Diagnostic reagent for lung adenocarcinoma radiotherapy prognosis and application thereof
By detecting the lactation levels of HAT1 and RPA1, evaluating the resistance characteristics of radiotherapy for lung adenocarcinoma, and developing targeted strategies, the problem of lack of evaluating HAT1-mediated protein lactation modification in the prior art is solved, and personalized diagnosis and treatment of radiotherapy for lung adenocarcinoma is achieved.
Patent Information
- Application Number
- CN202510564169.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-04-30
- Publication Date
- 2025-08-08
AI Technical Summary
There is a lack of methods in the prior art to evaluate the radiotherapy resistance characteristics of histone acetyltransferase 1 (HAT1)-mediated protein lactication modification in lung adenocarcinoma patients, which makes it difficult to effectively respond to the radiotherapy resistance of lung adenocarcinoma and lacks personalized diagnosis and treatment methods.
Provide a diagnostic reagent that analyzes the interaction and lactation sites of HAT1 and RPA1 by detecting the expression levels of histone acetyltransferase 1 (HAT1) and the lactation levels of replicate protein A1 (RPA1), combines biological experiments, analyzes the interactions and lactation sites of HAT1 and RPA1, evaluates the characteristics of radiotherapy resistance, and develops targeted strategies.
Accurate evaluation of the radiotherapy resistance characteristics of lung adenocarcinoma patients is achieved, and personalized targeted treatment plans are provided, which improves the sensitivity and therapeutic effect of lung adenocarcinoma radiotherapy.
Smart Images

Figure CN120446484A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the technical field of medical diagnosis, and in particular relates to a diagnostic reagent for radiotherapy prognosis of lung adenocarcinoma and a use thereof. Background Art
[0002] Lung adenocarcinoma (LUAD) is the most common type of non-small cell lung cancer (NSCLC), accounting for 30%-35% of NSCLC cases. Its morbidity and mortality rates rank first among malignant tumors in my country. Radiotherapy remains an important clinical treatment for LUAD. Radiotherapy uses high-energy radiation to damage the DNA of cancer cells, preventing their division and proliferation. However, radioresistance, which occurs during radiotherapy for lung adenocarcinoma, is a major cause of recurrence and poor prognosis in patients. Given the poor radioresistance seen in LUAD treatment, identifying the key proteins involved in LUAD radioresistance may reveal the underlying mechanisms of LUAD radioresistance and is expected to provide new clues for sensitizing LUAD to radiotherapy.
[0003] Most cancers exhibit a metabolic trait known as the Warburg effect, whereby cancer cells continue glycolysis and produce large amounts of lactate even in the presence of oxygen. Studies have shown that metabolic processes targeting lactate production can inhibit tumor progression. Recent studies have shown that, in addition to its metabolic role, lactate can also participate in post-translational modifications (PTMs). Lactylation, a novel post-translational modification that triggers the lactylation of lysine residues in proteins, is a recently discovered post-translational modification that regulates a variety of biological processes by incorporating lactate onto lysine residues in proteins. Studies have shown that lactylation of histones (such as H3K18la) can reduce chromatin compaction, making DNA near damaged sites more accessible to repair proteins (such as BRCA1 and Rad51). It may also enhance the recruitment of DNA damage signals (such as γH2AX foci formation) by affecting the balance of histone modifications (such as acetylation and methylation), accelerating the assembly of repair complexes. Furthermore, lactylation may directly modify DNA repair enzymes (such as RPA1 and ATM / ATR kinases), altering their activity or interactions with other proteins. Therefore, protein lactylation modification can promote the repair of DNA double bond breaks and thus lead to radiotherapy resistance, but the specific regulatory role and mechanism of lactylation modification in radiotherapy tolerance in LUAD are still unclear.
[0004] HAT1, short for Histone Acetyltransferase 1, is a key member of the histone acetyltransferase family. Acetyltransferases are key regulators of lactate modification. Previous studies have shown that HAT1 promotes cancer cell proliferation primarily by regulating the expression of cell cycle-related genes, such as c-Myc and CyclinD1 / E, or by acetylating repair proteins (such as BRCA1 and RAD51) or local chromatin, thereby increasing the efficiency of homologous recombination, a DNA damage repair pathway, and thereby promoting cancer cell proliferation.
[0005] However, existing methods for assessing radioresistance in lung adenocarcinoma patients through HAT1-mediated protein lactylation are lacking. Therefore, providing a strategy for assessing and targeting radioresistance in lung adenocarcinoma patients through HAT1-mediated protein lactylation is an urgent need for researchers in this field, potentially providing more diverse and personalized approaches for clinical diagnosis and treatment. Summary of the Invention
[0006] In view of the limitations of the prior art, the present invention provides an application of HAT1-mediated RPA1 protein lactylation modification to evaluate the radioresistance characteristics of lung adenocarcinoma patients and a targeting strategy.
