SNP (Single Nucleotide Polymorphism) molecular marker related to ovipneumonia infection resistance and application of SNP molecular marker

Abstract

The invention particularly relates to an SNP molecular marker related to ovipneumonia infection and application of the SNP molecular marker, and belongs to the field of genetic biology. The SNP molecular marker influencing the infection resistance of the ovipneumonia is located at the site 99752986 on the third chromosome, and the polymorphism of the SNP molecular marker is G / A. The SNP molecular marker can be used for identifying the sheep pneumonia infection resistance and selectively breeding.

Description

Technical Field

[0001] The invention belongs to the field of genetic biology, and in particular relates to a SNP molecular marker related to sheep pneumonia infection resistance and an application thereof. Background Art

[0002] Pneumonia in sheep is a multifactorial lung disease characterized by inflammation of the bronchioles and alveoli, often involving serum fibrinous exudate, epithelial cell desquamation, and, in severe cases, widespread fibrin deposition. Clinically, this pathology manifests as high fever, respiratory distress, rumination failure, lactation failure, pregnancy loss, and high mortality, posing a significant threat to both wild and domesticated populations. Studies have shown that pneumonia outbreaks in wild sheep populations have a mortality rate ranging from 30% to 90%, and these outbreaks can recur annually, leading to significant reductions in wild population sizes. In non-wild sheep, respiratory disease often leads to reduced daily weight gain and high mortality, resulting in significant economic losses for sheep farms. In the past, the genetic basis of resistance to pneumonia infection in sheep remained elusive due to a lack of effective genetic markers and advanced molecular biology techniques. However, advances in molecular genetics and whole-genome sequencing have enabled researchers to interrogate genetic variation associated with pneumonia resistance at the molecular level. In particular, the study of single nucleotide polymorphisms (SNPs) has provided new avenues for understanding the genetic control mechanisms of pneumonia resistance traits.

[0003] Genome-wide association studies (GWAS) and candidate gene analysis have become powerful tools for finding genetic markers associated with complex traits. Through these methods, researchers can not only identify specific gene regions associated with pneumonia infection resistance, but also explore how these genetic factors affect the formation and development of pneumonia infection resistance in sheep. In addition, the interaction between environmental factors and genes is also an important research area in the formation of pneumonia infection resistance because they jointly determine the final phenotype of the animal. The SNP markers in the present invention were discovered in this context, which provides new tools and ideas for future genetic improvement and biological research on pneumonia infection resistance. This discovery not only has important application value for sheep breeding, but also provides us with a new perspective to understand and manipulate pneumonia infection resistance traits. Summary of the Invention

[0004] The main purpose of the present invention is to provide a SNP molecular marker related to sheep pneumonia infection resistance. The SNP molecular marker can be used to accurately select genes, thereby efficiently breeding sheep with ideal pneumonia infection resistance, which makes up for the technical defect of the existing technology that lacks SNP molecular markers directly related to sheep pneumonia infection resistance.

[0005] The present invention adopts the following technical solutions to achieve the above-mentioned purpose:

[0006] A SNP molecular marker associated with sheep pneumonia infection resistance, wherein the SNP molecular marker is located at position 99752986 on chromosome 3, and the polymorphism of the SNP molecular marker is G / A.

[0007] The present invention also provides the use of the SNP molecular marker in identifying the sheep pneumonia infection resistance trait.

[0008] A method for identifying sheep pneumonia infection resistance using the above-mentioned SNP molecular markers comprises the following steps:

[0009] Step (1) using the sheep genomic DNA to be tested as a template and using specific primers of the SNP molecular marker to perform PCR amplification to obtain a PCR product;

[0010] Step (2), sequencing the PCR products and analyzing the genotype;

[0011] Step (3), result judgment: judging whether the sheep has low pneumonia infection resistance or high pneumonia infection resistance according to different genotypes; sheep with the gene at the 99752986 site of chromosome 3 being GG or GA are low pneumonia infection resistance type; sheep with the gene at the 99752986 site of chromosome 3 being AA are high pneumonia infection resistance type.

[0012] The KASP primers used in the SNP molecular markers consist of two specific primers and one universal primer.

[0013] The specific primers include:

[0014] Primer·X:GAAGGTGACCAAGTTCATGCTACGCAGACGCTCAGGCCTCCTC, as shown in SEQ ID NO.1;

[0015] Primer Y:GAAGGTCGGAGTCAACGGATTACGCAGACGCTCAGGCCTCCTT, as shown in SEQ ID NO.2;

[0016] The universal primers are:

[0017] Primer C: GGCTGCTCACTGTTTCTTGTTCAG, as shown in SEQ ID NO. 3;

[0018] The fluorescent linker sequence GAAGGTGACCAAGTTCATGCT was connected to the 5' end of the specific primer Primer·X as the FAM fluorescent linker sequence;

[0019] The fluorescent linker sequence GAAGGTCGGAGTCAAC GGATT was connected to the 5' end of the specific primer Primer Y as the HEX fluorescent linker sequence.

