Composition for caring for keratin materials comprising at least indole-3-lactic acid, indole-3-carboxaldehyde, indole-3-acetic acid and adjuvant, use and method for implementing said composition

Abstract

The present invention relates to a composition comprising, in a physiologically acceptable medium: at least indole-3-lactic acid; an indole-3-formaldehyde compound; indole-3-acetic acid; and / or one of their salts; and at least one adjuvant. It also relates to such a composition for use in preventing a reduction in and / or enhancing a skin barrier function in an individual, for improving skin moisturizing, for improving the quality of skin, in particular dry skin, for preventing and / or treating cosmetic manifestations associated with dry skin, and for preventing and / or treating cosmetic manifestations associated with dry skin. Said cosmetic exhibits, in particular, a sensation selected from the group consisting of tension, pruritus, uncomfortable feelings, blurred complexion, pruritus, and significant slight undulation of the skin, and / or for the prevention and / or treatment of pruritus, in particular skin pruritus affected by dermatological conditions such as atopic dermatitis, and / or for the prevention and / or treatment of atopic dermatitis. The invention also relates to a non-therapeutic cosmetic process for caring for a keratin material, comprising at least one step of topically applying such a composition to said keratin material.

Description

Technical Field

[0001] The present invention relates to the use of an indole mixture for improving barrier function and emollients.

[0002] More particularly, the present invention aims to propose a composition, in particular a cosmetic composition, in particular for the care of keratin materials, comprising, in a physiologically acceptable medium: - at least indole-3-lactic acid and / or its salts, indole-3-carboxaldehyde and / or its salts and indole-3-acetic acid and / or its salts; and at least one adjuvant chosen from fatty substances, organic solvents chosen from lower monoalcohols having 1 to 5 carbon atoms, such as ethanol, isopropanol, tert-butanol; polyols, such as propylene glycol, 1,2-pentylene glycol, caprylyl glycol, hexylene glycol (or 2-methyl-2,4-pentanediol) and polyethylene glycol; polyol ethers, such as dipropylene glycol monomethyl ether, ionic or nonionic, hydrophilic or lipophilic, thickeners; softeners; opacifiers; stabilizers; silicones; antifoaming agents; fragrances; preservatives; anionic, cationic, nonionic, zwitterionic or amphoteric surfactants; fillers; polymers; propellants; and mixtures thereof.

[0003] The present invention also relates to the cosmetic use, in particular topical cosmetic use, of such a composition for preventing a decrease in the barrier function of the skin of an individual and / or for strengthening the barrier function of the skin of an individual.

[0004] Furthermore, it relates to the cosmetic use of such a composition for improving skin moisturization, in particular for topical cosmetic use.

[0005] Furthermore, it relates to the cosmetic use, in particular topical cosmetic use, of such a composition for improving the quality of the skin, in particular dry skin.

[0006] Furthermore, it relates to the cosmetic use, in particular topical cosmetic use, of such a composition for preventing and / or treating cosmetic manifestations associated with dry skin, chosen in particular from sensations of tightness, itching, discomfort, dull complexion, rough skin and pronounced micro-reliefs of the skin.

[0007] Furthermore, it relates to the cosmetic use, in particular topical cosmetic use, of such a composition for the prevention and / or treatment of pruritus, in particular pruritus of the skin affected by dermatological disorders such as atopic dermatitis.

[0008] It also relates to the cosmetic use of such a composition for preventing and / or treating atopic dermatitis, in particular for topical cosmetic use.

[0009] Finally, the invention relates to a non-therapeutic cosmetic method for caring for keratin materials, in particular the skin, in particular dry skin, comprising the topical application of such a composition to these keratin materials. Background Art

[0010] Skin is a tissue whose cells are interconnected and intact. Skin tissue forms the outer covering and contains sebaceous or sweat glands and hair follicles. Skin is an epithelium that undergoes continuous renewal. This renewal, or desquamation, is a coordinated and finely regulated process, resulting in the imperceptible and invisible removal of surface cells.

[0011] Human skin consists of two layers, the upper epidermis and the deeper dermis.

[0012] Epidermis is conventionally divided into the keratinocyte basal layer constituting the epidermal germinal layer, the stratum spinosum being made up of several layers of polygonal cells being positioned on the germinal layer, the one to three layers of " granules " layer being made up of the flat cells containing special cytoplasm inclusions transparent keratin granules and the upper stratum called stratum corneum (or cornified layer (stratum corneum)) that last group is made up of the keratinocyte of the differentiation terminal stage being called keratinocyte.The tissue between these various cell layers and most important cohesion become possibility by one group of intercellular junctions, comprise the adhesions that contribute to maintaining epithelial tissue homeostasis.These adhesions are connected to be particularly referred to as desmosomes.Desmosomes are made up of the transmembrane protein from the cadherin family, such as desmoglein.These connections have an essential effect in the structure, maintenance and construction cohesion of epidermis, and make it possible to transmit and weaken the mechanical force that acts on keratinocyte.These adhesions are connected to be mainly present in the epidermal middle layer until the topmost layer, the stratum corneum that is i.e. being made up of keratinocyte.

[0013] Corneal cells are anucleated cells, mainly composed of a fibrous material containing cytokeratin surrounded by a cornified envelope (cornified envelope) composed of the protein filaggrin. Filaggrin aggregates keratin filaments into large fibrils in the lower part of the stratum corneum. When it approaches the skin surface, filaggrin mainly decomposes into free amino acids, which form the main part of the highly hygroscopic complex natural moisturizing factor (NMF). NMF is important for maintaining the moisture retention of the stratum corneum and the softness of the skin.

[0014] New keratinocytes are continually produced to compensate for the continuous loss of epidermal cells in the stratum corneum through a mechanism known as desquamation.

[0015] However, an imbalance between the production of basal cells and the rate of desquamation may lead specifically to the formation of scales on the skin's surface.

[0016] Similarly, for various reasons, a lack of terminal differentiation of corneocytes can result in the formation of large, thick clusters of cells visible to the naked eye and called "scales," or in other cases, in a thinning of the corneum.

[0017] Furthermore, a reduction in the entire junctional system responsible for intercellular cohesion leads directly to a reduction in the efficacy of the skin barrier function.

[0018] Therefore, one or more of these internal factors may lead to a weakening of the epidermal barrier properties, resulting in chronic dehydration of the stratum corneum, leading to a loss of mechanical elasticity, resulting in tension and also in a loss of radiance and transparency of the skin.

