Celine distemper virus VP2 protein monoclonal antibody and application thereof in preparation of fluorescent microsphere antigen detection test strip

By preparing fluorescent microsphere antigen detection strips for the feline distemper virus-specific monoclonal antibodies FPV-VP2-2A2 and FPV-VP2-2D9, the existing detection methods are solved in a complicated and inaccurate manner under non-laboratory conditions, and the rapid and accurate detection of feline distemper virus antigens is achieved, with significant improvement in sensitivity and specificity.

CN120446475APending Publication Date: 2025-08-08CHINA ANIMAL HUSBANDRY IND
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510342725.7
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-03-21
Publication Date
2025-08-08

AI Technical Summary

Technical Problem

The existing cat distemper virus detection methods are cumbersome, time-consuming and require professional equipment and technicians under non-laboratory conditions, and there is a risk of false positive or false negative, making it difficult to achieve a fast and accurate diagnosis.

Method used

The feline distemper virus-specific monoclonal antibodies FPV-VP2-2A2 and FPV-VP2-2D9 were used to prepare fluorescent microsphere antigen detection strips, and the antigen to be tested was detected by the double-anti-anti-sandwich method, and the specific antibodies on the fluorescent microsphere binding pad and chromatography membrane were used for rapid detection.

Benefits of technology

It realizes fast, accurate and simple antigen detection of feline distemper virus under non-laboratory conditions, with high sensitivity and strong specificity, suitable for early diagnosis, with a 100-fold increase in sensitivity and a compliance rate of up to 99.0%.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120446475A_ABST
    Figure CN120446475A_ABST
Patent Text Reader

Abstract

The invention discloses preparation of a feline distemper virus VP2 protein monoclonal antibody and application of the feline distemper virus VP2 protein monoclonal antibody in preparation of a fluorescent microsphere antigen detection test strip. The monoclonal antibody is as shown in 1) and 2), wherein the monoclonal antibody contains a heavy chain variable region FPV-VP2-2A2-VH and a light chain variable region FPV-VP2-2A2-VL; a heavy chain variable region FPV-VP2-2D9-VH and a light chain variable region FPV-VP2-2D9-VL are included, and the heavy chain variable region FPV-VP2-2D9-VH and the light chain variable region FPV-VP2 1) the amino acid sequence of the heavy chain variable region is as shown in SEQ ID No.1 in a sequence table; the amino acid sequence of the light chain variable region is as shown in SEQ ID No.2 in the sequence table. 2) the amino acid sequence of the heavy chain variable region is shown as SEQ ID No.3 in the sequence table; and the amino acid sequence of the light chain variable region is as shown in SEQ ID No.4 in the sequence table. The feline plague fluorescent microsphere antigen test strip composed of the two antibodies can be used for detecting feline plague antigens, is high in sensitivity and good in specificity, and can be used for early diagnosis of feline plague infection.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The invention belongs to the technical field of feline distemper antigen detection, and particularly relates to the preparation of a monoclonal antibody against the VP2 protein of a feline distemper virus and the application of the antibody in the preparation of a fluorescent microsphere antigen detection test strip. Background Art

[0002] Feline Parvovirus (FPV), also known as feline parvovirus, feline infectious enteritis virus, or feline panleukopenia virus, is the pathogen that causes feline distemper in felines. Taxonomically, it belongs to the genus Parvovirus in the family Parvoviridae. It is a non-enveloped, single-stranded, negative-sense DNA virus with equiaxially symmetrical icosahedral virions 20-24 nm in diameter. The main clinical symptoms of feline distemper are high fever, vomiting, severe leukopenia, diarrhea, and severe dehydration. It is an acute, highly contagious disease. FPV can naturally infect a wide range of species, including cats and mustelids. The infection rate in cats under one year old can reach 70%, with a mortality rate of 50-60%. The mortality rate in kittens under five months of age can reach as high as 80-90%. In group-housed cats, outbreaks can occur throughout the entire flock or litter. In recent years, the number of clinical cases of feline distemper in my country has been increasing.

[0003] Currently, the commonly used methods for detecting feline distemper virus in laboratories include virus isolation and culture, electron microscopy, PCR, and serological tests. However, although the virus isolation and culture method is the "gold standard" for laboratory diagnosis of pathogens, this method is time-consuming and often requires 1-2 weeks to complete. Electron microscopy can directly observe virus particles, but this method requires a large number of virus particles. The number of virus particles in clinical samples does not meet the requirements for electron microscopy observation, and this detection method requires the operator to have professional technical skills. Therefore, this method is not commonly used in clinical practice. PCR, including conventional PCR detection and qPCR, can detect the DNA of the corresponding virus by testing fecal or anal swab samples, thereby achieving the purpose of detecting trace amounts of viral nucleic acid. However, this method may cause false positives or false negatives due to sample contamination, and improper primer design and improper target sequence selection may affect the specificity and sensitivity of the PCR reaction. Commonly used methods in serological testing include enzyme-linked immunosorbent assay (ELISA) and colloidal gold test strips. Although the ELISA method can carry out corresponding detection of the target antigen, the method needs to be carried out in a laboratory, and requires professional and technical personnel and specialized instruments to complete, and different operators will cause large errors to the relevant results. Compared with the above-mentioned detection methods, the operation is cumbersome and the detection is time-consuming, and expensive instruments and equipment and professional and technical personnel are required to operate, and it is difficult to complete the detection under the conditions of the grassroots field such as non-laboratories. The test strip detection has the advantages of being simple and rapid, having strong specificity, high sensitivity, being readable with the naked eye, and being easy to preserve the results, and can quickly detect a large number of samples. Advantages such as the detection can be widely used in pet hospitals and families. Therefore, the present invention has developed a fluorescent microsphere test strip for detecting feline distemper antigens quickly, accurately and effectively for clinical diagnosis. Summary of the Invention

[0004] The purpose of the present invention is to provide a method for detecting feline distemper antigens quickly, accurately and effectively. To solve the above technical problems, the present invention adopts the following technical solutions:

[0005] The present invention provides a monoclonal antibody for detecting feline distemper virus. The monoclonal antibodies are respectively feline distemper virus-specific monoclonal antibody FPV-VP2-2A2 obtained by secretion of hybridoma cell FPV-VP2-2A2 strain and feline distemper virus-specific monoclonal antibody FPV-VP2-2D9 obtained by secretion of hybridoma cell FPV-VP2-2D9 strain.