[0007] The present invention, using clinical specimen testing combined with biological experiments, found that HAT1 expression in LUAD was significantly higher than in normal tissues, as measured by the GEPIA and UALCAN databases. Furthermore, LUAD patients with high HAT1 expression had a worse survival prognosis. Furthermore, the UALCAN database showed that HAT1 protein expression increased significantly with increasing TNM stage of LUAD patients, a finding confirmed by immunohistochemical studies of LUAD patient tumor tissue.
[0008] Western blot analysis revealed that HAT1 is required for lactylation in LUAD cells. To further investigate how HAT1-mediated protein lactylation contributes to radioresistance in LUAD, researchers combined immunofluorescence, comet assays, and a DR-GFP reporter system to demonstrate for the first time that HAT1 promotes DNA damage repair via homologous recombination (HR) in LUAD cells, thereby conferring radioresistance. To analyze the proteins involved in HAT1 function, immunoprecipitation and mass spectrometry revealed that HAT1 binds to RPA1 and regulates its lactylation. Using a 4D label-free lactylation proteomics approach and DNA-protein binding assays with synthetic biotin-labeled ssDNA, mutations at RAP1 lactylation sites K88, K163, K167, and K267 were identified as suppressing HR. Furthermore, studies have shown that the acetyltransferase activity of KAT family proteins requires autoacetylation, and experiments have shown that autoacetylation at K15 of HAT1 promotes and enhances its lactyltransferase activity. Therefore, HAT1 enhances its lactyltransferase activity through autoacetylation at the K15 position, thereby enhancing the lactylation modification of RPA1 and promoting radioresistance in lung adenocarcinoma.
[0009] The present invention first provides a diagnostic reagent for radiotherapy prognosis of lung adenocarcinoma, which comprises a reagent for detecting the expression level of histone acetyltransferase 1 (HAT1) and / or a reagent for detecting the lactation level of replication protein A1 (RPA1).
[0010] In one embodiment of the present invention, the reagent for detecting the lactylation level of replication protein A1 (RPA1) comprises biotin-labeled ssDNA, wherein the nucleotide sequence of the ssDNA is SEQ ID NO: 1.
[0011] In one embodiment of the present invention, the reagent for detecting the lactation level of replication protein A1 (RPA1) further comprises a reagent for detecting RAP1 lactation.
[0012] In one embodiment of the present invention, the reagent for detecting RPA1 lactation is a biotin-labeled ssDNA for detecting lactation of K88, K163, K167 and / or K267 of RPA1. The nucleotide sequence of the ssDNA is SEQ ID NO: 1.
[0013] In one embodiment of the present invention, the reagent for detecting the expression level of histone acetyltransferase 1 (HAT1) further comprises a reagent for detecting the autoacetylation of K15 of HAT1.
[0014] The present invention also provides a reagent for detecting the expression level of histone acetyltransferase 1 (HAT1) and / or a reagent for detecting the lactation level of replication protein A1 (RPA1) in the preparation of a diagnostic reagent for radiotherapy prognosis of lung adenocarcinoma.
[0015] The beneficial effects of the above technical solution of the present invention are as follows:
[0016] The present invention provides an application of a HAT1-mediated RPA1 protein lactylation modification to evaluate the radioresistance characteristics of lung adenocarcinoma patients and a targeting strategy, providing a more diversified and personalized means for the clinical diagnosis and treatment of LUAD. BRIEF DESCRIPTION OF THE DRAWINGS
[0017] Figure 1 Figure 3 is a graph showing that HAT1 is upregulated in LUAD and is associated with poor prognosis; (A) is a survival chart analysis of LUAD patients using the GEPIA database with a median cutoff value; (B) is a Kaplan-Meier analysis of patients with high or low HAT1 expression using a tumor lung adenocarcinoma dataset; (C) is a Kaplan-Meier analysis of patients with high or low HAT1 expression using a mixed lung adenocarcinoma dataset; (D) is an analysis of HAT1 expression in LUAD GEPIA samples; (E) is an analysis of HAT1 expression in LUAD CPTAC samples; (F) is HAT1 IHC staining in normal tissues and tumor tissues of different grades (grade I, II, III, and IV). Scale bar: 100 μm; (G) Analysis of HAT1 expression in normal tissues and grade I, II, and III tumor tissues using the LUAD CPTAC dataset; (H) Expression of HAT1 in 14 pairs of normal and tumor tissues; (I) Relative protein expression of HAT1 in Figure H, data analyzed using two-way analysis of variance (ANOVA). ** P<0.01.