[0019] At the same time, a weakening of the skin barrier also occurs in the presence of external insults, in particular chosen from irritants (detergents, acids, alkalis, oxidizing agents, reducing agents, concentrated solvents, toxic gases or fumes), thermal or climatic imbalances (cold, drought, radiation), xenobiotics (undesirable microorganisms, allergens, pollutants).

[0020] One of the key steps in the terminal differentiation of the stratum corneum is the cross-linking of precursor proteins of the cornified envelope (CE). This phenomenon plays an essential role in the development and maintenance of skin cohesion and physical properties such as barrier function, and is a key step in the terminal differentiation process. The cornified envelope is an essential component of corneal cells.

[0021] Conventional moisturizing active ingredients, such as humectants, moisturizing polymers or occlusive fatty substances such as liquid petrolatum, temporarily modify the surface properties of the skin. These active ingredients can cause mechanical softening of the stratum corneum by forming a thin film on the skin surface, an increase in its moisturizing state and / or an improvement in the micro-relief of the skin. However, these effects do not necessarily persist over time and disappear after cleaning the skin. In addition, these active ingredients can be eliminated by the cleansing action.

[0022] To overcome these shortcomings, it may be advantageous to select active ingredients that have beneficial effects on biological pathways and biomarkers related to skin barrier function.

[0023] In addition to the key factors involved in skin barrier function and mentioned above, in particular filaggrin and adherens junctions (desmogleins), the tryptophan metabolism pathway, namely the aryl hydrocarbon receptor (AHR) pathway, is of particular interest because it is known to be involved in various skin disorders, such as accelerated aging and inflammation (Parrado, C. et al. Front. Pharmacol. 10, (2019); Krutmann, J. Dermatol. Sci. 85, 152–161 (2017); Vogeley, C., Int. J. Mol. Sci. 20, (2019); Hidaka, T., Front. Med. 6, (2019); Stockinger, B Annu. Rev. Immunol. 32, 403–432 (2014)).

[0024] It is also known to be essential for the integrity of the skin barrier (Haas, K. et al. J. Invest. Dermatol. 136, 2260–2269 (2016)), and its activation, in particular through the genes CYP1A1 and / or OVOL1, makes it possible to improve the skin barrier in the setting of atopic dermatitis (Furue, M., Hashimoto-Hachiya, A. & Tsuji, G. Int. J. Mol. Sci. 20, (2019)).

[0025] Therefore, there is a need to identify new active ingredients which make it possible to stimulate not only the tryptophan metabolic pathway, namely the aryl hydrocarbon receptor (AHR) pathway, but also the expression of filaggrin and / or adherens junctions, such as desmoglein.

[0026] There is a need for active ingredients that enable the skin, in particular dry skin, to maintain its barrier function.

[0027] There is a need for active ingredients which make it possible to prevent a reduction in the barrier function of the skin of an individual and / or to strengthen the barrier function of the skin of an individual.

[0028] There is also a need for active ingredients making it possible to improve skin moisturization.

[0029] Additionally, there is a need for active ingredients which make it possible to improve the quality of the skin, in particular dry skin.

[0030] Additionally, there is a need for active ingredients making it possible to prevent and / or treat the cosmetic manifestations associated with dry skin, in particular selected from the group consisting of tightness, itching, a feeling of discomfort, dull complexion, rough skin and pronounced microreliefs of the skin.

[0031] There is also a need for active ingredients making it possible to prevent and / or treat pruritus, in particular pruritus of the skin affected by dermatological disorders such as atopic dermatitis.

[0032] Additionally, there is a need for active ingredients which make it possible to prevent and / or treat atopic dermatitis. Summary of the Invention

[0033] The purpose of the present invention is to solve the above technical problems.

[0034] In fact, the inventors have now discovered that the indole mixture according to the invention makes it possible to overexpress genes for activating the AHR pathway (in particular, the genes CYP1A1 and / or OVOL1 described by Furue et al. Int. J. Mol. Sci. 20, (2019)) and genes for stimulating epidermal differentiation (FLG-Filaggrin and / or DSG1-Desmoglein 1), and thus prevent a decrease in the barrier function of the skin and / or strengthen it. Therefore, the mixture is advantageous in improving the barrier function of the skin and moisturizing it. SUMMARY OF THE INVENTION Thus, according to a first aspect, the present invention relates to a composition, in particular a cosmetic composition, in particular for caring for keratin materials, comprising in a physiologically acceptable medium: - at least indole-3-lactic acid and / or its salts, indole-3-carboxaldehyde and / or its salts and indole-3-acetic acid and / or its salts; and at least one adjuvant chosen from fatty substances, organic solvents chosen from lower monoalcohols having 1 to 5 carbon atoms, such as ethanol, isopropanol, tert-butanol; polyols, such as propylene glycol, 1,2-pentanediol, caprylyl glycol, hexylene glycol (or 2-methyl-2,4-pentanediol) and polyethylene glycol; polyol ethers, such as dipropylene glycol monomethyl ether, ionic or nonionic, hydrophilic or lipophilic, thickeners; softeners; opacifiers; stabilizers; silicones; antifoaming agents; fragrances; preservatives; anionic, cationic, nonionic, zwitterionic or amphoteric surfactants; fillers; polymers; propellants; and mixtures thereof.

[0036] “Polyols” suitable for use in the present invention are intended to be compounds of linear, branched or cyclic, saturated or unsaturated alkyl type, which carry at least two —OH functions, in particular at least three —OH functions and more in particular at least four —OH functions on the alkyl chain.

[0037] Suitable polyols for formulating the compositions according to the invention are especially those containing in particular from 2 to 32 carbon atoms, preferably from 3 to 16 carbon atoms.

[0038] By "fillers" it is understood colourless or white solid particles of any shape, insoluble in form and dispersed in the medium of the composition. They are inorganic or organic in nature and give body or rigidity and / or softness to the composition.

[0039] The fillers used in the composition according to the invention may be in the form of layers, spheres, balls, fibers or any other intermediate shape between these defined shapes.

[0040] The fillers in the context of the present invention may or may not be surface-coated, and in particular they may be surface-treated with silicones, amino acids, fluorinated derivatives or any other substance that promotes the dispersion and compatibility of the filler in the composition.

[0041] Fillers can be inorganic or organic.

[0042] The inorganic filler may be selected from synthetic or natural mica; silica powder; talc; kaolin; boron nitride or mixtures thereof.

