finally genotyped using GenotypeGVCFs. Only autosomes were used for subsequent analysis, and the generated gvcf files were initially filtered using the SelectVariants function. SNP filtering criteria were: QD ≥ 60.0, MQ ≥ 3.0, ReadPosRankSum < -8.0, and MQRankSum < -12.5. Variant calls were performed on 98 samples using GATK4, followed by hard filtering (QD < -2.0 || ReadPosRankSum < -8.0 || FS > 60.0 || MD < 40.0 || SOR > 3.0 || MQRankSum < -12.5 || QUAL < 30). After quality control, 241 domestic and foreign horse breed individuals and 10,714,899 SNPs were used for subsequent genome-wide selection signal analysis.

[0044] Example 2 Process steps for molecular marker verification 1. The study population consisted of 241 individuals of local domestic horse breeds, and the samples were obtained from the National Livestock and Poultry Germplasm Resources Bank (Table 1).

[0045] Table 1 Horse breed statistics 2. By using VCFtools (Version 0.1.16) software, the F ST , with a window length of 50 kb and a step length of 10 kb. XP-CLR (Version 1.1.2) software was used to calculate the XP-CLR of the high body high group and the low body high group, with a window length of 50 kb and a step length of 10 kb. XP-EHH of the high body high group and the low body high group was calculated using Selscan (Version 2.0.0) software. The top 5% windows with the strongest signal values were selected as significant regions. The analysis results were visualized using ggplot2 (Version 3.4.4) software in R (Version 4.3.2) ( Figure 2 The three methods annotated 1319, 825 and 433 salient regions respectively ( Figure 3 The intersection of the three screening methods annotated a total of 85 genes (including IGFBP1 Gene, Figure 4 The visualization results showed that in chromosome 4, within the 16.177MB-16.226MB region, this gene region was selected in the high-body high group and the low-body high group. By using VCFtools software, the F of the single point of the high-body high group and the low-body high group was calculated. ST The F value of this SNP molecular marker (rs395786667) ST The value is 0.889875. According to the IFmut database (http: / / www.ifmutants.com:8212 / ), the region where the SNP molecular marker (rs395786667) is located is IGFBP1 There is an H3K27ac signal peak in the 5490bp region upstream of the gene ( Figure 5 ), indicating that the site is an enhancer region.

[0046] 3. Use Plink (Version 1.90) software to calculate the rs1138581426 molecular marker site (located at IGFBP1 The genotype of the gene (5490bp upstream) was significantly different between the high body height group and the low body height group. The Fisher test and chi-square test showed that the difference between the high body height group and the low body height group was extremely significant ( P <0.01) ( Figure 6 ).

[0047] Example 3 Application of the rs1138581426 molecular marker in horse breeding for high-performance traits The stallions are tested for the rs1138581426 molecular marker; individuals with the AA genotype obtained by the test are selected as the remaining stallions, and stallion individuals with the AC or CC genotype are eliminated. Horses with high body height traits can be bred as remaining stallions to achieve the selection of stallions for body height traits.

[0048] Example 4 Application of rs1138581426 Molecular Marker in Horse Breeds with Height Traits The rs1138581426 molecular marker is tested on stallions; individuals with the AA genotype obtained by the test are selected as stallions, and the stallions are bred; the rs1138581426 molecular marker is tested on horses born from breeding, and individuals with the AA genotype are retained, while individuals with the AC or CC genotype are eliminated, and breeding is carried out to cultivate a tall and high-production-performance horse breed.

[0049] Example 5 A method for genetic improvement of horses Detect the rs1138581426 molecular marker in stallions; select stallion individuals with the genotype AA and eliminate individuals with the AC or CC genotype; use the screened individuals as stallions for breeding, and continue to select stallion individuals with the rs1138581426 molecular marker genotype AA in the offspring, and eliminate individuals with the AC or CC genotype; thereby increasing the frequency of the allele A in the offspring horse population generation by generation, thereby increasing the lean meat rate of the offspring stallions during the fattening period.

[0050] Example 6 Application of the rs1138581426 molecular marker in screening young horses with tall stature traits The rs1138581426 molecular marker is detected in the young horses to be screened; when the genotype of the detected molecular marker is AA, the young horse to be screened has the genetic trait of high body height and is retained; when the genotype is AC or CC, the young horse to be screened has the genetic trait of low body height and is eliminated.

[0051] Examples 3 to 6 used the following primers to amplify the rs1138581426 molecular marker. The primer sequences were (SEQ ID NOs: 2-3): Forward primer: 5′- TTTTGAGCAAGAGCGGCATTC -3′ Reverse primer: 5′-TGGGCCTCAAGTGTCATGTT -3′ PCR amplification methods include: 1) Extract genomic DNA from the horse to be tested; 2) Using genomic DNA as a template, perform PCR amplification using the primers shown in SEQ ID NO: 2-3; 3) Analyze the PCR amplification products.