[0006] The feline distemper virus-specific monoclonal antibody FPV-VP2-2A2 contains a heavy chain variable region FPV-VP2-2A2-V H and light chain variable region FPV-VP2-2A2-V L ; The FPV-VP2-2A2-V Hand the FPV-VP2-2A2-V L The complementary regions of the determinants are composed of CDR1, CDR2 and CDR3; the FPV-VP2-2A2-V H The amino acid sequence of CDR1 is shown in amino acids 31 to 35 of SEQ ID No. 1; the FPV-VP2-2A2-V H The amino acid sequence of CDR2 is shown in amino acids 50 to 66 of SEQ ID No. 1; the FPV-VP2-2A2-V H The amino acid sequence of CDR3 is shown in amino acids 99 to 108 of SEQ ID No. 1; the FPV-VP2-2A2-V L The amino acid sequence of CDR1 is shown in amino acids 24 to 34 of SEQ ID No. 2; the FPV-VP2-2A2-V L The amino acid sequence of CDR2 is shown in amino acids 50 to 55 of SEQ ID No. 2; the FPV-VP2-2A2-V L The amino acid sequence of CDR3 is shown as amino acids 89 to 97 of SEQ ID No. 2.

[0007] The feline distemper virus-specific monoclonal antibody FPV-VP2-2D9 contains a heavy chain variable region FPV-VP2-2D9-V H and light chain variable region FPV-VP2-2D9-VL; the FPV-VP2-2D9-V H The complementary region of the determinant cluster of the FPV-VP2-2D9-VL is composed of CDR1, CDR2 and CDR3; the FPV-VP2-2D9-V H The amino acid sequence of CDR1 is shown in amino acids 31 to 35 of SEQ ID No. 1; the FPV-VP2-2D9-V H The amino acid sequence of CDR2 is shown in amino acids 50 to 66 of SEQ ID No. 3; the FPV-VP2-2D9-V H The amino acid sequence of CDR3 is shown in amino acids 99 to 109 of SEQ ID No. 3; the FPV-VP2-2D9-V LThe amino acid sequence of CDR1 of the FPV-VP2-2D9-VL is shown as amino acids 24 to 37 of SEQ ID No.4; the amino acid sequence of CDR1 of the FPV-VP2-2D9-VL is shown as amino acids 24 to 34 of SEQ ID No.4; the amino acid sequence of CDR2 of the FPV-VP2-2D9-VL is shown as amino acids 50 to 56 of SEQ ID No.4; the amino acid sequence of CDR3 of the FPV-VP2-2D9-VL is shown as amino acids 89 to 97 of SEQ ID No.4.

[0008] Preferably, the FPV-VP2-2A2-V H The amino acid sequence of FPV-VP2-2A2-V L The amino acid sequence is shown in positions 1 to 107 of SEQ ID No. 2 in the sequence listing.

[0009] Preferably, the FPV-VP2-2D9-V H The amino acid sequence of FPV-VP2-2D9-V is shown in the 1st to 120th positions of SEQ ID No.3 in the sequence list; L The amino acid sequence is shown in positions 1 to 107 of SEQ ID No. 4 in the sequence listing.

[0010] The above-mentioned heavy chain variable region and light chain variable region sequences can be connected with animal-derived constant regions (such as mouse antibody heavy chain and light chain constant regions) to prepare monoclonal antibodies that can specifically bind to feline distemper virus.

[0011] The invention discloses a feline distemper virus fluorescent microsphere antigen detection test strip, comprising a backing, a sample pad, a fluorescent microsphere binding pad, a chromatography membrane and a water-absorbing pad on the backing; the fluorescent microsphere binding pad is embedded with a feline distemper virus-specific monoclonal antibody FPV-VP2-2A2 labeled with fluorescent microspheres; the chromatography membrane is provided with a detection line and a quality control line; the quality control line on the chromatography membrane is sprayed with goat anti-mouse IgG; and the detection line on the chromatography membrane is sprayed with a feline distemper virus-specific monoclonal antibody FPV-VP2-2D9.

[0012] The backing is a polyethylene backing.

[0013] Also includes loading cartridges.

[0014] The absorbent pad is made of absorbent filter paper; the fluorescent microsphere binding pad is made of glass cellulose membrane;

[0015] The chromatography membrane is a nitrocellulose membrane.

[0016] The use of the above-mentioned enzyme-linked immunosorbent assay strips in the preparation of a kit for specifically detecting feline distemper virus antigens also falls within the scope of protection of the present invention.

[0017] The use of the above-mentioned monoclonal antibody that can specifically bind to feline distemper virus antigen in the preparation of a test strip for detecting feline distemper virus is also within the scope of protection of the present invention.