[0018] Figure 2Figure 1 is a map of HAT1-regulated lactylation in LUAD cells; (A) is the expression of pan-L-lactyl lysine (Pan-Kla) in HAT1-KO cells; (B) is the expression of pan-crotonyl lysine (Pan-Kcr) in HAT1-KO cells; (C) is the expression of pan-butyryl lysine (Pan-Kbu) in HAT1-KO cells; (D) is the expression of overall succinyl lysine (Pan-Ksu) in HAT1-KO cells; (E) is the expression of overall glutaryl lysine (Pan-Kglu) in HAT1-KO cells; (F) is the expression of overall benzoyl lysine (Pan-Kbz) in HAT1-KO cells; (G) is the expression of pan-propionyl lysine (Pan-Kpr) in HAT1-KO cells; (H) is the expression of HAT1. (I) Expression of global β-hydroxybutyryl lysine (Pan-Kbhb) in HAT1-KO cells; (I) Expression of global malonyl lysine (Pan-Kma) in HAT1-KO cells; (J) Expression of pan-2-hydroxyisobutyl lysine (Pan-Khib) in HAT1-KO cells; (K) Expression of acetyl lysine (Pan-Kac) in HAT1-KO cells; (L) Coomassie brilliant blue staining of total protein in control cells and HAT1-KO cells; (M) Expression of Pan-Kla, HAT1 and GAPDH in different monoclonal cells with HAT1 depleted; (N) NALA-induced Pan-Kla expression in HAT1-KO cells; (O) Coomassie brilliant blue staining of total protein induced by NALA in HAT1-KO cells.
[0019] Figure 3 .HAT1 promotes DDR in LUAD cells; (A) is the detection graph of IR-induced γ-H2AX lesions in A549 cells after HAT1 elimination; (B) is the detection graph of IR-induced γ-H2AX lesions in H1299 cells after HAT1 depletion; (C) is the detection graph of IR-induced HAT1-KO Detection profile of tailing DNA in A549 cells; (D) Detection profile of tailing DNA in H1299 cells depleted of HAT1; (E) Detection profile of γ-H2AX, HAT1, and β-actin expression in HAT1-depleted monoclonal A549 cells (clones #3 and #14); (F) Detection profile of γ-H2AX, HAT1, and β-actin expression in HAT1-depleted monoclonal H1299 cells (clones #19 and #26); (G) Detection profile of the clonogenicity of IR-treated A549 cells; (H) Detection profile of the colony-forming ability of IR-treated H1299 cells. All data were analyzed using two-way analysis of variance (ANOVA), **P<0.01;
[0020] Figure 4 .Detection graph of HAT1 promoting HR-mediated DDR in LUAD cells; wherein, (A) is a schematic diagram of the HR reporter system; (B) is a detection graph of GFP-positive cells measured by flow cytometry using the HR reporter system; (C) is a detection graph of the relative HR efficiency of control LUAD cells and HAT1-KO LUAD cells; (D) is a schematic diagram of the NHEJ reporter system; (E) is a detection graph of GFP-positive cells measured by flow cytometry using the NHEJ reporter gene system; (F) is a detection graph of the relative HR efficiency of control LUAD cells and HAT1-KO LUAD cells. Detection graph of relative NHEJ efficiency of LUAD cells (G) is the detection graph of IR-induced RPA1 foci eliminating HAT1 in A549 cells; (H) is the detection graph of IR-induced RPA1 foci in H1299 cells depleted of HAT1; (I) is the detection graph of IR-induced RAD51 foci eliminating HAT1 in A549 cells; (J) is the detection graph of IR-induced RAD51 foci in H1299 cells depleted of HAT1; All data were analyzed using two-way analysis of variance (ANOVA). ** P<0.01.
[0021] Figure 5Figure 3 is a correlation map of HAT1-mediated lactoylation of RPA1 in LUAD cells; (A) is a correlation map of the intersection between lysine lactoylation substrates, HAT1-interacting proteins and a gene set of 28 HR proteins; (B) is a secondary mass spectrum of RPA1K88 lactoylation modification; (C) is a correlation map of strip staining of proteins interacting with HAT1; (D) is a correlation map of the interaction between HAT1 and RPA1 in A549 cells; (E) is a correlation map of the interaction between HAT1 and RPA1 in H1299 cells; (F) is a correlation map of the interaction between exogenous HAT1 and exogenous RPA1 in 293T cells detected by Flag-Trap; (G) is a correlation map of the interaction between exogenous HAT1 and exogenous RPA1 in 293T cells detected by HA-Trap. Correlation graph of interaction; (H) is the correlation graph of verification of RPA1 lactylation in A549 cells; (I) is the correlation graph of confirmation of RPA1 lactylation in H1299 cells; (J) is the correlation graph of detection of lactylated RPA1 in A549 cells depleted of HAT1; (K) is the correlation graph of detection of lactylated RPA1 in H1299 cells depleted of HAT1; (L) is the correlation graph of detection of lactylated RPA1 in HEK-293T cells overexpressing seven acetyltransferases of the KAT family, including P300, CBP, HAT1, KAT2A, KAT2B, KAT5 and KAT8; (M) is a schematic diagram of molecular docking between HAT1 and La-CoA; (N) is a correlation graph of in vitro lactylation assay showing the lysine lactoyltransferase activity of HAT1 towards RPA1.