[0043] The organic filler may be selected from: organopolysiloxane powders coated with silicone resins, such as those sold by Shin Etsu under the trade names "KSP-100", "KSP-101", "KSP-102", "KSP-103", KSP-104", "KSP-105", polymethylsilsesquioxane powders, such as those sold under the trade name TOSPEARL by Momentive Performance Materials; Polyamide powders, also called nylons, such as nylon-1 (polyamide 1), nylon-12 (polyamide 12), such as those sold under the trade name ORGASOL by Arkema; nylon-66 (polyamide 66); nylon-6 (polyamide 6); Polyethylene powder; Microspheres based on acrylic copolymers, such as those made from ethylene glycol dimethacrylate / lauryl methacrylate copolymers sold under the trade name POLYTRAP by Dow Corning; Expanding powders, such as hollow microspheres, and in particular the microspheres sold under the trade name EXPANCEL by Nouryon; Polymethyl methacrylate microspheres, such as those sold under the trade name MICROSPHERE M-100 by Matsumoto or COVABEAD LH85 by Sensient; Ethylene-acrylate copolymer powders, such as those sold under the trade name FLOBEADS by Sumitomo Seika Chemicals; powders of natural organic materials, such as starch powders, in particular corn, wheat or rice starch, optionally crosslinked, for example with octenylsuccinate anhydride, such as those sold under the trade name DRY-FLO by Nouryon; Poly-p-phenylene terephtamide powder; and mixtures thereof.

[0044] The propellant may be selected from compressed or liquefied gases.

[0045] As examples of compressed gases, mention may be made of air, nitrogen, carbon dioxide (or CO2) and mixtures thereof.

[0046] Examples of liquefied gases include dimethyl ether, chlorinated and / or fluorinated hydrocarbons, such as trichlorofluoromethane, dichlorodifluoromethane, chlorodifluoromethane, 1,1,1,2-tetrafluoroethane, chloropentafluoroethane, 1-chloro-1,1-difluoroethane, 1,1-difluoroethane; and volatile hydrocarbons, such as, in particular, C3-C5 alkanes, such as propane, isopropane, n-butane, isobutane, pentane, alone or in a mixture. Hydrocarbons selected from propane, isopropane, n-butane, isobutane, alone or in a mixture may be mentioned as examples of liquefied gases.

[0047] As illustrated in the following examples, the applicant has surprisingly found that a composition according to the invention comprising at least indole-3-lactic acid and / or its salts; indole-3-carboxaldehyde and / or its salts; and indole-3-acetic acid and / or its salts makes it possible to overexpress genes for activating the AHR pathway (in particular the genes CYP1A1 and / or OVOL1) and stimulating differentiation (FLG-filaggrin and / or DSG1-desmoglein), and thereby prevent the reduction of the skin barrier function and / or strengthen the skin barrier function. Said discovery forms the basis of the present invention (see, for example, Hoober JK, Eggink LL. Int J Mol Sci. 2022 Jan 27; 23(3): 1455). In fact, filaggrin (FLG) is the main structural protein associated with the skin surface barrier. Mutations in the gene encoding filaggrin are the most significant risk factor for skin diseases. About 50% of patients with atopic dermatitis carry mutations that are the source of the loss of filaggrin function. Esparza-Gordillo et al. (Curr Opin Allergy Clin Immunol. 2010 Oct;10(5):418-26) indicate that 10% to 20% of people in industrialized countries suffer from atopic dermatitis, with a strong predisposition in children when the mother carries a FLG mutation. Mutations in the FLG gene are also associated with ichthyosis vulgaris, a common skin disease characterized by dry and scaly skin with a prevalence of at least 1 in 250 people.

[0048] In addition, DSG1 encodes desmoglein 1, a major component of desmosomes, which connects the cell surface to the keratin cytoskeleton and plays a key role in maintaining the integrity of the epidermis and barrier function. Mutations that cause psoriasis SAM syndrome (severe dermatitis, polyallergy, and metabolic exhaustion syndrome) are reflected in the lack of membrane expression of DSG1, resulting in loss of cell-cell adhesion (Oh, J. et al. Nature 514, 59–6 (2014)). Lack of desmoglein 1 leads to severe dermatitis, polyallergy, and metabolic loss (Samuelov L et al. Nat Genet. 2013 Oct; 45(10): 1244-1248; Lisa M Godsel et al. J Clin Invest. 2022 Feb 1; 132(3): e144363).

[0049] These two proteins are therefore crucial for the barrier function performed by the skin.

[0050] The composition according to the invention may further comprise a tryptamine and / or a salt thereof, in particular in a content of at least 0.00001% by weight relative to the total weight of the composition, and more particularly at least 0.0001% by weight relative to the total weight of the composition.

[0051] The composition according to the invention may additionally be characterized in that it comprises: - a content of indole-3-lactic acid and / or its salts of at least 0.00001% by weight relative to the total weight of the composition, in particular at least 0.0001% by weight relative to the total weight of the composition; and - a content of indole-3-carboxaldehyde and / or its salts of at least 0.00001% by weight relative to the total weight of the composition, in particular at least 0.0001% by weight relative to the total weight of the composition; and - a content of indole-3-acetic acid and / or its salts of at least 0.000002% by weight relative to the total weight of the composition, in particular at least 0.00001% by weight relative to the total weight of the composition.

[0052] The composition according to the invention may be such that the sum of the contents of indole-3-lactic acid, indole-3-carboxaldehyde and indole-3-acetic acid and / or one of their salts corresponds to at least 0.0001% by weight relative to the total weight of the composition.

[0053] The composition according to the invention may be such that the sum of the contents of indole-3-lactic acid, indole-3-carboxaldehyde and indole-3-acetic acid and / or one of their salts is from 0.0001% to 10% by weight relative to the total weight of the composition, in particular from 0.0001% to 1%, more particularly from 0.0001% to 0.1%, even more particularly from 0.0001% to 0.01% by weight, for example 0.00011% by weight relative to the total weight of the composition.