[0018] The present invention provides a method for preparing the above-mentioned reagent strip, characterized in that a PVC base plate is used as a test plate, (this statement is not very clear) a sample pad, a fluorescent microsphere binding pad, a nitrocellulose membrane, and a water-absorbing pad are sequentially attached to the PVC base plate, with each adjacent portion overlapping by 2 mm. The fluorescent microsphere binding pad is made of glass fiber, and the prepared fluorescent microsphere-labeled monoclonal antibody FPV-VP2-2A2 is evenly applied to the fluorescent microsphere binding pad portion, dried at 37°C for 3 hours, and two lines are coated on the nitrocellulose membrane: a quality control line (C line) and a test line (T line), wherein the T line coating is the monoclonal antibody FPV-VP2-2D9 at a concentration of 1.0 mg / mL, and the C line coating is purified goat anti-mouse IgG antibody at a concentration of 1.0 mg / mL, which is then sprayed on the nitrocellulose membrane using a film spray gold instrument. After assembly, the large plate is cut into 4 mm bare strips using a strip cutter for later use.

[0019] Furthermore, the final concentration of the fluorescent microsphere-labeled monoclonal antibody FPV-VP2-2A2 mixture is 10 μg / mL.

[0020] The feline distemper virus antigen detection test strip provided by the present invention detects the antigen to be tested using a double antibody sandwich method. The dominant feline distemper virus antigen epitope, VP2 protein, is obtained through the construction, prokaryotic expression, and purification of a recombinant plasmid. Subsequently, two feline distemper virus monoclonal antibodies are obtained after immunization of mice, cell fusion, hybridoma cell line screening, and ascites preparation and purification. The antigen is detected using the double antibody sandwich method, demonstrating high sensitivity and specificity, and can be used for the early diagnosis of feline distemper virus infection. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 This is a schematic diagram of the fluorescent microsphere test strip;

[0022] Figure 2 The VP2 protein of FPV-VP2 was purified and then analyzed by SDS-PAGE.

[0023] Figure 3 The sensitivity test results of the fluorescent microsphere test strips; from left to right are FPV virus dilution 10 1 times, 10 2 times, 10 3 times, 10 4 times, 10 5 times and 10 6times the test results;

[0024] Figure 4 1-2: are the test results of the test strip for FCV and FHV-I respectively. DETAILED DESCRIPTION

[0025] The methods in the following examples are all conventional methods unless otherwise specified.

[0026] Example 1. Preparation of Feline Distemper Virus VP2 Protein

[0027] (1) Synthesis of feline distemper virus gene and construction of prokaryotic expression vector pET-28a-VP2

[0028] The sequence of the FPV Jilin strain HH-1 / 86 was selected for expression of the relevant VP2 protein. Following codon optimization based on the gene sequence published on NCBI (GenBank Accession No. KX900570.1), the gene was submitted to Beijing Qingke Biotechnology Co., Ltd. for gene synthesis (with a His tag added to the C-terminus) and construction of the pET-28a-VP2 prokaryotic expression vector. The synthesized recombinant plasmid was then transformed into BL21(DE3) engineered bacteria.

[0029] (2) Expression and purification of feline distemper virus VP2 protein

[0030] The recombinant positive strain transformed with pET-28a-VP2 was inoculated into Kan-resistant LB liquid medium and cultured overnight at 37°C, 200 rpm. The next day, the seed bacteria were inoculated into Kan-resistant LB liquid medium at a ratio of 1:100 and cultured at 20°C, 200 rpm, until the OD600nm of the culture reached 0.6-0.8. IPTG was then added to a final concentration of 1 mM and induced at 20°C for 16 hours. The supernatant was collected by centrifugation at 8000 rpm for 20 minutes at 4°C and purified using a Ni prepacked column.

[0031] (3) Identification of Feline Distemper Virus VP2 Protein

[0032] The expression product was detected by SDS-PAGE electrophoresis. Figure 1 As shown, the molecular weight of the expressed product is approximately 65 kDa, which is consistent with the expected protein size.

[0033] The antigenicity of the recombinant protein was identified by indirect ELISA method. The recombinant protein reacted specifically with rabbit anti-FPV positive serum (OD 450nm =1.874) had no cross reaction with negative serum of healthy rabbits (OD 450nm=0.112). Therefore, the VP2 recombinant protein (GenBank Accession No. KX900570.1) prepared in this study can be used as an immunogen for the subsequent preparation of FPV monoclonal antibodies.

[0034] Example 2. Screening of Feline Distemper Virus VP2 Protein-Positive Monoclonal Hybridoma Cell Lines

[0035] (1) Mouse immunization: 1 mg of VP2 protein was used as an immunogen and emulsified with an equal amount of Freund's adjuvant. Three SPF-grade Bal b / c female mice were immunized at a dose of 100 μg / mouse. The immunizations were repeated three times. Freund's complete adjuvant was used for the first immunization, and Freund's incomplete adjuvant was used for the second and third immunizations. Serum titers were tested after the three immunizations. The mice with the highest serum titers were selected for cell fusion. Three days before fusion, 100 μg of VP2 protein was used for intraperitoneal stimulation (without adjuvant).

[0036] (2) On the 7th day after the third immunization, blood was collected from the eye sockets to determine the serum antibody titer. The titer of the mice after the third immunization was tested using the indirect ELISA method. The results are shown in Table 1. The mouse with the highest serum titer was mouse No. 2, so mouse No. 2 was selected for cell fusion.

[0037] Table 1 FPV virus serum ELISA titer results

[0038]

[0039]

[0040] Note: The test is considered valid when the negative control OD value is less than 0.2. The S / N value is ≥2.1, which is considered positive (P); the S / N value is less than 2.1, which is considered negative (N).

