TaqMan real-time fluorescent quantitative PCR probe and primer combination for identifying ampullaria gigas, kit and application of TaqMan real-time fluorescent quantitative PCR probe and primer combination
By designing the probe primer combination of TaqMan real-time fluorescence quantitative PCR in Fushou Snail, the problem of insufficient specificity and sensitivity of Fushou Snail detection in the existing technology has been solved, and the rapid and accurate Fushou Snail identification has been achieved, which has promoted the progress of related prevention and control and research work.
Patent Information
- Application Number
- CN202510818043.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-06-18
- Publication Date
- 2025-08-08
AI Technical Summary
The existing Fushou snail detection methods are not specific, prone to non-specific amplification, and insufficient detection sensitivity and reliability, making it difficult to achieve rapid and accurate identification.
A probe primer combination for real-time fluorescence quantitative PCR of Fushou Snail was designed, including specific probes, upstream primers and downstream primers. Through real-time fluorescence quantitative PCR reaction of TaqMan, combined with specific amplification conditions, high specificity and sensitivity detection of Fushou Snail was achieved.
It improves the accuracy and sensitivity of Fushou snail detection, shortens the detection time, achieves fast, stable and reliable identification, and reduces costs.
Smart Images

Figure CN120442820A_ABST
Abstract
Description
Technical Field
[0001] The embodiments of the present invention relate to the field of biological detection technology, and specifically to a probe primer combination, a kit and an application thereof for identifying Pomacea canaliculata using TaqMan real-time fluorescence quantitative PCR. Background Art
[0002] The golden apple snail (Pomacea canaliculata) is a mollusk of the family Pomacea and genus Pomacea. Its shell looks similar to that of a field snail. Native to the tropical and subtropical regions of Central America, it is widely distributed in North America, Asia, and Africa, and has become a global invasive alien species. The golden apple snail not only causes serious damage to aquatic plants and affects the ecological balance of water bodies, but also competes with native snails for living resources, resulting in damage to biodiversity. More importantly, the golden apple snail is the intermediate host of a variety of parasites, such as the Guangzhou roundworm. Once humans accidentally eat uncooked golden apple snails, they are at risk of contracting parasitic diseases, which seriously threatens human health.
[0003] Currently, the main detection methods for golden apple snails include morphological testing and traditional molecular biological testing. Morphological testing mainly relies on observing the morphological characteristics, color, size, etc. of the golden apple snail for identification. However, this method is greatly influenced by the subjective experience of the operator. It is difficult to accurately identify juvenile golden apple snails and individuals with similar morphology to other snails. It is also time-consuming and cannot meet the needs of rapid testing. Traditional molecular biological detection methods such as conventional PCR can amplify specific genes, but are prone to cross-contamination and cannot achieve accurate quantitative analysis of the number of golden apple snails. The accuracy and reliability of the test results are limited.
[0004] With the development of molecular biology techniques, real-time fluorescence quantitative PCR (PCR) has been widely used in biological detection due to its high sensitivity, high specificity, and ability to accurately quantify target nucleic acids. However, for the detection of golden apple snails, existing real-time fluorescence quantitative PCR fluorescent primer combinations suffer from weak specificity, which can easily lead to nonspecific amplification and interfere with the accuracy of test results. Furthermore, the amplification efficiency of some primer combinations does not reach the ideal range of 90%-110%, significantly compromising the sensitivity and reliability of the test. Summary of the Invention
[0005] To this end, the embodiments of the present invention provide a probe and primer combination, a kit, and an application for identifying Pomacea canaliculata using TaqMan real-time fluorescence quantitative PCR.
[0006] In order to achieve the above objectives, the embodiments of the present invention provide the following technical solutions:
[0007] According to a first aspect of an embodiment of the present invention, the present invention provides a probe primer combination for identifying golden apple snails by TaqMan real-time fluorescence quantitative PCR, comprising a probe, an upstream primer and a downstream primer, wherein the nucleotide sequence of the probe is: 5'-FAM-CCTTCTCTATTACTACTATTA-MGB-3', the nucleotide sequence of the upstream primer is 5'-CTTTTCCGCGTCTTAATAACATG-3', and the nucleotide sequence of the downstream primer is 5'-CATCCAGTTCCAGCACCACTC-3'.
[0008] According to a second aspect of the embodiments of the present invention, the present invention provides a kit for identifying Pomacea canaliculata using TaqMan real-time fluorescence quantitative PCR, comprising the probe and primer combination described above.
[0009] According to a third aspect of the embodiments of the present invention, the present invention provides the use of the probe and primer combination as described above, or the kit as described above, in identifying species of Golden Apple Snails.