[0054] The composition according to the invention may additionally comprise: - a content of indole-3-lactic acid and / or a salt thereof in a range from 0.00001% to 10% by weight relative to the total weight of the composition, in particular from 0.0001% to 1%, more particularly in a range from 0.0001% to 0.1%, even more particularly in a range from 0.0001% to 0.01% by weight relative to the total weight of the composition, in particular from 0.0001% to 10% by weight relative to the total weight of the composition; - a content of indole-3-carboxaldehyde and / or its salts in a range from 0.00001% to 10% by weight relative to the total weight of the composition, in particular in a range from 0.0001% to 1%, more particularly in a range from 0.0001% to 0.1%, even more particularly in a range from 0.0001% to 0.01% by weight relative to the total weight of the composition, in particular 0.0001% by weight relative to the total weight of the composition; and - a content of indole-3-acetic acid and / or its salts in a range from 0.000002% to 10% by weight relative to the total weight of the composition, in particular in a range from 0.00001% to 1% by weight, more particularly in a range from 0.00001% to 0.1% by weight, even more particularly in a range from 0.00001% to 0.01% by weight, in particular 0.00001% by weight relative to the total weight of the composition.

[0055] The composition according to the invention may comprise a content of tryptamine and / or its salts of at least 0.00001% by weight relative to the total weight of the composition, and more particularly at least 0.0001% by weight relative to the total weight of the composition.

[0056] The composition according to the invention may in particular be such that the [indole-3-lactic acid and / or its salts / indole-3-carboxaldehyde and / or its salts] weight ratio is from 0.5 to 50, in particular from 1 to 10, in particular 1.

[0057] The composition according to the invention may in particular be such that the [indole-3-carboxaldehyde and / or its salts / indole-3-acetic acid and / or its salts] weight ratio is from 0.5 to 150, in particular from 1 to 100, more particularly from 1 to 10, in particular 1 or 10.

[0058] The composition according to the invention may in particular be such that the [indole-3-lactic acid and / or its salts / indole-3-acetic acid and / or its salts] weight ratio is from 0.5 to 50, in particular from 1 to 10, in particular 1.

[0059] The composition according to the invention may in particular be such that the [indole-3-lactic acid and / or its salts / indole-3-carboxaldehyde and / or its salts / indole-3-acetic acid and / or its salts] weight ratio is from 1:1:1 to 10:10:1.

[0060] The composition according to the invention may in particular be such that the weight ratio [indole-3-lactic acid and / or its salts / indole-3-carboxaldehyde and / or its salts / indole-3-acetic acid and / or its salts / tryptamine and / or its salts] is from 1:1:1:1 to 10:10:1:10, preferably from 1:1:1:1 to 10:10:1:1.

[0061] In particular, the composition according to the invention may comprise a culture supernatant or a fraction of a culture supernatant of at least one bacterial strain of the species Staphylococcus epidermidis, chosen from the bacteria deposited in the CNCM under numbers I-5689 (deposited with the CNCM by L'Oréal on June 3, 2021), I-5904 (deposited with the CNCM by L'Oréal on September 21, 2022), I-5691 (deposited with the CNCM by L'Oréal on June 3, 2021), I-5693 (deposited with the CNCM by L'Oréal on June 3, 2021), I-5694 (deposited with the CNCM by L'Oréal on June 7, 2021) and I-5695 (deposited with the CNCM by L'Oréal on June 7, 2021).

[0062] The compositions according to the invention may be particularly suitable for topical administration.

[0063] The invention also relates to the cosmetic use, in particular topical cosmetic use, of a composition according to the invention for preventing a reduction in the barrier function of the skin of an individual and / or for strengthening the barrier function of the skin of an individual.For the purposes of the present invention, the individual is preferably a human being.

[0064] Furthermore, the present invention relates to the cosmetic use, in particular topical cosmetic use, of the composition according to the invention for improving skin moisturization.

[0065] The present invention relates to the cosmetic use, in particular topical cosmetic use, of a composition according to the invention for improving the quality of the skin, in particular dry skin.

[0066] Dry skin appears rough to the touch and appears covered with scales and generally has a taut and / or tense feeling. In fact, dry skin is often accompanied by scaling.

[0067] From a physiological point of view, dry skin is often associated in particular with a decrease in the skin's moisturizing level, with a negative impact on the barrier function, measured by imperceptible water loss. From a sensory point of view, it is particularly characterized by a feeling of tautness and / or tension in the skin.

[0068] Dry skin, also known as "xerosis," can appear at any age and may not be associated with a pathological condition.

[0069] The present invention also relates to the cosmetic use, in particular topical cosmetic use, of a composition according to the invention for preventing and / or treating cosmetic manifestations associated with dry skin, in particular chosen from sensations of tightness, itching, discomfort, dull complexion, rough skin and pronounced micro-reliefs of the skin.

[0070] Furthermore, the present invention relates to the cosmetic, in particular topical, use of a composition according to the invention for the prevention and / or treatment of pruritus, in particular pruritus of the skin affected by dermatological disorders such as atopic dermatitis.

[0071] The present invention also relates to the cosmetic use, in particular topical cosmetic use, of a composition according to the invention for the prevention and / or treatment of atopic dermatitis.

[0072] In the practice of the composition according to the present invention, the composition may be particularly suitable for topical administration.

[0073] Finally, the invention relates to a non-therapeutic cosmetic method for caring for keratin materials, in particular the skin, in particular dry skin, in particular dry skin, comprising the topical application to these keratin materials of a composition according to the invention.

[0074] Other characteristics, aspects and advantages of the present invention will emerge on reading the following detailed description. BRIEF DESCRIPTION OF THE DRAWINGS

[0075] [ Figure 1 ] shows the quantification of total indole concentration - i.e. the sum of ILA (indole-3-lactic acid), IAld (indole-3-carboxaldehyde), IAA (indole-3-acetic acid) and tryptamine concentrations - in the culture supernatants of the six strains tested, i.e. the reference strains CNCM I-5689, I-5904, I-5691, I-5693, I-5694 and I-5695.

[0076] X-axis: from left to right: control, CNCM I-5694, CNCM I-5695, CNCM I-5693, CNCM I-5904, CNCM I-5689 and CNCM I-5691.

[0077] Y-axis: total indole in pmol / ml.

[0078] [ Figure 2 Figure 3 shows the expression results of markers of the AHR pathway (CYP1A1) and barrier function (FLG) in keratinocytes stimulated by different concentrations of ILA. GAPDH is a reference gene, which is a component of NHEKs.

[0079] X-axis: from left to right: 0.005 μM ILA; 0.5 μM ILA; 5 μM ILA; 50 μM ILA and 250 μM ILA. For each concentration, the bars from left to right show GAPDH, FLG and then CYP1A1.

[0080] Y-axis: percentage (%) expression of GAPDH, FLG and CYP1A1 mRNA compared to GAPDH.