[0041] (3) Cell fusion: The eyeballs of the mice to be fused were removed and bled, blood samples were collected, and serum was taken as a positive control. The mice were killed by cervical dislocation, soaked in 75% alcohol solution for disinfection, and then fixed on a wax plate. The spleen of the mice was then removed and placed in a culture dish to grind and collect spleen cells. The spleen cells and resuspended myeloma cells were centrifuged together at 1000 rpm for 10 minutes, and the supernatant was discarded. The spleen cells and myeloma cells were gently resuspended with DMEM, and the resuspended spleen cells and myeloma cells were gently mixed. The cells were centrifuged at 1000 rpm for 10 minutes, and the supernatant was discarded. 1 mL of PEG was used for fusion, and then DMEM culture medium was added to dilute the cells to terminate the fusion reaction. The cells were centrifuged at 1000 rpm for 10 minutes and the supernatant was discarded. The fused cells were resuspended in HAT culture medium and then added to a cell culture plate containing feeder cells at a volume of 100 uL / well. The cells were cultured in a cell culture incubator at 37°C and 5% CO2. After culturing for 3-5 days, the cell growth was observed under a microscope. The positive hybridoma cells could be detected after about 7 days.

[0042] (4) Screening of positive hybridoma cell lines: After 7 days of culture in HAT complete medium, ELISA screening was performed. Cells with ELISA test results with OD values higher than 1.0 were selected for subcloning. After subcloning, six hybridoma cell lines that could stably secrete monoclonal antibodies were identified and expanded for culture. The two cell lines with the highest positive results were named FPV-VP2-2A2 and FPV-VP2-2D9, with supernatant ELISA titers of OD values reaching 1.611 and 1.491, respectively.

[0043] Table 2 Screening test results of monoclonal cell lines (S / N value)

[0044]

[0045] Example 3. Preparation, purification and identification of monoclonal antibodies against feline distemper virus VP2 protein

[0046] (1) Preparation and purification of monoclonal antibodies against feline distemper virus VP2 protein

[0047] Monoclonal antibodies are primarily prepared by inducing ascites in mice. Sterile liquid paraffin is injected into the mouse peritoneal cavity one week prior to the test. One week later, the monoclonal cell lines FPV-VP2-2A2 and FPV-VP2-2D9 are injected into the mouse peritoneal cavity. After 5 days, abdominal changes are closely monitored. After 7-10 days, the ascites fluid is collected and purified using Protein G affinity chromatography for monoclonal antibody purification.

[0048] (2) Monoclonal antibody subtype identification: The antibody subtype was identified using a commercial monoclonal antibody subtype kit. The heavy chain subtype of the monoclonal antibodies FPV-VP2-2A2 and FPV-VP2-2D9 was IgG2a, and the light chain subtype was kappa.

[0049] (3) Identification of the specificity of monoclonal antibodies: FPV-VP2 protein, FPV virus strain PSY01, feline calicivirus fluid (CHZ05 strain) stored by our company, and feline rhinotracheitis virus type 1 virus fluid (HBJ06 strain) were used as coating antigens to determine the specificity of monoclonal antibodies. Monoclonal antibodies FPV-VP2-2A2 and FPV-VP2-2D9 reacted positively only with FPV-VP2 protein and FPV virus fluid coating, and were negative with the other two common viruses, indicating that monoclonal antibodies FPV-VP2-2A2 and FPV-VP2-2D9 are both specific monoclonal antibodies for FPV-VP2 protein.

[0050] Example 4. Gene sequencing, expression and identification of positive monoclonal hybridoma cell lines FPV-VP2-2A2 and FPV-VP2-2D9

[0051] Two positive cloned hybridoma cell lines were collected, RNA was extracted and reverse transcribed to obtain cDNA of the hybridoma cells as a template. The template cDNA was sent to Beijing Qingke Biotechnology Co., Ltd. for sequencing. The monoclonal antibody FPV-VP2-2A2 contains the heavy chain variable region FPV-VP2-2A2-V H and light chain variable region FPV-VP2-2A2-V L ; The FPV-VP2-2A2-V H The amino acid sequence of FPV-VP2-2A2-V L The amino acid sequence of FPV-VP2-2A2-V H and the FPV-VP2-2A2-V L The complementary regions of the determinants are composed of CDR1, CDR2 and CDR3; the FPV-VP2-2A2-V H The amino acid sequence of CDR1 is shown in amino acids 31 to 35 of SEQ ID No. 1; the FPV-VP2-2A2-V H The amino acid sequence of CDR2 is shown in amino acids 50 to 66 of SEQ ID No. 1; the FPV-VP2-2A2-V H The amino acid sequence of CDR3 is shown in amino acids 99 to 108 of SEQ ID No. 1; the FPV-VP2-2A2-V L The amino acid sequence of CDR1 is shown in amino acids 24 to 34 of SEQ ID No. 2; the FPV-VP2-2A2-V L The amino acid sequence of CDR2 is shown in amino acids 50 to 55 of SEQ ID No. 2; the FPV-VP2-2A2-V L The amino acid sequence of CDR3 is shown as amino acids 89 to 97 of SEQ ID No. 2;