[0010] According to a fourth aspect of an embodiment of the present invention, the present invention provides a method for identifying species of golden apple snails, the method comprising:
[0011] (1) Extracting cDNA or genomic DNA from the sample to be tested;
[0012] (2) performing TaqMan real-time fluorescence quantitative PCR reaction using the above-mentioned probe, upstream primer, and downstream primer to obtain a Ct value and an amplification curve;
[0013] (3) Determination of test results: If the Ct value is ≤35 and a typical amplification curve appears, the result is positive; if there is no Ct value or no amplification curve, the result is negative; if the Ct value is >35, the sample is repeated. If there is no Ct value in the repeated result, it is negative; otherwise, it is positive.
[0014] Furthermore, the TaqMan real-time fluorescence quantitative PCR reaction system was as follows: 10 μL of premixed reagent, 0.7 μL of 10 μM upstream primer, 0.7 μL of 10 μM downstream primer, 0.6 μL of 10 μM TaqMan probe, 1 μL of DNA template, and supplemented with ddH2O to a total volume of 20 μL.
[0015] Furthermore, the TaqMan real-time fluorescence quantitative PCR reaction conditions were as follows: pre-denaturation at 95°C for 2 min; 95°C for 15 s, 60°C for 30 s, and 40 cycles.
[0016] The embodiments of the present invention have the following advantages:
[0017] The TaqMan probe real-time fluorescence PCR probe and primer combination established in the present invention has excellent specificity and sensitivity in identifying golden apple snail species, greatly improving the accuracy of detection while shortening the detection time, achieving stable, reliable, short cycle and low cost effects, which is of great significance for achieving rapid and accurate identification of golden apple snails and promoting related prevention and control and research work. BRIEF DESCRIPTION OF THE DRAWINGS
[0018] To more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for the embodiments or the description of the prior art. Obviously, the drawings described below are merely exemplary, and those skilled in the art can derive other implementation drawings based on the provided drawings without inventive effort.
[0019] Figure 1 A specificity verification amplification curve provided by the present invention;
[0020] Figure 2 The amplification curve diagram of different copy numbers of the golden apple snail gene provided by the present invention;
[0021] Figure 3 This is a standard curve diagram for the gene detection of Golden Apple Snail provided by the present invention. DETAILED DESCRIPTION
[0022] The following describes the implementation of the present invention using specific embodiments. Those skilled in the art will readily understand the other advantages and benefits of the present invention from the disclosure herein. Obviously, the embodiments described are only a portion of the present invention, not all of it. All other embodiments derived by persons of ordinary skill in the art based on the embodiments of the present invention without inventive effort are intended to fall within the scope of protection of the present invention.
[0023] Example 1 Design of primers and probes
[0024] Mitochondrial sequences of the target species and related species were downloaded from the NCBI database and aligned using MEGA6 software. Species-specific regions were selected and primers and probes were designed using Primer Express 3.0.1 software to ensure specific detection of the target species. Primer and probe design and synthesis were performed by Beijing Qingke Biotechnology Co., Ltd. Primer and probe information is provided in Table 1 below.
[0025] Table 1
[0026] name Sequence (5'→3') Upstream primer 5'-CTTTTCCGCGTCTTAATAACATG-3'(SEQ ID NO:1) Downstream primer 5'-CATCCAGTTTCCAGCACCACTC-3'(SEQ ID NO:2) probe 5'-FAM-CCTTCTCTATTACTACTATTA-MGB-3'(SEQ ID NO:3)
[0027] Example 2 Specificity Detection
[0028] Positive DNA samples were extracted from golden apple snails, red-eared sliders, bullfrogs, giant African snails, alligator snapping turtles, snapping turtles, and Procambarus clarkii. DNA templates were extracted from scaly snails, red-eared sliders, bullfrogs, giant African snails, snapping turtles, and small snapping turtles as negative samples. ddH2O was used instead of the nucleic acid in the system as a no-template control (NFC). Amplification was performed using the upstream and downstream primers and probes listed in Table 1. Primer and probe specificity was verified by Ct values. Each sample was assayed in triplicate. DNA templates were extracted using a commercially available kit.
[0029] The real-time fluorescence PCR reaction system was as follows: 2xT5 Fast qPCR Mix (Qingke, TSE301) 10 μL, upstream primer 10 μM 0.7 μL, downstream primer 10 μM 0.7 μL, probe 10 μM 0.6 μL, DNA template 1 μL, and ddH2O was added to make up the total volume to 20 μL.
[0030] The real-time fluorescence amplification program was as follows: pre-denaturation at 95°C for 2 min, 1 cycle; 95°C for 15 s, 60°C for 30 s, 40 cycles; and collection of fluorescence signals during annealing and extension (60°C).
