SNP (Single Nucleotide Polymorphism) molecular marker related to initial laying weight of chicken and application of SNP molecular marker

By screening out SNP sites related to chicken production weight in the promoter region of the IGFBP-2 gene, developing SNP molecular markers and detection primer pairs, solving the problem of difficulty in screening chicken production weight in the prior art, and improving the breeding efficiency and production performance of laying hens.

CN120442819APending Publication Date: 2025-08-08SHANDONG AGRICULTURAL UNIVERSITY
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510785168.6
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-06-12
Publication Date
2025-08-08

AI Technical Summary

Technical Problem

It is difficult for the prior art to effectively use SNP molecular markers to screen and breed laying hen varieties with major production, resulting in a decrease in chicken immunity, an increase in deadlock and a decrease in production performance.

Method used

Two SNP sites significantly related to chicken prescription weight were identified in the promoter region of the IGFBP-2 gene (7_23309098 and 7_23308838), and corresponding SNP molecular markers and detection primer pairs were developed to identify the weight traits of chicken prescription weight.

Benefits of technology

Effective screening and breeding of laying hens with major production capacity has been achieved, the production performance of chickens during the egg laying period has been improved, and the deadlock rate and breeding costs have been reduced.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120442819A_ABST
    Figure CN120442819A_ABST
Patent Text Reader

Abstract

The invention discloses an SNP (Single Nucleotide Polymorphism) molecular marker related to the first laying weight of chicken and application thereof, and belongs to the technical field of molecular genetics. According to the invention, a key promoter region of the IGFBP-2 gene is identified by researching the promoter region of the IGFBP-2 gene; the method comprises the following steps of: screening two SNP loci, namely 723309098 (C / T) and 723308838 (C / T), which are remarkably related to the chicken first-laying weight in a key promoter region of the IGFBP-2 gene, based on the two SNP loci, developing the SNP molecular marker which is remarkably related to the chicken first-laying weight character, and detecting the SNP molecular marker, so that the breeding of a laying hen variety with large first-laying weight is facilitated, and the breeding cost is reduced. And beneficial help is provided for breeding work.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the technical field of molecular genetics, and in particular to a SNP molecular marker associated with chicken initial laying weight and an application thereof. Background Art

[0002] The starting weight of chickens is a crucial indicator for layer breeding and production. Whether or not weight meets the standard before the start of laying has a significant impact on mortality during the laying period. Underweight chickens, coupled with the intense pressure of egg production after the start of laying, can gradually weaken the flock's immunity, leading to a poor immune response and the occurrence of atypical outbreaks, which directly reduces production performance. Furthermore, this decline in health leads to increased mortality, persistent bacterial diseases, and increased pharmaceutical costs, resulting in high breeding costs and a direct impact on profitability.

[0003] Single nucleotide polymorphisms (SNPs) refer to DNA sequence polymorphisms caused by variations in a single nucleotide at the genomic level, leading to genetic differences between individuals. As the simplest form of inter-individual DNA variation, SNPs are numerous, widely distributed, and genetically stable. They are currently the most commonly used molecular markers and hold great potential for studying inter-individual genetic variation, analyzing genetic mechanisms, and selecting for dominant traits.

[0004] Research on the relationship between SNPs and egg production performance in poultry is extensive. For example, two SNPs in the key promoter region of the FSHR gene were significantly associated with age at first laying and number of eggs laid at 43 weeks of age in Dongxiang and Suken chickens, suggesting that this may affect egg production by influencing FSHR expression (Li et al., 2019a). Three SNPs in the promoter and exon regions of the GDF9 gene were significantly associated with age at first laying and weight at first laying in Dongxiang and Luhua chickens, and also affected GDF9 gene expression levels (Liu et al., 2018). Five SNPs in the promoter region of the RLN3 gene were significantly associated with age at first laying and number of eggs laid in Zaozhuang Sunzhi chickens, providing potential DNA markers for improving egg production performance (Zhang et al., 2024b). In addition, studies have identified multiple genes associated with egg production traits through genome-wide association analysis based on single SNPs combined with multi-omics analysis, revealing the molecular mechanisms of multi-tissue coordinated regulation of egg production in chickens (Wang et al., 2024). Therefore, identifying functional SNPs that affect egg production performance, or using SNP-assisted molecular markers to locate genes or regulatory regions associated with egg production traits and analyze genetic regulatory mechanisms, is of great significance for improving poultry egg production performance and poultry breeding. Summary of the Invention

[0005] In view of the above-mentioned prior art, the purpose of the present invention is to provide a SNP molecular marker related to the weight of chickens at the beginning of laying hens and its application.