[0081] [ Figure 3 ] shows the expression results of markers of the AHR pathway (CYP1A1) and barrier function (FLG) in keratinocytes stimulated by different concentrations of IAld. GAPDH is a reference gene, which is a component of NHEKs.

[0082] X-axis: from left to right: 0.005 μM IAld; 0.5 μM IAld; 5 μM IAld; 50 μM IAld and 250 μM IAld. For each concentration, the bars from left to right show GAPDH, FLG and then CYP1A1.

[0083] Y-axis: percentage (%) expression of GAPDH, FLG and CYP1A1 mRNA compared to GAPDH.

[0084] [ Figure 4 Figure 3 shows the expression of markers of the AHR pathway (CYP1A1) and barrier function (FLG) in keratinocytes stimulated by different concentrations of IAA. GAPDH is a reference gene, which is a component of NHEKs.

[0085] X-axis: from left to right: 0.005 μM IAA; 5 μM IAA; 50 μM IAA and 250 μM IAA. For each concentration, the bars from left to right show GAPDH, FLG and then CYP1A1.

[0086] Y-axis: percentage (%) expression of GAPDH, FLG and CYP1A1 mRNA compared to GAPDH.

[0087] [ Figure 5 Figure 3 shows the expression of markers of the AHR pathway (CYP1A1) and barrier function (FLG) in keratinocytes stimulated by different concentrations of tryptamine. GAPDH is a reference gene, which is a component of NHEKs.

[0088] X-axis: from left to right: 0.005 μM tryptamine; 0.5 μM tryptamine; 5 μM tryptamine; 50 μM tryptamine and 250 μM tryptamine. For each concentration, the bars from left to right show GAPDH, FLG and then CYP1A1.

[0089] Y-axis: percentage (%) expression of GAPDH, FLG and CYP1A1 mRNA compared to GAPDH.

[0090] [ Figure 6] shows the expression results of markers of the AHR pathway (CYP1A1) and barrier function (FLG) in keratinocytes stimulated with a 1:1:1:1 mixture of ILA, IAld, IAA, and tryptamine at doses of 0.5 (4 x 0.5 μM), 5 (4 x 5 μM), or 50 μM (4 x 50 μM) of each compound. GAPDH is the reference gene, which is a component of NHEKs.

[0091] X-axis: from left to right: 4 x 0.5 μM mixture; 4 x 5 μM mixture; 4 x 50 μM mixture. For each concentration, the bars from left to right show GAPDH, FLG, and then CYP1A1.

[0092] Y-axis: percentage (%) expression of GAPDH, FLG and CYP1A1 mRNA compared to GAPDH.

[0093] [ Figure 7 ] shows the expression results of markers of the AHR pathway (CYP1A1) and barrier function (FLG) in keratinocytes stimulated by two compositions containing (i) 5 μM ILA, 0.5 μM IAd and 0.5 μM IAA (5+0.5+0.5 μM) or (ii) 5 μM ILA, 0.5 μM IAd and 5 μM IAA (5+0.5+5 μM). GAPDH is a reference gene, which is a component of NHEKs.

[0094] X-axis: from left to right: 5+0.5+0.5 μM mixture; 5+0.5+5 μM mixture. For each concentration, the bars from left to right show GAPDH, FLG, and then CYP1A1.

[0095] Y-axis: percentage (%) expression of GAPDH, FLG and CYP1A1 mRNA compared to GAPDH.

[0096] Details The composition according to the invention The compositions according to the invention are preferably cosmetics.

[0097] The composition according to the invention is preferably suitable for topical application to keratin materials, in particular the skin, and therefore comprises a physiologically acceptable medium, ie a medium that is compatible with the skin.

[0098] The term "cosmetic" is intended to mean compositions that are compatible with keratin materials, in particular the skin, mucous membranes and skin appendages. The compositions according to the invention are non-therapeutic.

[0099] The term "keratin material" is intended to denote in particular the skin, mucous membranes, fibres, eyelashes and skin appendages.

[0100] The term "skin" is intended to mean all skin of the body, and preferably the skin of the face, scalp, neckline, neck, arms and forearms, or still more preferably the skin of the face, the skin of the face (particularly the skin of the forehead, nose, cheeks and chin), the skin of the neckline and the skin of the neck.

[0101] For the purposes of the present invention, the term "physiologically acceptable" is intended to mean a medium which has a pleasant color, smell and feel and does not cause any unacceptable discomfort, ie stinging or straining, which could tend to prevent the user from applying the composition.

[0102] As used herein, the terms "treat" and "treatment" refer to the alleviation of symptoms associated with a particular disorder or condition and / or the elimination of said symptoms as well as the complete disappearance of the disorder or condition in question.

[0103] In the context of the present invention, the terms "prevent" and "prevention" mean reducing to a lesser extent the risk or likelihood of a given phenomenon occurring.

[0104] The invention thus makes it possible to impart beneficial properties to the skin, in particular in a lasting manner, in particular: an effective barrier function; a moisturizing effect; elasticity and a smooth texture of the skin; a surface morphology with low roughness, good tissue cohesion and an improvement in the visual appearance of the skin.

[0105] From a physiological point of view, dry skin is often associated with a decrease in skin moisturization and has a negative impact on the barrier function, measured by imperceptible water loss. From a sensory point of view, it is particularly characterized by a feeling of tightness, itching, discomfort and / or skin tension. For obvious reasons, these symptoms cause discomfort.

[0106] The composition according to the invention thus proves to be particularly effective for treating dry skin conditions, for treating dry skin, for treating itching and / or tightness associated with dry skin, for physiologically restoring the proper moisturizing state of the stratum corneum, for treating hyposeborrheic dry skin, for improving the comfort of dry skin or else for preventing the dull and / or lifeless appearance of the skin as a result of drying out the skin.

[0107] As indicated above, the composition according to the present invention comprises (i) indole-3-lactic acid (ILA) and / or its salts; (ii) indole-3-carboxaldehyde (IAld) and / or its salts; and (iii) indole-3-acetic acid (IAA) and / or its salts.

[0108] According to the present invention, a "salt" of an indole is intended to mean a salt formed from an inorganic or organic acid or another inorganic or organic base.

[0109] As examples of acid salts, mention may be made of sulfate, citrate, acetate, oxalate, chloride, bromide, iodide, nitrate, hydrogensulfate, phosphate, isonicotinate, lactate, salicylate, tartrate, tannate, pantothenate, bitartrate, ascorbate, succinate, maleate, gentisinate, fumarate, gluconate, glucuronate, saccharate, formate, benzoate, glutamate, methanesulfonate, ethanesulfonate, benzenesulfonate, p-toluenesulfonate, aspartate and glutamate.