[0022] Figure 6 Figure 3 is a graph showing the correlation between the HR promotion by latexylation of RPA1 at K88, K163, K167, and K267 sites; (A) is a graph showing the detection results of the level of latexed RPA1 in cells with RPA1 K88R, K163R, K167R, and K267R mutants; (B) is a graph showing the detection results of the level of RPA1 and the interaction of ssDNA with RPA1 K88R, K163R, K167R, and K267R mutants; (C) is a graph showing the detection results of the level of RPA1 and the interaction of HR factors with RPA1 K88R, K163R, K167R, and K267R mutants, including BLM, MRE11, RAD51, and NBS1; (D) is a graph showing the detection results of the relative HR efficiency in cells with RPA1 K88R, K163R, K167R, and K267R mutants. All data were analyzed using two-way analysis of variance (ANOVA). ** P<0.01.
[0023] Figure 7To detect the self-lactylation of HAT1 at K15 to promote the lactylation of RPA1; wherein, (A) is the result of detecting HA-Trap-bound acetyltransferase in cells overexpressing 8 acetyltransferases of the KAT family (including P300, CBP, HAT1, KAT2A, KAT2B, KAT5, KAT7 and KAT8); (B) is the result of detecting the level of lactylation acetyltransferase in cells overexpressing 8 acetyltransferases of the KAT family, including P300, CBP, HAT1, KAT2A, KAT2B, KAT5, KAT7 and KAT8 (red Arrows represent corresponding lactylated proteins); (C) Expression of acetyltransferases in whole cell lysates, showing the results of overexpressing eight acetyltransferases of the KAT family, including P300, CBP, HAT1, KAT2A, KAT2B, KAT5, KAT7, and KAT8; (D) is a secondary mass spectrometry diagram of HAT5K15 lactylation modification; (E) is a sequence alignment diagram of the K15 site of HAT1 in different species; (F) is a diagram showing the levels of lactylated HAT1 in NALA-induced 293T cells; (G) is a diagram showing the expression of lactylated HAT1 in WT cells and cells with HAT1 (H) is a graph showing the level of lactated RPA1 in HAT1-WT cells and HAT1-K15R mutant cells; (I) is a graph showing the relative HR efficiency in WT cells and cells with HAT1-K15R mutants; (J) is a graph showing the IR-induced lesions of RPA1 in A549 cells expressing HAT1-WT protein or mutant HAT1-K15R; (K) is a graph showing the colony-forming ability of A549 cells expressing HAT1-WT protein or mutant HAT1-K15R; all data were analyzed using two-way analysis of variance (ANOVA). ** P<0.01. DETAILED DESCRIPTION
[0024] In order to make the technical problems, technical solutions and advantages to be solved by the present invention clearer, a detailed description will be given below with reference to the accompanying drawings and specific embodiments.
[0025] Unless otherwise specified, the reagents and materials used in this example can be obtained through commercial sources.
[0026] Experimental materials and reagents:
[0027] Human lung adenocarcinoma cell line A549 was purchased from ATCC
[0028] Human lung adenocarcinoma cell line H1299 was purchased from ATCC
[0029] Fetal bovine serum (FBS) was purchased from Shanghai Yuanpei Biotechnology Co., Ltd.
[0030] Penicillin / streptomycin were purchased from Thermo Fisher Scientific
[0031] RPMI 1640 culture medium was purchased from Thermo Fisher Scientific
[0032] Dulbecco's modified Eagle's medium (DMEM) was purchased from Thermo Fisher Scientific
[0033] HEK-293T cells were purchased from ATCC
[0034] Lipofectamine 2000 was purchased from Thermo Fisher Scientific
[0035] Example 1 Cell culture and transfection
[0036] Human lung adenocarcinoma cell lines A549 and H1299 were cultured in RPMI 1640 medium supplemented with 10% fetal bovine serum (FBS) and 1% penicillin / streptomycin (P / S). Dulbecco's modified Eagle's medium (DMEM) containing 10% FBS and 1% P / S was used to maintain HEK-293T cells. All cell lines were cultured at 37°C in a humidified 5% CO2 incubator. Transfection was performed using Lipofectamine 2000 according to the manufacturer's instructions.
[0037] Example 2 Immunohistochemistry
[0038] ① Paraffin sectioning: The paraffin specimen is placed in a -20℃ refrigerator for pre-cooling and then sliced, spread and air-dried.