[0006] To achieve the above object, the present invention adopts the following technical solutions:

[0007] In a first aspect of the present invention, a SNP molecular marker is provided that is associated with the weight of chickens at the beginning of laying. The nucleotide sequence of the SNP molecular marker is shown in SEQ ID No. 1, and comprises a first SNP site and a second SNP site.

[0008] The 112th base from the 5' end of the sequence shown in SEQ ID No. 1 is the first SNP site, and its base is C or T; the 372nd base from the 5' end of the sequence shown in SEQ ID No. 1 is the second SNP site, and its base is C or T.

[0009] The details are as follows:

[0010] CACAATGGCGTTGCACCAAATG CCTGGCAAAGAACCGGGCTGAAACCCTCCCCTAGGGGAA CGACCCCCATCGGCCACCTAAAAAATGCTTTACAATGAGGTTCAGGCTGC[C / T]CCTTGTGCTTAC AAAGGGAGAAAGGCAGATGTCAGCCCGTGTACCGAGAGTGTGAGGGCATGGCGCTCACCACGGGGAGAAAACCAACGTTGGATGCTTGGAATATTTAACCGCCTGCAACAGATAATTAGCCAAACCCT CTTACGCCTCCAAATATAGCTTCATTAGTCATATGAAAATATCTCATTGGAACCAAATGTGAGTCATTAGTGAAGTCAACAGCAGATCATAAAAAAAGGTACTGAGAGCCTTGAGAAAT[C / T]GTGAG CGTGCGGTGAGAATAACTCAGCGCGTTGTGCACGGAACATCTGCTCACAGGGGCTGCCGTGTCCCCCATTCCTGCCATGGGATGTGCAGCAGGAAAAACACAGAGCGTGCACTGGGCTTCTGCTGCTTCTTTTTTGTCAGCCTCTAAAAAGGAGAGGGACTCTGATGGGTGAAACCCTTGTAAGAATGGAGTTATTCTTTGGGGAAATGTGGGG AGCGGGGTGGGAAGGTGTGCTTAG .

[0011] Note: "[C / T]" in the sequence is a SNP site, which is represented by "n" in the sequence table.

[0012] The present invention detected two SNP sites in the promoter region of the chicken IGFBP-2 gene that were significantly associated with the weight of chickens at the beginning of laying.

[0013] The physical position of the first SNP site is 7_23309098; the physical position of the second SNP site is 7_23308838.

[0014] The reference genome for the above physical location is GRCg6a; GenBank accession: GCA_000002315.5.

[0015] The genotypes of these two SNPs are associated with the weight at the start of laying (BW), and can be used to screen laying hens with larger weight at the start of laying, thereby improving the production performance of the flock throughout the laying period.

[0016] The second aspect of the present invention provides the use of the above-mentioned SNP molecular marker in chicken genetic breeding.

[0017] In the above application, the chicken genetic breeding is: breeding laying hens with large laying weight.

[0018] In the above application, individuals with CC genotype at 7_23309098 (the first SNP site) and CC genotype at 7_23308838 (the second SNP site) correspond to the trait of large birth weight.

[0019] In a third aspect of the present invention, a primer pair for detecting the above-mentioned SNP molecular marker is provided, wherein the nucleotide sequences of the primer pair are shown in SEQ ID No. 2 and SEQ ID No. 3; specifically, as follows:

[0020] F: CACAATGGCGTTGCACCAAATG; (SEQ ID No. 2)

[0021] R: AGCGGGGTGGGAAGGTGTGCTTAG. (SEQ ID No.3)

[0022] In a fourth aspect, the present invention provides a kit for detecting the above-mentioned SNP molecular marker, wherein the kit comprises a primer pair shown in SEQ ID No. 2 and SEQ ID No. 3.