[0052] The monoclonal antibody FPV-VP2-2D9 contains the heavy chain variable region FPV-VP2-2D9-V H and light chain variable region FPV-VP2-2D9-V L ; The FPV-VP2-2D9-V H The amino acid sequence of FPV-VP2-2D9-V is shown in the 1st to 120th positions of SEQ ID No.3 in the sequence list; LThe amino acid sequence of FPV-VP2-2D9-V is shown in the 1st to 107th positions of SEQ ID No. 4 in the sequence list. H and the FPV-VP2-2D9-V L The complementary regions of the determinants are composed of CDR1, CDR2 and CDR3; the FPV-VP2-2D9-V H The amino acid sequence of CDR1 is shown in amino acids 31 to 35 of SEQ ID No. 1; the FPV-VP2-2D9-V H The amino acid sequence of CDR2 is shown in amino acids 50 to 66 of SEQ ID No. 3; the FPV-VP2-2D9-V H The amino acid sequence of CDR3 is shown in amino acids 99 to 109 of SEQ ID No. 3; the FPV-VP2-2D9-V L The amino acid sequence of CDR1 of the FPV-VP2-2D9-VL is shown as amino acids 24 to 37 of SEQ ID No.4; the amino acid sequence of CDR1 of the FPV-VP2-2D9-VL is shown as amino acids 24 to 34 of SEQ ID No.4; the amino acid sequence of CDR2 of the FPV-VP2-2D9-VL is shown as amino acids 50 to 56 of SEQ ID No.4; the amino acid sequence of CDR3 of the FPV-VP2-2D9-VL is shown as amino acids 89 to 97 of SEQ ID No.4.

[0053] Example 5. Expression and identification of monoclonal antibodies FPV-VP2-2A2 and FPV-VP2-2D9

[0054] 5.1 Expression of VP2 Monoclonal Antibody

[0055] (1) Synthesis of gene sequences: Based on the determined sequences of the heavy and light chain variable regions of the monoclonal antibodies FPV-VP2-2A2 and FPV-VP2-2D9, the sequences of the heavy and light chain constant regions of the mouse antibodies were supplemented into the variable region portions, and then the gene sequences were synthesized and codon optimized for insect cells. The nucleotide sequences of the FPV-VP2-2A2 heavy chain and light chain are shown in SEQ ID No. 5 and SEQ ID No. 6 in the sequence listing; the nucleotide sequences of the FPV-VP2-2D9 heavy chain and light chain are shown in SEQ ID No. 7 and SEQ ID No. 8 in the sequence listing.

[0056] (2) Construction of shuttle vector: Based on the sequence information of the heavy and light chains and the sequence information of the pFastBacdual (purchased from ThermoFisher, catalog number 10712024) vector, corresponding primers were designed (sequences are shown in Table 4 below) to amplify the full-length fragments of the heavy and light chains. After gel recovery, the fragments were connected to the pFastBacdual vector by homologous recombination. The pFastBacdual vector contains two promoters, namely the PH promoter and the P10 promoter. After connection to the vector, sequence determination was performed to ensure the accuracy of the sequence.

[0057] Table 3 Primer sequence information for expression vector construction

[0058] name Sequence (5'-3') 2A2-HF TCATACATCTACGCGGCCGCTAGC CAAGTCCAACTCCAGCAGCC 2A2-HR TCCCCCATCTCCCGGTACCTGCGGACACTGTTACGAG 2A2-LF CTGCCTTTGCGCGGGATGAATTCGACATTCAAATGACACAAAG 2A2-LR CTAGTACTTCTCGACAAGCTT CTTGATCTCTACCTTTGTACC 2D9-HF TCATACATCTACGCGGCCGCTAGC CAAGTGCAGCTGCAACAACC 2D9-HR TCCCCCATCTCCCGGTACCGGCTGACACAGTAACAAG 2D9-LF CTGCCTTTGCGGCGGATGAATTC GATATAGTTATGACCCAATC 2D9-LR CTAGTACTTCTCGACAAGCTTTTCAATTCCAACTTTGTACC

[0059] (3) Screening and extraction of recombinant Bacmid: The constructed shuttle vector was transformed into DH10Bac competent cells and spread on triple-antibody plates (kanamycin, gentamicin, and tetracycline). After culturing at 37°C for 48 hours, white spots were picked and identified using M13 primers. The target fragment size of the positive clone was 4600 bp, and that of the negative clone was 300 bp. The clones with no 300 bp band were selected and shaken. After 12 hours, the Bacmid was extracted using the isopropanol precipitation method, and the concentration was then measured using Nanodrop.

[0060] (4) Rescue of recombinant baculovirus: Before transfection, the density of the recombinant baculovirus was 2×10 6 SF9 cells were plated in six-well plates and transfected with 5 μg and 2.5 μg of recombinant Bacmid using 8 μl of transfection reagent. The medium was changed 4-6 hours after transfection and cultured at 28°C. After 72 hours, the P2 virus was harvested and amplified. The same method was used for amplification of the P3 virus. The P4 virus was amplified in shake flasks at a virus inoculum ratio of 1:100.

[0061] (5) Expression and purification of specific monoclonal antibodies: The P4 virus was inoculated at a density of 2×10 6 Hi5 cells were cultured at 28°C and harvested after 48 hours. The cells were centrifuged at 8000 rpm for 1 hour, and the supernatant was filtered through a 0.22 μm filter for later use. Monoclonal antibodies were then purified using Protein G affinity chromatography.

[0062] 5.2 Identification of FPV monoclonal antibodies

[0063] Monoclonal Antibody Titer Assay: The sensitivity of the monoclonal antibodies was assessed using an indirect ELISA. FPV strain PSY01 was used as the coating antigen, and FPV-VP2-2A2 and FPV-VP2-2D9 were serially diluted to verify the sensitivity of the monoclonal antibodies. As shown in Table 4, the titers of both monoclonal antibodies were greater than 32,000-fold.