[0039] ② Dewaxing: Place the paraffin sections in a 60℃ oven for 30 minutes and then perform the following dewaxing steps: xylene I for 15 minutes, xylene II for 15 minutes, 100% alcohol for 10 minutes, 95% alcohol for 5 minutes, 85% alcohol for 5 minutes, 75% alcohol for 5 minutes, rinse with tap water for 5 minutes, and place in PBS for 5 minutes.
[0040] ③ Antigen retrieval: Rinse sections thoroughly with PBS for 15 minutes. Prepare the appropriate antibody retrieval solution. Add an appropriate amount of water to a pressure cooker and heat to boiling. Place the sections in the pressure cooker and heat on high pressure for 2 minutes 30 seconds. Immediately rinse the pressure cooker with tap water to cool it down. Remove the sections and place them in a retrieval box containing the retrieval solution. Allow to cool naturally to room temperature.
[0041] ④ Inactivation of endogenous catalase: remove the slices, rinse with PBS three times, 5 minutes each time, add 3% H2O2, and incubate at 37℃ for 30 minutes.
[0042] ⑤ Blocking: Remove the sections and rinse with PBS three times for 5 minutes each. Gently shake dry the sections and place them in a humidified chamber. Add goat blocking serum to the tissue and incubate in a 37°C oven for 30 minutes.
[0043] ⑥ Primary antibody incubation: Gently shake dry the slices, drop the diluted antibody onto the slices, cover with a wet box lid, and incubate in a 4°C refrigerator overnight.
[0044] ⑦ Secondary Antibody Incubation: Remove the sections, warm them to room temperature, and place them in a repair box. Rinse with PBS three times, 5 minutes each time. Gently shake off the PBS and place them in a humidified chamber. Add the immunohistochemical secondary antibody dropwise to the sections and incubate them in a 37°C oven for 30 minutes.
[0045] ⑧ Color development: Remove the wet chamber and place the sections in a repair box. Wash three times with PBS for 5 minutes each. Remove the sections and place them under a microscope. Add DAB color development solution. Once the color develops to the desired level, immediately place the sections in water to terminate the reaction.
[0046] ⑨Restaining: Rinse the sections in tap water for 5 minutes, stain in hematoxylin staining solution for 20 seconds, rinse thoroughly with tap water, then place in hydrochloric acid alcohol for 1 second, and rinse again with tap water until the sections turn blue.
[0047] ⑩ Dehydration and transparency: Soak the sections in 75% alcohol for 5 minutes, 85% alcohol for 5 minutes, 95% alcohol for 5 minutes, 100% alcohol for 10 minutes, xylene for 15 minutes, and fresh xylene for 15 minutes.
[0048] Mounting: After the sections have dried naturally in a fume hood, add 50-100 μL of neutral gum to each section and mount with a coverslip. The sections can be placed in a 37°C oven to remove air bubbles.
[0049] Scan and save: The slide scanner saves the image after scanning the slide.
[0050] According to the immunohistochemistry (IHC) evaluation system, IHC staining evaluation was performed as follows: the five most characteristic high-power fields (400 times magnification) of each tissue section were manually selected using an Olympus BX51 microscope (Olympus, Tokyo, Japan). The percentage of signal-positive tumor cells in all tumor cells was counted, and the positive rate classification criteria were more than 50% (+++), between 25% and 50% (++), between 5% and 25% (+), and less than 5% (-). Then, cases with "+++" and "++" were considered to have high expression of the target protein. Otherwise, the case was defined as low expression of the target protein.
[0051] Example 3 Western blotting
[0052] ① Total cell protein extraction: Aspirate the culture medium, add 5ml of PBS, gently shake to wash the culture medium, and discard the PBS. After adding 1ml of PBS, scrape the cells with a cell scraper and transfer them to a 1.5ml centrifuge tube with a pipette. Centrifuge at 800g for 3 minutes at 4°C, discard the supernatant, and retain the cell pellet. Add approximately 10 times the volume of RIPA lysis buffer containing PMSF to the cell pellet and lyse on ice for 30 minutes. After lysis, place the cell lysate in a 4°C centrifuge and centrifuge at 25,000g for 15 minutes. Transfer the supernatant after centrifugation to a new 1.5ml centrifuge tube to obtain the total cell protein.
[0053] ② Protein sample preparation: After determining the concentration of each protein using a BCA protein quantification kit, add 1 / 3 of the protein volume of 4* loading buffer to the protein, and then add 1* loading buffer to equalize the concentration of each protein. Place the mixed protein sample in a 95°C water bath for 5 minutes to complete denaturation.