[0031] The results are shown in Table 2 and Figure 1 , the positive sample showed a typical S-shaped amplification curve (see Figure 1 ), while other negative samples and no-template controls showed a straight line (see Figure 1 There was no increase in fluorescence value, indicating that the primers and probes provided by the present invention can specifically detect the DNA of golden apple snails.
[0032] Table 2
[0033]
[0034]
[0035] Example 3 Probe amplification efficiency detection
[0036] The target product obtained by amplification in Example 2 was cloned into a vector (Qingke pClone007 Versatile SimpleVector). The resulting plasmid was sequenced and verified as a standard plasmid for amplification efficiency testing of Pomacea canaliculata. The nucleotide sequence of the Pomacea canaliculata standard plasmid is as follows:
[0037] AGTTCGATGTAACCCACTCGTGCACCCAACTGATCTTCAGCATCTTT
[0038] TACTTTCACCAGCGTTTCTGGGTGAGCAAAAACAGGAAGGCAAAATGCC
[0039] GCAAAAAACGGAATAAGTGCGACACGGAAATGTTGAATACTCATTTTAG
[0040] CTTCCTTAGCTCCTGAAAATCTCGATAACTCAAAAAATACGCCCGGTAGT
[0041] GATCTTATTTCATTATGGTGAAAGTTGGAACCTCTTACGTGCCGATCAAGT
[0042] CAAAAGCCTCCGGTCGGAGGCTTTTGACTTTCTGTTCCGGCTCGTATGTT
[0043] GTGTCTATGGAAGCGGATAACAATTTCACACAGGAAACAGCTATGACCA
[0044] AGTTTGACATCCTTCAGGTGGACTCAAGACTGCAATCGCGTGTCGCCCTT
[0045] CTTTTCCGCGTCTTAATAACATGAGATTTTGATTATTACCACCTTCTCTATT
[0046] ACTACTATTATCGTCTGCTGCTGTTGAGAGTGGTGCTGGAACTGGATGAA
[0047] GGGCGACACGCGATTGCAGTGTAACACGAGTGATCCTGAGTTCAGATCA
[0048] ACTGGCCGTCGTTTTACACAATCAAGTCGTGACTGGGAAAACCCTGGCG
[0049] CTCCAACTTAATCGCCTTGCAGCACTGGCTCACCTTCACGGGTGGGCCTT
[0050] TCTTCGGTAGAAAATCAAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGT
[0051] AATCTGCTGCTTGCAAACAAAAAAACCACCGCTACCAGCGGTGGTTTGT
[0052] TTGCCGGATCAAGAGCTACCAACTCTTTTTCCGAGGTAACTGGCTTCAGC
[0053] AGAGCGCAGATACCAAATACTGTTCTTCTAGTGTAGCCGTAGTTAGGCCA
[0054] CCACTTCAAGAACTCTGTAGCACCGCCTACATACCTCGCTCTGCTAATCC
[0055] TGTTACCAGTGGCTGCTGCCAGTGGCGATAAGTCGTGTCTTACCGGGTTG
[0056] GACTCAAGACGATAGTTACCGGATAAGGCGCAGCGGTCGGGCTGAACGG
[0057] GGGGTTCGTGCACACAGCCCAGCTTGGAGCGAACGACCTACACCGAAC
[0058] TGAGATACCTACAGCGTGAGCTATGAGAAAGCGCCACGCTTCCCGAAGG
[0059] GAGAAAGGCGGACAGGTATCCGGTAAGCGGCAGGGTCGGAACAGGAGA
[0060] GCGCACGAGGGAGCTTCCAGGGGGAAACGCCTGGTATCTTTATAGTCCT
[0061] GTCGGGTTTCGCCACCTCTGACTTGAGCATCGATTTTTGTGATGCTCGTC
[0062] AGGGGGGCGGAGCCTATGGAAAAACGCCAGCAACGCAGAAAGGCCCAC
[0063] CCGAAGGTGAGCCAGGTGATTACATTTGGGCCCTCATTACCAATGCTTAA
[0064] TCAGTGAGGCACCTATCTCAGCGATCTGTCTATTTCGTTCATCCATAGTTG
[0065] CCTGACTCCCCGTCGTGTAGATAACTACGATACGGGAGGGCTTACCATCT
[0066] GGCCCCAGTGCTGCAATGATACCGCGAGACCCACGCTCACCGGCTCCAG
[0067] ATTTATCAGCAATAAACCAGCCAGCCGGAAGGGCCGAGCGCAGAAGTGG
[0068] TCCTGCAACTTTATCCGCCTCCATCCAGTCTATTAATTGTTGCCGGGAAGC
[0069] TAGAGTAAGTAGTTCGCCAGTTAATAGTTTGCGCAACGTTGTTGCCATTG
[0070] CTACAGGCATCGTGGTGTCACGCTCGTCGTTTGGTATGGCTTCATTCAGC
[0071] TCCGGTTCCCAACGATCAAGGCGAGTTACATGATCCCCCATGTTGTGCAA
[0072] AAAAGCGGTTAGCTCCTTCGGTCCTCCGATCGTTGTCAGAAGTAAGTTG
[0073] GCCGCAGTGTTATCACTCATGGTTATGGCAGCACTGCATAATTCTCTTACT
[0074] GTCATGCCATCCGTAAGATGCTTTTCTGTGACTGGTGAGTACTCAACCAA
[0075] GTCATTCTGAGAATAGTGTATGCGGCGACCGAGTTGCTCTTGCCCGGCGT
[0076] CAATACGGGATAATACCGCGCCACATAGCAGAACTTTAAAAGTGCTCATC
[0077] ATTGGAAAACGTTCTTCGGGGCGAAAACTCTCAAGGATCTTACCGCTGT
[0078] TGAGATCC, see SEQ ID NO:4.