[0020] Furthermore, the annealing temperature for PCR amplification in the above method is 56-65°C.

[0021] The present invention provides application of the method for identifying sheep pneumonia infection resistance using the SNP molecular marker in sheep breeding.

[0022] The present invention has the following beneficial effects:

[0023] With the expansion of the sheep industry, the incidence of infectious respiratory diseases in sheep has gradually increased, becoming a key factor restricting the development of the sheep industry. Such diseases not only lead to slower daily weight gain and increased mortality, but also cause serious economic losses to the sheep industry. However, there is still a lack of in-depth understanding of the pathogenic mechanism of sheep pneumonia.

[0024] The SNP markers identified in this study are important for breeding strategies to improve sheep's resistance to pneumonia infection. High infection resistance indicates a higher resistance to pneumonia infection under the same feeding conditions, while low pneumonia infection resistance indicates a higher susceptibility to pneumonia infection under the same feeding conditions compared to high infection resistance.

[0025] Using this molecular marker, breeders can more accurately select sheep with higher resistance to pneumonia infection, thereby improving breeding efficiency and precision. Furthermore, this marker has important application prospects in studying the genetic regulatory mechanisms of sheep pneumonia resistance, helping to further understand the genetic background of sheep pneumonia resistance. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Figure 1 : Pictures of different sheep lung infection conditions in Example 1. The left side shows a picture of the lungs of sheep with high infection resistance under the same feeding conditions, and the right side shows a picture of the lungs of sheep with low infection resistance under the same feeding conditions;

[0027] Figure 2 : Sheep genotyping diagram in Example 1;

[0028] Figure 3 : Boxplot of the association analysis between SNPs and sheep pneumonia infection resistance phenotype in Example 1. DETAILED DESCRIPTION

[0029] The present invention is further illustrated below with reference to specific examples. It should be understood that these examples are only used to illustrate the present invention and are not used to limit the scope of the present invention. After reading the present invention, modifications of various equivalent forms of the present invention made by those skilled in the art all fall within the scope of protection of the claims of this application.

[0030] Example 1 Identification of sheep pneumonia infection resistance using SNP molecular marker chr3:99752986

[0031] The experimental subjects were 61 six-month-old triple-cross sheep, which were Duolang sheep, Australian White Dorper sheep and Hu sheep.

[0032] The KASP primers used in the SNP molecular markers consist of two specific primers and one universal primer.

[0033] The specific primers include:

[0034] Primer·X:GAAGGTGACCAAGTTCATGCTACGCAGACGCTCAGGCCTCCTC, as shown in SEQ ID NO.1;

[0035] Primer Y:GAAGGTCGGAGTCAACGGATTACGCAGACGCTCAGGCCTCCTT, as shown in SEQ ID NO.2;

[0036] The universal primers are:

[0037] Primer C: GGCTGCTCACTGTTTCTTGTTCAG, as shown in SEQ ID NO. 3;

[0038] The fluorescent linker sequence GAAGGTGACCAAGTTCATGCT was connected to the 5' end of the specific primer Primer·X as the FAM fluorescent linker sequence;

[0039] The fluorescent linker sequence GAAGGTCGGAGTCAAC GGATT was connected to the 5' end of the specific primer Primer Y as the HEX fluorescent linker sequence;

[0040] The identifiable fluorescent signal is introduced by the amplification reaction of different alleles, and the genotype can be determined by detecting the fluorescent color.

[0041] The method is as follows:

[0042] (1) DNA extraction using whole blood precipitation method

[0043] a. Format the blood samples to be extracted in 96 wells and prepare a formatting table;

[0044] b. Prepare a lysis mixture based on the number of blood samples to be extracted (whole blood lysis buffer and proteinase K in a 10:1 ratio). Aliquot 300 μl of the lysis mixture into each well of a new 1.3 ml 96-well conical plate. Then, in the order in which the whole blood samples were mixed, add 100 μl of the inverted whole blood sample to each 1.3 ml 96-well conical plate. Heat-seal with aluminum foil and thoroughly mix the blood sample and lysis mixture. Incubate in a 65°C water bath until the sample is completely lysed.

[0045] c. Remove the 1.3 ml 96-well conical-bottom plate from the water bath after overnight lysis, wipe off any water stains, centrifuge briefly, remove the aluminum foil heat seal, add 1 / 3 volume of protein scavenger to each well, mix well, let stand for 10 minutes, and centrifuge at 3600 rpm for 10 minutes.

[0046] d. Prepare a new 0.8ml 96-well conical-bottom plate and dispense 200μl of isopropanol into each well.