[0054] ③SDS-PAGE electrophoresis: Place the gel in an electrophoresis tank and add sufficient electrophoresis buffer. Add 30 μg of protein sample to each well. Run at 120V for 20 minutes, then increase to 160V and run for approximately 40 minutes until bromophenol blue has just run out of the gel. Terminate the electrophoresis and proceed to transfer to the membrane.
[0055] ④ Transfer: Use the sandwich method to place the filter paper, PVDF membrane and electrophoresis gel into the clamp in sequence, place the clamp into the electrotransfer tank, and transfer the membrane at a constant current of 0.36A for 2 hours.
[0056] ⑤Immunolysis: Block the membrane in 7.5% skim milk on a shaker at room temperature for 1 hour. Wash the membrane with PBST and then incubate with primary antibodies (HAT1, Wuhan Tri-Ting Biotechnology Co., Ltd.; Kla, Hangzhou Jingjie Biotechnology Co., Ltd.; p-H2AX, Cell Signaling Technology; GAPDH, Wuhan Tri-Ting Biotechnology Co., Ltd.) on a shaker at 4°C overnight. After primary antibody incubation, remove the membrane from the antibody and place it in PBST. Wash three times for 10 minutes each on a horizontal shaker at room temperature. Then, incubate the membrane in secondary antibodies (Anti-rabbit IgG HRP-linked Antibody, Cell Signaling Technology; Anti-mouse IgG HRP-linked Antibody, Cell Signaling Technology) on a shaker at room temperature for 1 hour. Then, wash the secondary antibodies three times for 10 minutes each using the same method.
[0057] ⑥ Chemiluminescence: Prepare the developer, drain the excess liquid on the membrane, add an appropriate amount of developer, place it in the developing instrument for development and take pictures.
[0058] Results and Conclusions 1: HAT1 was detected in normal tissues and tumor tissues, and it was found that HAT1 expression was upregulated in tumor tissues. Combined with the analysis of GEPIA and CPTAC databases, HAT1 may be a potential oncogene for LUAD. Figure 1 H and Figure 1 I)
[0059] Results and Conclusion 2: In HAT1-KO cells, only L-Lactyl lysine and Acetyllysine were significantly reduced, while the other nine acylation modifications were not regulated by HAT1. Therefore, HAT1 is required for lactation in LUAD cells. Figure 2 A and Figure 2 K)
[0060] Results and conclusion 3: Immunoprecipitation experiments confirmed that RPA1 could bind to HAT1 in A549 cells. Figure 5 D)
[0061] Results and Conclusion 4: Using pan-lactylation antibody, we confirmed that RPA1 was lactylated in A549 cells. Figure 5 H)
[0062] Example 4 Immunofluorescence imaging
[0063] ① Take an appropriate amount of cells and plate them in an immunofluorescence chamber, culture them in an incubator overnight, then rinse them with PBS three times, fix them with 4% paraformaldehyde at room temperature for 15 minutes, and then rinse them with PBS three times, each time for 5 minutes.
[0064] ② Incubate with 0.3% Triton X-100 for 15 minutes to disrupt the cell membrane, and rinse with PBS three times, each time for 5 minutes.
[0065] ③ Block with 10% goat serum at 37°C for 30 min.
[0066] ④ Add diluted antibodies (p-H2AX, Cell Signaling Technology; RPA1, Cell Signaling Technology; RAD51, Thermo Fisher Scientific) and incubate at 4°C overnight.
[0067] ⑤ Rinse with PBS 3 times, 5 min each time, add diluted fluorescent secondary antibody (Anti-rabbit IgG (H + L), F (ab') 2 Fragment (Alexa 594Conjugate); Anti-mouse IgG(H+L),F(ab')2Fragment(Alexa 488 Conjugate, Cell Signaling Technology) mixture, and incubate at 37°C for 30 min.
[0068] ⑥ Rinse with PBS three times, 5 minutes each time, add DAPI to stain the nucleus, and incubate at 37℃ for 15 minutes.
[0069] ⑦ Rinse with PBS three times, 5 minutes each time, seal the slides with anti-fluorescence quenching mounting medium, and store in a light-proof humidified box at 4°C.
[0070] ⑧Observe and collect images using a laser confocal microscope.
[0071] Results and Conclusion 1: Compared with control cells, the duration of γ-H2AX focus signals in HAT1-ko A549 and H1299 cells was prolonged, indicating that the loss of HAT1 impaired DNA damage repair in LUAD cells. Figure 3 A and Figure 3 B)
[0072] Results and Conclusion 2: Compared with control cells, the persistence of RPA1 focal signals in HAT1-KO A549 and H1299 cells was reduced, indicating that HAT1 promotes HR-mediated DNA damage repair in LUAD cells. Figure 4 G and Figure 4 H).
[0073] Results and Conclusion 3: Compared with control cells, the persistence of RAD51 focal signals in HAT1-KO A549 and H1299 cells was reduced, indicating that HAT1 promotes HR-mediated DNA damage repair in LUAD cells. Figure 4 , I and J).