[0110] As examples of basic salts, mention may be made of alkali metal hydroxides such as sodium, potassium and lithium; alkaline earth metal hydroxides such as calcium and magnesium; hydroxides of other metals such as aluminum and zinc, aqueous ammonia and organic amines such as unsubstituted or hydroxy-substituted mono-, di- or trialkylamines; dicyclohexylamine; tributylamine, pyridine, N-methyl-N-ethylamine; diethylamine; triethylamine; mono-, di- or tris(2-hydroxyalkylamines), such as mono-, di- or tris(2-hydroxyethyl)amine, 2-hydroxytert-butylamine or tris(hydroxymethyl)methylamine, N,N-dialkyl-N-(hydroxyalkyl)-amines, such as N,N-dimethyl-N-(2-hydroxyethyl)amine; N-methyl-D-glucamine; and amino acids such as arginine and lysine.

[0111] The indole salt according to the invention is preferably a basic salt, and in particular a sodium or potassium salt.

[0112] According to one variant, in the composition according to the invention, indole-3-acetic acid is in the form of a basic salt, preferably an inorganic basic salt, more preferentially an alkali metal salt such as sodium, potassium and lithium, and even more preferentially a sodium salt.

[0113] According to one variant, in the composition according to the invention, indole-3-carbaldehyde is present in non-salified form.

[0114] According to one variant, in the composition according to the invention, indole-3-lactic acid is present in a non-salified form or in the form of a basic salt, preferably in the form of an inorganic basic salt, more preferentially in the form of a salt of an alkali metal such as sodium, potassium and lithium, even more preferentially in the form of a sodium salt; preferably, indole-3-lactic acid is present in a non-salified form.

[0115] The composition according to the present invention preferably comprises (i) indole-3-lactic acid (ILA) or a salt thereof; (ii) indole-3-carboxaldehyde (IAld) or a salt thereof; and (iii) indole-3-acetic acid (IAA) or a salt thereof.

[0116] The indole-3-lactic acid (ILA) of the composition according to the present invention has the following formula (I): [Chem1] The composition according to the invention may comprise a content of indole-3-lactic acid and / or its salts of at least 0.00001% by weight relative to the total weight of the composition, and in particular at least 0.0001% by weight relative to the total weight of the composition.

[0117] The composition according to the invention may comprise a content of indole-3-lactic acid and / or its salts of at least 0.001% by weight relative to the total weight of the composition, and in particular at least 0.005% by weight relative to the total weight of the composition.

[0118] The composition according to the invention may contain a content of indole-3-lactic acid and / or its salts of less than 10% by weight relative to the total weight of the composition, in particular less than 1% by weight, more particularly less than 0.1% by weight, even more particularly less than 0.01% by weight relative to the total weight of the composition.

[0119] The composition according to the invention may comprise a content of indole-3-lactic acid and / or a salt thereof in a range from 0.00001% to 10% by weight relative to the total weight of the composition, in particular from 0.0001% to 1%, more particularly in a range from 0.0001% to 0.1%, even more particularly in a range from 0.0001% to 0.01% by weight relative to the total weight of the composition, for example 0.0001% by weight relative to the total weight of the composition.

[0120] The indole-3-carboxaldehyde (IAld) of the composition according to the present invention has the following formula (II): [Chem2] The composition according to the invention may comprise a content of indole-3-carboxaldehyde (IAld) and / or its salts of at least 0.00001% by weight relative to the total weight of the composition, and in particular at least 0.0001% by weight relative to the total weight of the composition.

[0121] The composition according to the invention may comprise a content of indole-3-carboxaldehyde and / or its salts of at least 0.001% by weight relative to the total weight of the composition, and in particular at least 0.004% by weight relative to the total weight of the composition.

[0122] The composition according to the invention may contain a content of indole-3-carboxaldehyde and / or its salts of less than 10% by weight relative to the total weight of the composition, in particular less than 1% by weight, more particularly less than 0.1% by weight, even more particularly less than 0.01% by weight relative to the total weight of the composition.

[0123] The composition according to the invention may comprise a content of indole-3-carboxaldehyde and / or a salt thereof in a range from 0.00001% to 10% by weight relative to the total weight of the composition, in particular in a range from 0.0001% to 1% by weight, more particularly in a range from 0.0001% to 0.1%, even more particularly in a range from 0.0001% to 0.01% by weight relative to the total weight of the composition, for example 0.0001% by weight relative to the total weight of the composition.

[0124] Indole-3-acetic acid (IAA) of the composition according to the present invention has the following formula (III): [Chem3] The composition according to the invention may comprise a content of indole-3-acetic acid (IAA) and / or salts thereof of at least 0.000002% by weight relative to the total weight of the composition and in particular at least 0.00001% by weight relative to the total weight of the composition.

[0125] The composition according to the invention may comprise a content of indole-3-acetic acid (IAA) and / or salts thereof of at least 0.001% by weight relative to the total weight of the composition, and in particular at least 0.004% by weight relative to the total weight of the composition.

[0126] The composition according to the invention may contain a content of indole-3-acetic acid and / or salts thereof of less than 10% by weight relative to the total weight of the composition, in particular less than 1% by weight, more particularly less than 0.1% by weight, even more particularly less than 0.01% by weight relative to the total weight of the composition.

[0127] The composition according to the invention may comprise a content of indole-3-acetic acid and / or a salt thereof in a range from 0.000002% to 10% by weight relative to the total weight of the composition, in particular in a range from 0.00001% to 1% by weight, more particularly in a range from 0.00001% to 0.1%, even more particularly in a range from 0.00001% to 0.01% by weight, for example 0.00001% by weight relative to the total weight of the composition.

[0128] Indole-3-acetic acid (IAA) may in particular be present in the composition according to the invention entirely or partly in the form of a basic salt, preferably an alkali metal salt, more preferentially a sodium salt.

[0129] In the composition according to the present invention, the sum of the contents of indole-3-lactic acid (and / or its salts), indole-3-carboxaldehyde (and / or its salts) and indole-3-acetic acid (and / or its salts) may be at least 0.0001% by weight relative to the total weight of the composition, in particular at least 0.00011% by weight relative to the total weight of the composition.