[0047] e. Transfer 200 μl of the supernatant from the 1.3 ml 96-well conical-bottom plate to a 0.8 ml 96-well conical-bottom plate filled with isopropanol (be careful not to aspirate the precipitate when transferring the supernatant), mix well, let stand for 5 minutes, and centrifuge at 3600 rpm for 10 minutes.

[0048] f. Discard the supernatant, add 500 μl of 80% anhydrous ethanol to each well for washing, centrifuge at 3600 rpm for 10 min, discard the supernatant, dry, add 100 μl of sterile water and mix thoroughly. After the DNA is completely dissolved, perform quality control and store the DNA in a refrigerator at 4°C.

[0049] The DNA of the sheep to be tested was extracted according to the above method. The genomic DNA of the sheep to be tested was used as a template and the specific primers of the SNP molecular marker were used for PCR amplification. The amplification system was shown in Table 1 and the amplification procedure was shown in Table 2. The PCR primers were obtained. The PCR products of different sheep were electrophoresed on 1% agarose gel. Figure 1 As shown:

[0050] Table 1 PCR system

[0051] Final concentration Actual usage 100 μM Primer C 0.375μM 0.0030μl 100μM Primer X 0.15μM 0.0012μl 100μM Primer Y 0.15μM 0.0012μl 2×KASP Master Mix 1× 0.4 μl Ultrapure water 0.3946μl DNA (dried) 10ng-20ng Total volume 0.8 μl

[0052] Table 2 Touch down PCR amplification conditions are as follows

[0053]

[0054]

[0055] (2) After the PCR reaction is completed, ARAYA is used to scan the fluorescence signal of the reaction system; then INTELLICS is used for data analysis and genotyping. According to the analysis results, the sheep genotype is divided into three types: GG, GA, and AA. Figure 2 shown.

[0056] (3) Result determination:

[0057] The experimental sheep were dissected and the lung lesion ratio was analyzed using Image software. The calculation formula was:

[0058]

[0059] A lesion rate higher than 20 was considered to have low resistance to pneumonia infection, and a lesion rate lower than 20 was considered to have high resistance to pneumonia infection.

[0060] Sheep pneumonia infection Figure 1 The SNP correlation analysis is shown in Figure 3 As shown, sheep whose gene at chromosome 3 99752986 site is GA or GG have severe lung infection and higher lesion rate, showing lower resistance to pneumonia infection; sheep whose gene at chromosome 3 99752986 site is AA have mild lung infection and lower lesion rate, showing higher resistance to pneumonia infection.

[0061] Based on the above experimental results, it can be judged that sheep mainly show low pneumonia infection resistance or high pneumonia infection resistance; among them, sheep with the gene at the 99752986 site of chromosome 3 being GG or GA are low pneumonia infection resistance type; sheep with the gene at the 99752986 site of chromosome 3 being AA are high pneumonia infection resistance type.

Claims

1. A SNP molecular marker associated with sheep pneumonia infection resistance, characterized in that: The SNP molecular marker is located at position 99752986 on chromosome 3, and the polymorphism of the SNP molecular marker is G / A.

2. Use of the SNP molecular marker according to claim 1 in identifying resistance to sheep pneumonia infection.

3. A method for identifying sheep pneumonia infection resistance using the SNP molecular marker according to claim 1, characterized in that: The following steps are involved: Step (1), extracting DNA from the sheep to be tested; Using the sheep genomic DNA to be tested as a template, PCR amplification was performed using specific primers of SNP molecular markers to obtain PCR products; Step (2), sequencing the PCR products and analyzing the genotype; Step (3), result judgment: judging the sheep's resistance to pneumonia infection according to different genotypes; sheep with the gene at the 99752986 site of chromosome 3 being GG or GA are of low pneumonia infection resistance type; sheep with the gene at the 99752986 site of chromosome 3 being AA are of high pneumonia infection resistance type; The KASP primers used in the SNP molecular markers consist of two specific primers and one universal primer, and the two specific primers are respectively: Primer·X:GAAGGTGACCAAGTTCATGCTACGCAGACGCTCAGGCCTCCTC, as shown in SEQ ID NO.1; Primer Y:GAAGGTCGGAGTCAACGGATTACGCAGACGCTCAGGCCTCCTT, as shown in SEQ ID NO.2; The universal primers are: Primer C: GGCTGCTCACTGTTTCTTGTTCAG, as shown in SEQ ID NO. 3; The fluorescent linker sequence GAAGGTGACCAAGTTCATGCT was connected to the 5' end of the specific primer Primer·X as the FAM fluorescent linker sequence; The fluorescent linker sequence GAAGGTCGGAGTCAAC GGATT was connected to the 5' end of the specific primer Primer Y as the HEX fluorescent linker sequence.

4. The method according to claim 3, characterized in that The annealing temperature for PCR amplification is 56-65°C.

5. Use of the method according to claim 3 or 4 in sheep breeding.

Images