[0064] Table 4 Monoclonal Antibody Titer Detection

[0065] Dilution multiple mAb FPV-VP2-2A2 mAb FPV-VP2-2D9 1000 2.654 2.667 2000 2.53 2.463 4000 2.141 1.987 8000 1.634 1.476 16000 1.252 1.153 32000 0.902 0.846 Positive control 2.952 2.903 Negative control 0.103 0.102

[0066] Monoclonal antibody specificity testing: FPV virus strain PSY01, our company's feline calicivirus (CHZ05 strain), and feline rhinotracheitis virus type 1 (HBJ06 strain) were used as coating antigens to determine the specificity of the monoclonal antibodies. Monoclonal antibodies FPV-VP2-2A2 and FPV-VP2-2D9 reacted positive only with the FPV virus coating solution and were negative with the other two common viruses, indicating that both FPV-VP2-2A2 and FPV-VP2-2D9 are specific monoclonal antibodies for FPV.

[0067] Example 6. Preparation of Feline Distemper Virus VP2 Protein Fluorescent Microsphere Antigen Detection Test Strips

[0068] The preparation method of the feline distemper virus VP2 protein fluorescent microsphere antigen detection test strip prepared by the present invention is as follows:

[0069] 1 Preparation of fluorescent microsphere-labeled monoclonal antibodies

[0070] (1) Cleaning: Take 50 μL of time-resolved fluorescent microspheres with a particle size of 200 nm (Changsha Meiniu Biotechnology Co., Ltd.), add them to 950 μL of pure water, mix well, sonicate for 1 min, centrifuge at 12000 rpm / min for 15 min, and discard the supernatant.

[0071] (2) Activation: Take 500uL of activation solution to resuspend the microspheres, sonicate for 1 minute, then transfer to a shaker, activate at 37°C, 200rpm for 30 minutes, centrifuge at 12000rpm / min for 15 minutes, and discard the supernatant. Then wash the microspheres once with 500uL of pure water and 10mM boric acid buffer respectively, centrifuge at 12000rpm / min for 15 minutes, and discard the supernatant. Preparation of activation solution: Weigh 10mg NHS and dissolve it in 1mL of anhydrous ethanol, take 68uL of EDC and dissolve it in 932uL of pure water, the final concentration is 10mg / mL. Take 10uL of NHS and EDC and dissolve them separately, and add them to 980uL of pure water at the same time to prepare the activation solution, which is prepared before use.

[0072] (3) Coupling: resuspend the microspheres in 1 mL of 10 mM boric acid buffer, sonicate for 1 min, then add 10 μg of monoclonal antibody FPV-VP2-2A2, mix well, and couple at room temperature for 2 h.

[0073] (4) Blocking: Add 4% Casein protein to a final concentration of 0.2% and block at room temperature for 1 hour. Centrifuge at 12,000 rpm / min for 15 minutes and discard the supernatant.

[0074] (5) Resuspension: Take 400 μL of resuspension solution (10 mM boric acid buffer containing 5% sucrose, 1% Casein and 1% Tween-20, pH 8.0) to resuspend the microspheres, sonicate for 1 min to prepare a microsphere-labeled complex, and use a gold spray film device to evenly spray the solution onto the glass fiber at a rate of 2 μL / cm, and dry at 37°C for 3 h.

[0075] 2. Nitrocellulose membrane coating

[0076] The quality control line (C line) and the test line (T line) were sprayed on the surface of the nitrocellulose membrane using a gold spray film sprayer. The T line was coated with the monoclonal antibody FPV-VP2-2D9 at a concentration of 1.0 mg / mL, and the C line was coated with purified goat anti-mouse antibody at a concentration of 1.0 mg / mL. The spray volume for both lines was 1 μL / cm, and the distance between them was 0.5 cm.

[0077] 3Test strip assembly

[0078] Using a PVC substrate as the test plate, attach the sample pad (treated with 10 mM borate buffer containing 1% Casein, 1% Tween-20, and 1% NaCl for 5 minutes and then dried at 37°C for 3 hours), fluorescent microsphere conjugate pad, nitrocellulose membrane, and absorbent pad in the order shown, overlapping each other by 2 mm. Cut the assembled plate into 4 mm strips using a strip cutter for later use.

[0079] 4. Usage and judgment of test strips

[0080] Insert the sample to be tested into a sample tube containing sample treatment solution and dissolve it as much as possible in the solution. Add the treated sample vertically to the sample well of the test strip (4 drops) and let it sit horizontally at room temperature for 15 minutes before determining the result. If both the control line and the test line show color, the result is considered positive; if only the control line shows color, the result is considered negative; if the control line does not show color, the result is considered invalid and requires retesting.

[0081] Example 7. Application of Feline Distemper Virus VP2 Protein Fluorescent Microsphere Antigen Detection Test Strips

[0082] (1) Test strip sensitivity test: dilute the FPV virus solution 10 times in sequence, diluting it to 10 1 times, 102 times, 10 3 times, 10 4 times, 10 5 times and 10 6 Times, the test strips prepared by the present invention and the commercially available feline distemper virus colloidal gold test strips were used for detection. The sensitivity of the test strips of this product was 10 4 times( Figure 2 ), the sensitivity of commercial colloidal gold test strips is diluted to 10 2 times (Table 5). The sensitivity of the test strips of this product is about 100 times higher than that of commercially available test strips in detecting the corresponding virus solution.

[0083] Table 5 Test strip sensitivity detection

[0084] Dilution multiple Test strip of the present invention Commercially available colloidal gold test strips <![CDATA[10 1 ]]> Positive Positive <![CDATA[10 2 ]]> Positive Positive <![CDATA[10 3 ]]> Positive Negative <![CDATA[10 4 ]]> Positive Negative <![CDATA[10 5 ]]> Negative Negative <![CDATA[10 6 ]]> Negative Negative

[0085] (2) Test strip specificity test: The test strip was used to simultaneously detect feline calicivirus liquid FCV and feline rhinotracheitis virus type 1 virus liquid FHV-I, and the results were both negative ( Figure 3 ), indicating that the test strip has strong specificity.