[0130] The composition according to the invention may in particular be such that the [indole-3-lactic acid and / or its salts / indole-3-carboxaldehyde and / or its salts] weight ratio is from 0.5 to 50, in particular from 1 to 10, for example 1.

[0131] The composition according to the invention may in particular be such that the [indole-3-carboxaldehyde and / or its salts / indole-3-acetic acid and / or its salts] weight ratio is from 0.5 to 150, in particular from 1 to 100, more particularly from 1 to 10, for example 1 or 10.

[0132] The composition according to the invention may in particular be such that the [indole-3-lactic acid and / or its salts / indole-3-acetic acid and / or its salts] weight ratio is from 0.5 to 50, in particular from 1 to 10, for example 1.

[0133] The composition according to the invention may in particular be such that the [indole-3-lactic acid and / or its salts / indole-3-carboxaldehyde and / or its salts / indole-3-acetic acid and / or its salts] weight ratio is from 1:1:1 to 10:10:1.

[0134] In particular, the composition according to the invention may comprise: - a content of indole-3-lactic acid and / or a salt thereof in a range from 0.00001% to 10% by weight relative to the total weight of the composition, in particular from 0.0001% to 1%, more particularly in a range from 0.0001% to 0.1%, even more particularly in a range from 0.0001% to 0.01% by weight relative to the total weight of the composition, for example 0.0001% by weight relative to the total weight of the composition; - a content of indole-3-carboxaldehyde and / or its salts in a range from 0.00001% to 10% by weight relative to the total weight of the composition, in particular in a range from 0.0001% to 1%, more particularly in a range from 0.0001% to 0.1%, even more particularly in a range from 0.0001% to 0.01% by weight relative to the total weight of the composition, for example 0.0001% by weight relative to the total weight of the composition; and - a content of indole-3-acetic acid and / or its salts, and in particular of the sodium salt, ranging from 0.000002% to 10% by weight relative to the total weight of the composition, in particular from 0.00001% to 1% by weight, more particularly from 0.00001% to 0.1% by weight, even more particularly from 0.00001% to 0.01% by weight, for example from 0.00001% by weight relative to the total weight of the composition.

[0135] The composition according to the present invention may further comprise a tryptamine and / or a salt thereof.

[0136] Tryptamine has the following formula (IV): [Chem4] The tryptamine and / or its salt may be present in the composition according to the invention in a content of at least 0.00001% by weight relative to the total weight of the composition, and in particular at least 0.0001% by weight relative to the total weight of the composition.

[0137] The composition according to the invention may contain a content of tryptamine and / or its salts of less than 10% by weight relative to the total weight of the composition, in particular less than 1% by weight, more particularly less than 0.1% by weight, even more particularly less than 0.01% by weight relative to the total weight of the composition.

[0138] The composition according to the invention may comprise a content of tryptamine and / or its salts in a range from 0.00001% to 10% by weight relative to the total weight of the composition, in particular from 0.0001% to 1%, more particularly in a range from 0.0001% to 0.1%, even more particularly in a range from 0.0001% to 0.01% by weight relative to the total weight of the composition, for example 0.0001% by weight relative to the total weight of the composition.

[0139] In particular, the composition according to the invention may comprise: - a content of indole-3-lactic acid and / or its salts in a range from 0.00001% to 10% by weight relative to the total weight of the composition, in particular from 0.0001% to 1%, more particularly from 0.0001% to 0.1%, even more particularly from 0.0001% to 0.01% by weight relative to the total weight of the composition, for example 0.0001% by weight relative to the total weight of the composition; and - a content of indole-3-carboxaldehyde and / or its salts in a range from 0.00001% to 10% by weight relative to the total weight of the composition, in particular from 0.0001% to 1%, more particularly from 0.0001% to 0.1%, even more particularly from 0.0001% to 0.01% by weight relative to the total weight of the composition, for example 0.0001% by weight relative to the total weight of the composition; - a content of indole-3-acetic acid and / or its salts, and in particular of the sodium salt, ranging from 0.000002% to 10% by weight relative to the total weight of the composition, in particular from 0.00001% to 1% by weight, more particularly from 0.00001% to 0.1% by weight, even more particularly from 0.00001% to 0.01% by weight, for example from 0.00001% by weight relative to the total weight of the composition; and - a content of tryptamine and / or its salts in a range from 0.00001% to 10% by weight relative to the total weight of the composition, in particular from 0.0001% to 1%, more particularly in a range from 0.0001% to 0.1%, even more particularly in a range from 0.0001% to 0.01% by weight relative to the total weight of the composition, for example 0.0001% by weight relative to the total weight of the composition.

[0140] In the composition according to the present invention, the sum of the contents of indole-3-lactic acid (and / or its salts), indole-3-carboxaldehyde (and / or its salts) and indole-3-acetic acid (and / or its salts) and tryptamine (and / or its salts) may be at least 0.0003% by weight relative to the total weight of the composition.

[0141] The composition according to the invention may in particular be such that the weight ratio [indole-3-lactic acid and / or its salts / indole-3-carboxaldehyde and / or its salts / indole-3-acetic acid and / or its salts / tryptamine and / or its salts] is from 1:1:1:1 to 10:10:1:10, preferably from 1:1:1:1 to 10:10:1:1.

[0142] The composition according to the invention may in particular comprise a culture supernatant or a fraction of a culture supernatant of at least one bacterial strain which produces indole-3-lactic acid and / or its salts, indole-3-carboxaldehyde and / or its salts and indole-3-acetic acid and / or its salts and optionally also tryptamine and / or its salts, and in particular also tryptamine and / or its salts.

[0143] The composition according to the invention may in particular comprise a culture supernatant or a fraction of a culture supernatant of at least one bacterial strain of the species Staphylococcus epidermidis, said at least one bacterial strain producing indole-3-lactic acid and / or its salts, indole-3-carboxaldehyde and / or its salts and indole-3-acetic acid and / or its salts and optionally also tryptamine and / or its salts, and in particular also tryptamine.

[0144] Therefore, the composition according to the invention preferably comprises a culture supernatant or a fraction of a culture supernatant of at least one bacterial strain chosen from the species Staphylococcus epidermidis of bacteria deposited at the CNCM under numbers 1-5689, 1-5904, 1-5691, 1-5693, 1-5694 and 1-5695.