[0074] Example 5 Comet assay
[0075] ① Pre-cool the lysis at 4℃ in advance
[0076] ② Melt the LMA garose gel at 95°C for 5 minutes, then transfer it to 37°C for at least 20 minutes to cool it down.
[0077] ③ Take the frozen cells, wash them three times with PBS, resuspend them, and count them to make the cell concentration 1x106 / mL.
[0078] ④ Take 5uL of cell suspension and mix it with 45uL of LMA garose gel that has been cooled to 37℃. Immediately take 50ul of the mixture and add it dropwise into the concave well of the comet assay plate to completely cover the groove. Then quickly cover it with a clean coverslip and place it in a 4℃ environment for 10 minutes.
[0079] ⑤ Take out the sample, quickly push it to one side to remove the cover glass, immerse the sample in pre-cooled cell lysis solution Lysis solution, and place it at 4℃ for 30 minutes.
[0080] ⑥ Change lysis to TAE, 20 minutes at room temperature or 1 hour at 4 degrees.
[0081] ⑦ Slide electrophoresis, 21V, 30min.
[0082] ⑧ Drain the electrophoresis solution, soak in pure water twice, 5 minutes each time, and soak in 70% ethanol for 5 minutes.
[0083] ⑨Dry at room temperature for 10-20 minutes.
[0084] ⑩Add 100uL of GoldView nucleic acid dye diluted 1:10000 with pure water and place it in the dark at room temperature for 15-20 minutes.
[0085] Image analysis and result determination: Soak in water, wash off the staining solution, and observe at least 50 cells / sample using a fluorescence microscope (excitation wavelength 490 nm, emission wavelength 520 nm). Calculate the comet tail DNA content (Tail DNA%) and tail moment (Tail Moment) using image analysis software (e.g., CASP).
[0086] RESULTS AND CONCLUSION: After irradiation, the comet tail length of LUAD cells with HAT1 knockout significantly increased compared with control cells, indicating that HAT1 promotes DNA damage repair in LUAD cells. Figure 3 C and Figure 3 D)
[0087] Example 6 Clone Formation Experiment
[0088] ① Cell suspension preparation: Obtain A549 and H1299 cells in the logarithmic growth phase, trypsinize, and harvest by centrifugation (150 × g, 5 min). Resuspend the cells in complete culture medium (DMEM / F12 or RPMI1640 supplemented with 10% fetal bovine serum and 1% penicillin-streptomycin) and adjust the density to 500 cells / mL using a cell counter.
[0089] ② Plating and Culture: Evenly plate the cell suspension at 2 mL / well onto a 6-well plate. Gently shake to ensure single-cell dispersion. Incubate in a 37°C, 5% CO2 incubator for 24 hours to allow cells to adhere. After cell attachment, irradiate the plates (0, 2, 4, 6, or 8 Gy).
[0090] ③ Clone formation culture: Replace the culture medium with fresh complete medium every 3 days and continue culturing for 7–14 days until colonies are visible to the naked eye (>50 cells / colony).
[0091] ④ Fixation and staining of clones: Discard the culture medium, gently rinse twice with pre-chilled PBS (4°C), add 1 mL / well of fixative (methanol: glacial acetic acid = 3:1 v / v) and fix at room temperature for 10 minutes. Remove the fixative and add 0.5% crystal violet stain (containing 20% ethanol) dropwise for 15 minutes. Rinse with deionized water until the background is transparent and air-dry at room temperature.
[0092] ⑤ Colony counting and analysis: Use a high-definition flatbed scanner (resolution ≥ 600 dpi) to obtain stained images, and set the threshold using image analysis software (such as the ImageJ Colony Counter plug-in): minimum colony diameter: 50 μm, excluding edge effect areas (within 3 mm of the well edge).
[0093] The clone formation rate was calculated according to the formula:
[0094] Clone formation rate (%) = (number of clones in the experimental group / number of cells inoculated) × 100
[0095] Results and Conclusions 1: After irradiation with dose gradient radiation, the colony survival of LUAD cells decreased after HAT1 knockout, indicating that HAT1 knockout would enhance the radiosensitivity of LUAD cells. Figure 3 G and Figure 3 H)
[0096] Example 7 Homologous recombination (HR) and non-homologous end joining (NHEJ) efficiency detection experiment
[0097] ① Establishment of stable cell line: HEK293T cells were seeded in 6-well plates (density 5×10 5 cells / well), cultured at 37°C to 80% confluence, and transfected with DR-GFP / I-SceI plasmid (HR) (1 μg / well) and packaging plasmid EJ5-GFP / I-SceI (0.75 μg:0.25 μg / well) using Lipofectamine 2000.