[0086] (3) Repeatability test of test strips: 24 test strips were randomly selected from each of the three batches of test strips and tested for FPV virus dilution of 10 1 times, 10 2 times, 10 3 times, 10 4 times, 10 5 times and 10 6 The test strips were tested in triplicate using 2-fold dilutions of the same sample, as well as viral fluid samples of FCV and FHV-I. The sensitivity of the test strips was consistent within and between batches, with negative results for both FCV and FHV-I, indicating good reproducibility.

[0087] (4) Test strip stability test: The test strips were stored at 45°C for 30 days for accelerated aging. The sensitivity of the FPV virus solution was tested, and the virus solution samples of FCV and FHV-I were also tested. The test strips showed consistent sensitivity for FPV virus solution during the storage period, and the test results for FCV and FHV-I were all negative. This indicates that the test strips meet the stability requirements when stored at 45°C for 30 days.

[0088] (5) Clinical test with test strips: 295 samples collected by clinical PCR were tested with the test strips prepared by the present invention. The results are shown in the table below. Compared with the PCR method, the test strips prepared by the present invention had a positive coincidence rate of 95.7% and a total coincidence rate of 99.0%.

[0089] Table 6 Test strip compliance results

[0090]

[0091] In summary, the test strips of the present invention are 100 times more sensitive than existing commercial FPV test strips, have a high consistency with PCR in clinical testing, and offer more accurate test results compared to existing commercial test strips, overcoming the shortcomings of existing commercial test strips. The test strips of the present invention offer advantages such as simplicity, rapidity, strong specificity, high sensitivity, and easy storage of results, enabling early detection of FPV infection in cats.

Claims

1. A feline distemper virus fluorescent microsphere antigen detection test strip, characterized in that: The invention comprises a backing and a sample pad, a fluorescent microsphere binding pad, a chromatography membrane and a water-absorbing pad on the backing; the characteristic is that the fluorescent microsphere binding pad is embedded with a feline distemper virus-specific monoclonal antibody FPV-VP2-2A2 labeled with fluorescent microspheres, the chromatography membrane is provided with a detection line and a quality control line, the quality control line on the chromatography membrane is sprayed with goat anti-mouse IgG; the detection line on the chromatography membrane is sprayed with a feline distemper virus-specific monoclonal antibody FPV-VP2-2D9; The feline distemper virus-specific monoclonal antibody FPV-VP2-2A2 contains a heavy chain variable region FPV-VP2-2A2-V H and light chain variable region FPV-VP2-2A2-V L ; The FPV-VP2-2A2-V H and the FPV-VP2-2A2-V L The complementary regions of the determinants are composed of CDR1, CDR2 and CDR3; the FPV-VP2-2A2-V H The amino acid sequence of CDR1 is shown in amino acids 31 to 35 of SEQ ID No. 1; the FPV-VP2-2A2-V H The amino acid sequence of CDR2 is shown in amino acids 50 to 66 of SEQ ID No. 1; the FPV-VP2-2A2-V H The amino acid sequence of CDR3 is shown in amino acids 99 to 108 of SEQ ID No. 1; the FPV-VP2-2A2-V L The amino acid sequence of CDR1 is shown in amino acids 24 to 34 of SEQ ID No. 2; the FPV-VP2-2A2-V L The amino acid sequence of CDR2 is shown in amino acids 50 to 55 of SEQ ID No. 2; the FPV-VP2-2A2-V L The amino acid sequence of CDR3 is shown as amino acids 89 to 97 of SEQ ID No. 2; The feline distemper virus-specific monoclonal antibody FPV-VP2-2D9 contains a heavy chain variable region FPV-VP2-2D9-V H and light chain variable region FPV-VP2-2D9-V L ; The FPV-VP2-2D9-V H and the FPV-VP2-2D9-V L The complementary regions of the determinants are composed of CDR1, CDR2 and CDR3; the FPV-VP2-2D9-V H The amino acid sequence of CDR1 is shown in amino acids 31 to 35 of SEQ ID No. 1; the FPV-VP2-2D9-V H The amino acid sequence of CDR2 is shown in amino acids 50 to 66 of SEQ ID No. 3; the FPV-VP2-2D9-V H The amino acid sequence of CDR3 is shown in amino acids 99 to 109 of SEQ ID No. 3; the FPV-VP2-2D9-V L The amino acid sequence of CDR1 of the FPV-VP2-2D9-VL is shown as amino acids 24 to 37 of SEQ ID No.4; the amino acid sequence of CDR1 of the FPV-VP2-2D9-VL is shown as amino acids 24 to 34 of SEQ ID No.4; the amino acid sequence of CDR2 of the FPV-VP2-2D9-VL is shown as amino acids 50 to 56 of SEQ ID No.4; the amino acid sequence of CDR3 of the FPV-VP2-2D9-VL is shown as amino acids 89 to 97 of SEQ ID No.

4.

2. The feline distemper virus fluorescent microsphere antigen detection test strip according to claim 1, wherein: The FPV-VP2-2A2-V H The amino acid sequence of FPV-VP2-2A2-V L The amino acid sequence is shown in positions 1 to 107 of SEQ ID No. 2 in the sequence listing. Preferably, the FPV-VP2-2D9-V H The amino acid sequence of FPV-VP2-2D9-V is shown in the 1st to 120th positions of SEQ ID No.3 in the sequence list; L The amino acid sequence is shown in positions 1 to 107 of SEQ ID No. 4 in the sequence listing.