[0023] A fifth aspect of the present invention provides the use of the above primer pair and / or kit in assisting the breeding of laying hen breeds with large weight at the start of production.

[0024] A sixth aspect of the present invention provides a method for identifying the weight trait of laying hens, comprising the following steps:

[0025] The genomic DNA of the laying hen to be tested is used as a template, and PCR amplification is performed using the primers shown in SEQ ID No. 2 and SEQ ID No. 3 to obtain an amplified product; the amplified product is sequenced, and the egg-laying traits of the laying hen are identified based on the sequencing results.

[0026] Specifically, if the sequencing result of the amplified product corresponds to the sequence shown in SEQ ID No. 1, and the 112th base from the 5' end is a CC genotype, and the 372nd base is a CC genotype, then the animal is identified as having the trait of large initial weight.

[0027] Beneficial effects of the present invention:

[0028] The present invention studies the IGFBP-2 gene promoter region and identifies the key promoter region of the IGFBP-2 gene. Then, two SNP sites significantly correlated with the chicken's initial weight at laying are screened in the key promoter region of the IGFBP-2 gene, namely 7_23309098 (C / T) and 7_23308838 (C / T). Based on these two SNP sites, the present invention develops a SNP molecular marker significantly associated with the chicken's initial weight at laying. Detection of the SNP molecular marker facilitates the selection of laying hen breeds with a large initial weight at laying, providing beneficial assistance for breeding work. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] Figure 1 : Results of PCR amplification of the IGFBP-2 gene promoter region.

[0030] Figure 2 : Comparison analysis of the recombinant vector of IGFBP-2 gene promoter region and its NCBI sequence.

[0031] Figure 3 : Double enzyme digestion verification of IGFBP-2 gene promoter region deletion vector.

[0032] Figure 4 : Luciferase activities of promoter fragments of different lengths of IGFBP-2 gene (n=4), different lowercase letters indicate significant differences (P<0.05).

[0033] Figure 5 : Polymorphism of the key promoter region of IGFBP-2 gene in different chicken breeds.

[0034] Figure 6 : Genotype peak diagram of two SNP sites. DETAILED DESCRIPTION

[0035] It should be noted that the following detailed descriptions are illustrative and intended to provide further explanation of the present application. Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art to which the present application belongs.

[0036] In order to enable those skilled in the art to more clearly understand the technical solution of the present application, the technical solution of the present application will be described in detail below with reference to specific embodiments.

[0037] The test materials used in the examples of the present invention are all conventional test materials in the field and can be purchased through commercial channels. Experimental methods without detailed conditions were carried out in accordance with conventional test methods or the operating instructions recommended by the supplier.

[0038] Hailan brown laying hens come from the Linxi Village Farm in Fan Town, Tai'an City; Langya chickens come from Shandong Jihua Poultry Breeding Co., Ltd.; Zaozhuang Sunzhi chickens come from the Zaozhuang Sunzhi Chicken Breeding Base (Zhonghui Agriculture); Jining 100-day chickens come from the Jining Datang 100-day chicken breeding farm.

[0039] Example 1: Identification of SNP markers in the chicken IGFBP-2 gene promoter region

[0040] 1. Construction of full-length vector of IGFBP-2 gene promoter region:

[0041] Using the mixed genomic DNA of 35 Jining 100-day-old chickens as a template, the IGFBP-2 gene promoter region was amplified using a high-fidelity DNA polymerase, and a 2,919 bp fragment was obtained ( Figure 1 ).