[0098] ② 48 h after transfection, cells were collected and digested with 0.25% trypsin, and analyzed by flow cytometry. GFP-positive cells were sorted and the ratio of HR efficiency or NHEJ efficiency was calculated.
[0099] Results and Conclusion: In the HR group, the GFP fluorescence ratio of LUAD cells decreased significantly after HAT1 knockout; while in the NHEJ group, the GFP fluorescence ratio of LUAD cells did not change significantly after HAT1 knockout. This indicates that the HR efficiency of LUAD cells with HAT1 knockout is reduced compared with control cells. Figure 4 B and Figure 4 C). In contrast, knockout of HAT1 in LUAD cells did not affect the NHEJ efficiency of LUAD cells ( Figure 4 E and Figure 4 F).
[0100] Example 8 DNA-protein binding assay
[0101] ① DNA-protein binding assay, synthesis of biotin-labeled ssDNA-5'biotin (ACGCTGCCGAATTCTACCAGTGCCTTGCTA, SEQ ID NO: 1): HEK-293T cells were transfected with plasmids encoding FLAG-tagged RPA1 or RPA1 mutants (including K88R, K163R, K167R, and K267R).
[0102] ② The cells were collected and lysed in binding buffer (10 mM Tris-HCl, pH 7.5, 100 mM NaCl, 10 g / ml BSA, 10% glycerol and 0.5% NP-40).
[0103] ③ Incubate the whole-cell lysate with biotin-coupled ssDNA at room temperature for 30 minutes.
[0104] ④ Streptavidin beads (S beads) were added to the ssDNA-lysate mixture at room temperature for 1 hour to pull down proteins that interact with ssDNA.
[0105] ⑤Western blot analysis of ssDNA binding proteins.
[0106] RESULTS AND CONCLUSION: Compared with WT-RPA1, the amount of RPA1-Flag protein pulled down by streptavidin beads (S beads) bound to ssDNA in RPA1 K88R, K163R, K167R and K267R mutant cells was reduced. This indicates that compared with WT-RPA1, the affinity of RPA1 for ssDNA in RPA1K88R, K163R, K167R and K267R mutant cells is weakened ( Figure 6 B).
[0107] Example 9 Statistical Analysis
[0108] Online analysis was performed at http: / / gepia2.cancer-pku.cn / #index. Statistical significance was determined by Student's t-test, with P < 0.05 considered statistically significant. Kaplan-Meier survival plots and log-rank statistics were used to evaluate patient survival.
[0109] Results and Conclusions 1: The GEPIA database performed a survival analysis of the currently known major lysine acetyltransferases (writers), deacetylases (erasers), and readers. The results showed that high expression of HAT1 was significantly associated with poor prognosis in LUAD patients ( Figure 1 A).
[0110] Results and Conclusion 2: Kaplan-Meier analysis was used to analyze the correlation between HAT1 expression and prognosis of human LUAD. We found that patients with high HAT1 expression had poor survival, suggesting that HAT1 may serve as a candidate prognostic biomarker for predicting treatment outcomes ( Figure 1 B and Figure 1 C).
[0111] The above is a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principles of the present invention. These improvements and modifications should also be regarded as within the scope of protection of the present invention.
Claims
1. A diagnostic reagent for radiotherapy prognosis of lung adenocarcinoma, comprising a reagent for detecting the expression level of histone acetyltransferase 1 (HAT1) and / or a reagent for detecting the lactylation level of replication protein A1 (RPA1).
2. The diagnostic reagent according to claim 1, wherein The reagent for detecting the lactylation level of replication protein A1 (RPA1) contains biotin-labeled ssDNA.
3. The diagnostic reagent according to claim 2, wherein The nucleotide sequence of the ssDNA is SEQ ID NO:
1.
4. The diagnostic reagent according to any one of claims 1 to 3, wherein The reagent for detecting the lactation level of replication protein A1 (RPA1) further comprises a reagent for detecting RAP1 lactation.
5. The diagnostic reagent according to claim 4, wherein The reagent for detecting RPA1 lactylation is biotin-labeled ssDNA for detecting lactylation of K88, K163, K167 and / or K267 of RPA1.
6. The diagnostic reagent according to claim 5, wherein The nucleotide sequence of the ssDNA is SEQ ID NO:
1.
7. The diagnostic reagent according to any one of claims 1 to 6, wherein The reagent for detecting the expression level of histone acetyltransferase 1 (HAT1) further comprises a reagent for detecting the autoacetylation of K15 position of HAT1.
8. Use of a reagent for detecting the expression level of histone acetyltransferase 1 (HAT1) and / or a reagent for detecting the lactation level of replication protein A1 (RPA1) in the preparation of a diagnostic reagent for radiotherapy prognosis of lung adenocarcinoma.