[0079] The standard plasmid of Pomacea canaliculata was diluted as a positive standard and detected according to the real-time fluorescence PCR reaction system and amplification procedure of Example 2. Each dilution factor was repeated 3 times to obtain the probe gradient amplification curve ( Figure 2 , 1: dilution factor 10^3, 2: dilution factor 10^4, 3: dilution factor 10^5, 4: dilution factor 10^6, 4: dilution factor 10^7), CT and copy number LOG values were fitted to obtain the standard curve equation ( Figure 3 ), detect R 2 The results reached 0.9998, indicating a good linear relationship between the CT and the logarithmic copy number values within the range of 4.43E+7 to 4.43E+3 copies / µL for the Pomacea canaliculata gene. Based on the established standard curve, the amplification efficiency was calculated to be 96.8%. The test data are shown in Table 3.
[0080] Table 3
[0081]
[0082] After the plasmid was diluted 10^7 times, the detection repeatability was good, and the probe detection efficiency was within the normal range (90%-110%), and the sensitivity could meet the experimental requirements.
[0083] Although the present invention has been described in detail above using general descriptions and specific embodiments, it will be apparent to those skilled in the art that modifications and improvements may be made thereto. Therefore, such modifications and improvements, without departing from the spirit of the present invention, are intended to be within the scope of protection claimed herein.
[0084]
[0085]
[0086]
Claims
1. A probe and primer combination for identifying Pomacea canaliculata by TaqMan real-time fluorescence quantitative PCR, characterized in that: The method comprises a probe, an upstream primer and a downstream primer, wherein the nucleotide sequence of the probe is 5'-FAM-CCTTCTCTATTACTACTATTA-MGB-3', the nucleotide sequence of the upstream primer is 5'-CTTTTCCGCGTCTTAATAACATG-3', and the nucleotide sequence of the downstream primer is 5'-CATCCAGTTCCAGCACCACTC-3'.
2. A kit for identifying Pomacea canaliculata by TaqMan real-time fluorescence quantitative PCR, characterized in that: Comprising the probe primer combination as claimed in claim 1.
3. Use of the probe-primer combination according to claim 1 or the kit according to claim 2 in identifying species of Golden Apple Snail.
4. A method for identifying species of golden apple snails, characterized in that: The method comprises: (1) Extracting cDNA or genomic DNA from the sample to be tested; (2) performing a TaqMan real-time fluorescence quantitative PCR reaction using the probe, upstream primer, and downstream primer as claimed in claim 1 to obtain a Ct value and an amplification curve; (3) Determination of test results: If the Ct value is ≤35 and a typical amplification curve appears, the result is positive; if there is no Ct value or no amplification curve, the result is negative; if the Ct value is >35, the sample is repeated. If there is no Ct value in the repeated result, it is negative; otherwise, it is positive.
5. The method for identifying species of golden apple snails according to claim 4, wherein: The TaqMan real-time fluorescence quantitative PCR reaction system is as follows: 10 μL of premixed reagent, 0.7 μL of 10 μM upstream primer, 0.7 μL of 10 μM downstream primer, 0.6 μL of 10 μM TaqMan probe, 1 μL DNA template, and ddH2O is added to make up the total volume to 20 μL.
6. The method for identifying species of golden apple snails according to claim 4, wherein: The reaction conditions of TaqMan real-time fluorescence quantitative PCR were as follows: pre-denaturation at 95°C for 2 min; 40 cycles of 95°C for 15 s and 60°C for 30 s.
Citation Information
Cited By
Rapid detection primer group, rapid detection method and kit for pomacea canaliculata and application of rapid detection primer group and rapid detection method for pomacea canaliculata
CN121472430A
A detection primer set, detection method, kit and application of apple snail
CN121472430B