[0042] The fragment was then inserted into the pGL3-Basic vector and sent to the company for sequencing. The sequencing results were compared with the IGFBP-2 promoter region sequence in the NCBI database (NC_052538.1). Figure 2 As shown in Figure 2, the sequence similarity reached 99.31%, proving that the full-length recombinant vector of the IGFBP-2 promoter region has been successfully constructed. The vector was named pGL3-IGFBP2-F1

[0043] 2. Construction of IGFBP-2 gene promoter region deletion vector:

[0044] Based on the full-length recombinant vector of the IGFBP-2 promoter region, upstream primers were designed for each 600 bp reduction, while the downstream primers remained unchanged, to construct promoter deletion vectors of different fragment lengths. The primers used to construct the IGFBP-2 gene promoter region deletion vectors are shown in Table 1.

[0045] Table 1: Primers for constructing promoter region deletion vector

[0046]

[0047] The constructed promoter deletion vectors were named pGL3-IGFBP2-F2, -F3, -F4, and -F5. The results were verified by double enzyme digestion. Figure 3 As shown in the figure, the fragment length is consistent with the expected result. The recombinant plasmid was sent to the company for sequencing, and the fragment similarity after sequence comparison was greater than 99%.

[0048] 3. Dual luciferase activity analysis of IGFBP-2 gene promoter region deletion vector:

[0049] The recombinant plasmids of different lengths were transfected into Post-GCs, and the dual luciferase activity was detected 24 hours later. Figure 4 When the promoter region -1088 bp was deleted, the fluorescence activity decreased significantly, indicating that the -1679 bp to -1088 bp segment is the key segment of the IGFBP-2 gene promoter, with a total length of 591 bp.

[0050] 4. Identification of key SNPs in the promoter region of the IGFBP-2 gene:

[0051] Using whole-genome sequencing data, we screened for single-nucleotide polymorphisms (SNPs) within the key promoter region of the IGFBP-2 gene. We selected one high-yielding laying hen breed, the Hailan Brown, and three low-yielding local laying hen breeds: the Langya, Jining, and Zaozhuang Sunzhi. Genomic DNA from the blood of at least 20 chickens of each breed was used as a template for PCR amplification of the key promoter region containing the SNP. Each sample was amplified independently. After gel electrophoresis revealed the correct band, the gel block was excised and sent to our company for sequencing. Finally, the genotype of the SNP in each sample was analyzed using DNAMAN and Chromas software.

[0052] result Figure 5 As shown, two SNP sites were screened, both of which exist in different chicken breeds. The physical position of the first SNP site is 7_23309098, and its nucleotide polymorphism is C / T; the physical position of the second SNP site is 7_23308838, and its nucleotide polymorphism is C / T.

[0053] Chromas software was used to view the peak graph of each SNP site in the sequencing results and genotype each sample. The results are as follows Figure 6 As shown, there are three genotypes at both SNP sites.

[0054] Example 2: Association analysis between SNP sites in the key promoter region of the IGFBP-2 gene and egg-laying traits of Langya chickens

[0055] A population of 1,183 Langya chickens with production records was selected. 1-2 mL of blood was collected from the wing vein in an anticoagulant tube. Association analysis was performed between the two SNPs identified in Example 2 (7_23309098 and 7_23308838) and egg production traits. The details are as follows:

[0056] Genotypes at loci 7_23309098 and 7_23308838 were determined in a Langya chicken population through genome sequencing and then analyzed for association with egg production traits, including age at first lay (AFE), egg weight at first lay (EW), body weight at first lay (BW), total eggs at 43 weeks of age (E43), and maximum consecutive days of laying (LCS). The results are shown in Table 2.

[0057] Table 3: Association analysis between SNP sites in the key promoter region of IGFBP-2 gene and egg production traits of Langya chicken

[0058]

[0059]

[0060] Note: AFE: Age at first laying, BW: Body weight at first laying, EW: Egg weight at first laying, E43: Total number of eggs laid at 43 weeks of age, LCS: Longest consecutive days of laying. When P < 0.05, the association between each genotype and egg production traits was significantly different, otherwise it was not significant.

[0061] The results showed that both loci 7_23309098 and 7_23308838 were significantly associated with weight at birth (BW), among which the CC genotype of locus 7_23309098 corresponded to a larger weight at birth; the CC genotype of locus 7_23308838 corresponded to a larger weight at birth.