[0052] The amplification system used in the PCR reaction was as follows (50 μl): 1 μl of 100 ng / μl template DNA, 1 μl of 10 pmol / μl forward primer and reverse primer, 1 μl of 10 mmol / L dNTP Mixture, 1 μl of 1.25 U / 25 μl TaKaRa Ex Taq DNA polymerase, 25 μl of 2× PCR reaction buffer, and the balance was double-distilled water.

[0053] The PCR reaction program is as follows: PCR reaction conditions are: 95°C pre-denaturation for 5 minutes; 95°C denaturation for 30 seconds, 55°C or 60°C annealing for 30 seconds, 72°C extension for 1-2 minutes, for a total of 30-35 cycles; 72°C insulation for 2 minutes.

[0054] Although the present invention has been described in detail above using general descriptions and specific embodiments, it will be apparent to those skilled in the art that modifications and improvements may be made based on the present invention. Therefore, such modifications and improvements, which do not depart from the spirit of the present invention, are intended to be within the scope of protection claimed herein.

Claims

1. Any of the following applications of SNP markers associated with horse height traits: (1) Used for breeding horses for high-quality traits; (2) Used for early prediction of horse individuals with high body height traits; (3) Used for identification of high-body and high-trait horse breeds; (4) For genetic improvement of horse breeds; (5) Used for IGFBP1 Genotyping; IGFBP1 The reference sequence number of the gene at NCBI is ENSECAG00000014889; in, SNP markers associated with horse height traits include IGFBP1 The gene has a nucleotide sequence with a polymorphism of A / C at position 183 of the sequence shown in SEQ ID NO: 1; the genotype of the site with the polymorphism is AA, corresponding to the tall body height trait; the genotype of the site with the polymorphism is CC, corresponding to the low body height trait.

2. Any of the following applications of primers for amplifying SNP markers associated with horse height traits: (1) Used for breeding horses for high-quality traits; (2) Used for early prediction of individuals with tall stature; (3) Used for identification of high-body and high-trait horse breeds; (4) For genetic improvement of horse breeds; (5) Used for IGFBP1 Genotyping; IGFBP1 The reference sequence number of the gene at NCBI is ENSECAG00000014889; in, The SNP marker associated with the horse height trait is the same as the SNP marker described in claim 1.

3. Any of the following uses of a detection reagent or kit containing primers for amplifying SNP markers associated with horse height traits: (1) Used for breeding horses for high-quality traits; (2) Used for early prediction of individuals with tall stature; (3) Used for identification of high-body and high-trait horse breeds; (4) For genetic improvement of horse breeds; (5) Used for IGFBP1 Genotyping; IGFBP1 The reference sequence number of the gene at NCBI is ENSECAG00000014889; in, The SNP marker associated with the horse height trait is the same as the SNP marker described in claim 1.

4. The use according to claim 2 or 3, characterized in that The primers are shown in SEQ ID NO: 2-3.

5. A method for breeding horses for high-quality traits, characterized in that: The steps include: 1) Detecting SNP markers associated with horse height traits in reserve stallions; 2) Select individuals with AA genotype in step 1) as stallions and eliminate stallions with AC or CC genotypes; The SNP marker associated with the horse height trait is the same as the SNP marker described in claim 1.

6. A method for breeding a horse breed with high body and high trait, characterized in that: The steps include: 1) Detecting SNP markers associated with horse height traits in reserve stallions; 2) Selecting individuals with AA genotype in step 1) as breeding horses, and breeding the breeding stallions and mares; 3) testing the SNP markers on the horses born from the mating in step 2), retaining individuals with the AA genotype, eliminating individuals with the AC or CC genotype, and then breeding to obtain a horse breed with a high body height trait; The SNP marker associated with the horse height trait is the same as the SNP marker described in claim 1.

7. A method for genetic improvement of horses, characterized in that: The steps include: 1) Detection of SNP markers associated with horse height traits in reserve stallions; 2) Retain individuals with genotype AA in step 1) and eliminate individuals with genotype AC or CC; 3) Using the individuals with the AA genotype from step 2) as stallions for breeding, continuing to select stallions with the AA genotype from the offspring and eliminating those with the AC or CC genotypes; this increases the frequency of the allele A in the offspring population, thereby reducing the proportion of low-height stallions in the offspring; The SNP marker associated with the horse height trait is the same as the SNP marker described in claim 1.

8. A method for screening young horses with tall body and tall traits, characterized in that: The steps include: 1) Detecting SNP markers associated with horse height traits in young horses to be screened; 2) When the genotype of the SNP marker detected in step 1) is AA, the young horse to be screened has the genetic trait of tall stature and is retained; when the genotype detected is AC or CC, the young horse to be screened has the genetic trait of short stature and is eliminated; The SNP marker associated with the horse height trait is the same as the SNP marker described in claim 1.

Images