3. The feline distemper virus fluorescent microsphere antigen detection test strip according to claim 1, wherein: The backing is a polyethylene backing.

4. The feline distemper virus fluorescent microsphere antigen detection test strip according to any one of claims 1 to 3, wherein Also includes loading cartridge.

5. The feline distemper virus fluorescent microsphere antigen detection test strip according to any one of claims 1 to 3, characterized in that The absorbent pad is made of absorbent filter paper; the fluorescent microsphere binding pad is made of glass cellulose membrane; The chromatography membrane is a nitrocellulose membrane.

6. Feline distemper virus-specific monoclonal antibody, which is the monoclonal antibody described in any one of the following 1)-4): 1) Contains the heavy chain variable region FPV-VP2-2A2-V H and light chain variable region FPV-VP2-2A2-V L ; The FPV-VP2-2A2-V H and the FPV-VP2-2A2-V L The complementary regions of the determinants are composed of CDR1, CDR2 and CDR3; the FPV-VP2-2A2-V H The amino acid sequence of CDR1 is shown in amino acids 31 to 35 of SEQ ID No. 1; the FPV-VP2-2A2-V H The amino acid sequence of CDR2 is shown in amino acids 50 to 66 of SEQ ID No. 1; the FPV-VP2-2A2-V H The amino acid sequence of CDR3 is shown in amino acids 99 to 108 of SEQ ID No. 1; the FPV-VP2-2A2-V L The amino acid sequence of CDR1 is shown in amino acids 24 to 34 of SEQ ID No. 2; the FPV-VP2-2A2-V L The amino acid sequence of CDR2 is shown in amino acids 50 to 55 of SEQ ID No. 2; the FPV-VP2-2A2-V L The amino acid sequence of CDR3 is shown as amino acids 89 to 97 of SEQ ID No. 2; 2) Contains the heavy chain variable region FPV-VP2-2D9-V H and light chain variable region FPV-VP2-2D9-V L ; The FPV-VP2-2D9-V H and the FPV-VP2-2D9-V L The complementary regions of the determinants are composed of CDR1, CDR2 and CDR3; the FPV-VP2-2D9-V H The amino acid sequence of CDR1 is shown in amino acids 31 to 35 of SEQ ID No. 1; the FPV-VP2-2D9-V H The amino acid sequence of CDR2 is shown in amino acids 50 to 66 of SEQ ID No. 3; the FPV-VP2-2D9-V H The amino acid sequence of CDR3 is shown in amino acids 99 to 109 of SEQ ID No. 3; the FPV-VP2-2D9-V L The amino acid sequence of CDR1 is shown in amino acids 24 to 34 of SEQ ID No. 4; the FPV-VP2-2D9-V L The amino acid sequence of CDR2 is shown in amino acids 50 to 56 of SEQ ID No. 4; the FPV-VP2-2D9-V L The amino acid sequence of CDR3 is shown in amino acids 89 to 97 of SEQ ID No.

4. 3) Contains the heavy chain variable region FPV-VP2-2A2-V H and light chain variable region FPV-VP2-2A2-V L ; Contains the heavy chain variable region FPV-VP2-2A2-V H and light chain variable region FPV-VP2-2A2-V L ; The FPV-VP2-2A2-V H The amino acid sequence of FPV-VP2-2A2-V L The amino acid sequence is shown in positions 1 to 107 of SEQ ID No. 2 in the sequence listing; 4) Contains the heavy chain variable region FPV-VP2-2D9-V H and light chain variable region FPV-VP2-2D9-V L ; The FPV-VP2-2D9-V H The amino acid sequence of FPV-VP2-2D9-V is shown in the 1st to 120th positions of SEQ ID No. 3 in the sequence list; L The amino acid sequence is shown in positions 1 to 107 of SEQ ID No. 4 in the sequence listing.

7. Use of the feline distemper virus-specific monoclonal antibody according to claim 6 in preparing a kit for specifically detecting feline distemper antigen.

8. Use of the antigen detection test strip according to any one of claims 1 to 5 in preparing a test kit for specifically detecting feline distemper virus antigen.

9. The use according to claim 8, characterized in that The samples to be tested in the kit for specific detection of feline distemper virus antigen include anal swabs, feces and virus culture.

10. The preparation method of the feline distemper virus fluorescent microsphere antigen detection test strip according to claim 1, using a PVC base plate as a test plate, sequentially pasting a sample pad, a fluorescent microsphere binding pad, a nitrocellulose membrane, and a water-absorbing pad on the base plate, with each adjacent part 2mm overlapping, wherein, The fluorescent microsphere conjugate pad is glass fiber, and the prepared fluorescent microsphere-labeled feline distemper virus-specific monoclonal antibody FPV-VP2-2A2 is evenly coated on the fluorescent microsphere conjugate pad part and dried at 37°C for 3 hours. Two lines are coated on the nitrocellulose membrane: a quality control line and a test line, wherein the test line coating is the feline distemper virus-specific monoclonal antibody FPV-VP2-2D9 with a concentration of 1.0 mg / mL, and the quality control line coating is the purified goat anti-mouse IgG antibody with a concentration of 1.0 mg / mL. Then, it is sprayed on the nitrocellulose membrane using a film spray gold instrument. After assembly, the large plate is cut into 4 mm bare strips using a strip cutter; The final concentration of the mixture of feline distemper virus-specific monoclonal antibody FPV-VP2-2A2 labeled with fluorescent microspheres is 10 μg / mL.