[0062] Example 3: Application of SNP molecular markers in the key promoter region of the IGFBP-2 gene in laying hen breeding

[0063] Based on the two SNP sites significantly associated with the weight at the start of laying in chickens identified in Example 2, this example designed a SNP molecular marker associated with the weight at the start of laying in chickens. The nucleotide sequence of the SNP molecular marker is shown in SEQ ID No. 1, comprising a first SNP site and a second SNP site;

[0064] The 112th base from the 5' end of the sequence shown in SEQ ID No. 1 is the first SNP site, and its base is C or T; the 372nd base from the 5' end of the sequence shown in SEQ ID No. 1 is the second SNP site, and its base is C or T.

[0065] A detection primer pair was designed based on the above-mentioned SNP molecular markers. The nucleotide sequences of the primer pair are shown in SEQ ID No. 2 and SEQ ID No. 3. Specifically, the primer pair is as follows:

[0066] F: CACAATGGCGTTGCACCAAATG; (SEQ ID No. 2)

[0067] R: AGCGGGGTGGGAAGGTGTGCTTAG. (SEQ ID No. 3).

[0068] Another 200 Langya chickens with production performance records were selected as test subjects to verify the performance of the SNP molecular marker in the key promoter region of the IGFBP-2 gene. Specifically:

[0069] The genomic DNA of the laying hen to be tested is used as a template, and PCR amplification is performed using the primers shown in SEQ ID No. 2 and SEQ ID No. 3 to obtain an amplified product; the amplified product is sequenced, and the egg-laying traits of the laying hen are identified based on the sequencing results.

[0070] If the sequencing result of the amplified product corresponds to the sequence shown in SEQ ID No. 1 and the 112th base from the 5' end is a CC genotype and the 372nd base is a CC genotype, then the product is identified as having the trait of large initial weight.

[0071] It has been verified that the laying weight trait of laying hens predicted by using the above-mentioned SNP molecular markers is consistent with the records of actual production performance of laying hens, and has practical application value.

[0072] The above description is merely a preferred embodiment of the present application and is not intended to limit the present application. Various modifications and variations are possible for those skilled in the art. Any modifications, equivalent substitutions, or improvements made within the spirit and principles of the present application shall be included within the scope of protection of the present application.

Claims

1. A SNP molecular marker associated with chicken weight at the start of laying, characterized in that: The nucleotide sequence of the SNP molecular marker is shown in SEQ ID No. 1, comprising a first SNP site and a second SNP site; The 112th base from the 5' end of the sequence shown in SEQ ID No. 1 is the first SNP site, and its base is C or T; the 372nd base from the 5' end of the sequence shown in SEQ ID No. 1 is the second SNP site, and its base is C or T.

2. Use of the SNP molecular marker according to claim 1 in chicken genetic breeding.

3. The use according to claim 2, characterized in that The chicken genetic breeding is to select and breed laying hens with large laying weight.

4. The use according to claim 2 or 3, characterized in that Individuals whose first SNP site in the SNP molecular marker is the CC genotype and / or whose second SNP site is the CC genotype correspond to the trait of large birth weight.

5. A primer pair for detecting the SNP molecular marker according to claim 1, characterized in that: The nucleotide sequences of the primer pair are shown in SEQ ID No. 2 and SEQ ID No.

3.

6. A kit for detecting the SNP molecular marker according to claim 1, characterized in that: The kit contains the primer pair according to claim 5.

7. Use of the primer pair according to claim 5 and / or the kit according to claim 6 in assisting the breeding of laying hen breeds with large weight at the start of production.

8. A method for identifying the weight trait of laying hens, characterized in that: The following steps are involved: The genomic DNA of the laying hen to be tested is used as a template, and the primers shown in SEQ ID No. 2 and SEQ ID No. 3 are used to perform PCR amplification to obtain an amplified product; the amplified product is sequenced, and the egg-laying traits of the laying hen are identified based on the sequencing results.

9. The method according to claim 8, characterized in that If the sequencing result of the amplified product corresponds to the sequence shown in SEQ ID No. 1 and the 112th base from the 5' end is a CC genotype and the 372nd base is a CC genotype, then the product is identified as having the trait of large initial weight.