[0145] The composition according to the invention additionally comprises at least one adjuvant chosen from fatty substances, organic solvents chosen from lower monoalcohols having 1 to 5 carbon atoms, such as ethanol, isopropanol, tert-butanol; polyols, such as propylene glycol, 1,2-pentanediol, caprylyl glycol, hexylene glycol (or 2-methyl-2,4-pentanediol) and polyethylene glycol; polyol ethers, such as dipropylene glycol monomethyl ether, ionic or nonionic, hydrophilic or lipophilic, thickeners; emollients; opacifiers; stabilizers; silicones; antifoaming agents; fragrances; preservatives; anionic, cationic, nonionic, zwitterionic or amphoteric surfactants; fillers; polymers; propellants; and mixtures thereof.

[0146] This adjuvant may represent from 0.0001% to 20% by weight, preferably from 0.01% to 10% by weight and better still from 0.1% to 5% by weight relative to the total weight of the composition.

[0147] Of course, the person skilled in the art will carefully choose the adjuvant(s) and / or the amounts thereof such that the advantageous properties of the indole derivatives of the composition according to the invention are not or not substantially adversely affected by the envisaged addition.

[0148] According to one embodiment, the composition according to the invention may comprise water.

[0149] In particular, the composition according to the invention may comprise from 20% to 90% by weight and preferably from 30% to 60% by weight of water relative to the total weight of the composition.

[0150] The composition according to the invention may further comprise at least one additional cosmetic active agent.

[0151] This may in particular be at least one active agent for caring for dry skin, such as glycerol or urea.

[0152] In the context of the present invention, the term "additional active agent" is intended to mean a compound which acts on its own, that is to say which does not require the intervention of an external agent in order to activate it.

[0153] The additional active agents that can be used in the compositions according to the invention can be chosen in particular from desquamating agents, soothing agents, anti-irritants, anti-aging agents, wound healing agents, antimicrobial agents, vitamins and mixtures thereof in any proportion.

[0154] The additional active agent used in the composition according to the invention may represent from 0.0001% to 20% by weight, preferably from 0.01% to 10% by weight and better still from 0.1% to 5% by weight relative to the total weight of the composition.

[0155] Of course, a person skilled in the art will carefully choose the or these optional additional compound(s) and / or amounts thereof such that the advantageous properties of the composition according to the invention are not or not substantially adversely affected by the envisaged addition.

[0156] The composition according to the invention may be in any presentation form commonly used in the cosmetic field.

[0157] It may be in the form of an aqueous or hydroalcoholic solution, it may be a gelled, lotion-type dispersion, it may be a two-phase dispersion, an oil-in-water or water-in-oil emulsion or a composite emulsion, an aqueous gel, or else a dispersion of oil in an aqueous phase, in particular using spheres which may be polymer particles or, better still, ionic and / or nonionic lipid vesicles. It may have a more or less fluid liquid consistency.

[0158] Preferentially, the compositions according to the invention are distinguished from compositions having essentially detergent use with respect to the skin, hair and / or mucous membranes, such as soaps, shampoos and shower gels for washing and / or cleaning.

[0159] The compositions according to the invention are preferably suitable for topical application.

[0160] The compositions according to the invention may therefore comprise all components usually employed in the envisaged topical application and administration.

[0161] The composition according to the invention may advantageously be in the form of an emulsion, in particular obtained by dispersing an aqueous phase in a fatty phase (W / O) or a fatty phase in an aqueous phase (O / W), with a liquid or semi-liquid consistency of the milk type, or with a soft consistency, or even as a multiple emulsion (W / O / W or O / W / O). These compositions are prepared according to generally known methods.

[0162] More particularly, the composition according to the invention may be ready for topical application and may preferably be in the form of an emulsion, preferably an oil-in-water emulsion. Preferably, such an emulsion is not intended to be rinsed off after application.

[0163] The compositions according to the invention are preferably intended for application to the skin.

[0164] Preferably, the skin is the skin of the face, scalp, décolletage, neck, arms or forearms, or even more preferably the skin of the face (particularly of the forehead, nose, cheeks and chin), décolletage and neck.

[0165] The pH of the composition is advantageously less than or equal to 8, preferably ranging from 4 to 7, better still ranging from 4.5 to 6.5.

[0166] The composition may alternatively be in the form of a face and / or body care or cosmetic product and may be packaged, for example, in the form of a cream in a jar or a fluid in a tube or pump bottle or dropper bottle.

[0167] The composition according to the invention can be manufactured by any known method commonly used in the cosmetics field.

[0168] Prior to formation, the ingredients are mixed in an order and under conditions that can be readily determined by one skilled in the art.

[0169] According to a particular form of the invention, other agents intended to improve the appearance and / or texture of the skin may also be added to the composition according to the invention.

[0170] Uses and methods According to one of its aspects, the present invention relates to the cosmetic, in particular topical, use of a composition according to the invention for preventing a reduction in the barrier function of the skin of an individual and / or for strengthening the barrier function of the skin of an individual.

[0171] According to yet another of its aspects, the present invention relates to the cosmetic use, in particular topical cosmetic use, of a composition according to the invention for improving skin moisturization.

[0172] The invention also relates to the cosmetic use, in particular topical cosmetic use, of a composition according to the invention for improving the quality of the skin, in particular dry skin.

[0173] The present invention also relates to the cosmetic use, in particular topical cosmetic use, of a composition according to the invention for preventing and / or treating cosmetic manifestations associated with dry skin, in particular chosen from sensations of tightness, itching, discomfort, dull complexion, rough skin and pronounced micro-reliefs of the skin.

[0174] Furthermore, a subject of the present invention is the cosmetic, in particular topical, use of a composition according to the invention for the prevention and / or treatment of pruritus, in particular pruritus of the skin affected by dermatological disorders such as atopic dermatitis.

[0175] It also relates to the cosmetic use of such a composition for preventing and / or treating atopic dermatitis, in particular for topical cosmetic use.

[0176] According to yet another of its aspects, the present invention relates to a non-therapeutic cosmetic method for caring for keratin materials, in particular the skin, in particular dry skin, comprising the topical application to these keratin materials of a composition according to the invention.

[0177] Cosmetic uses and methods contemplated according to the present invention are non-therapeutic.

[0178] The cosmetic uses and methods according to the invention are preferably carried out by topical application of the compositions according to the invention.

[0179] Topical application consists of applying the cosmetic composition externally to the skin according to the usual techniques for using these compositions.

[0180] For example, the cosmetic use or method according to the invention can be carried out by topically applying (e.g. daily) at least one composition according to the invention, which can be formulated, for example, in the form of a cream, gel, serum, lotion, emulsion or makeup-removing milk, preferably in the form of an emulsion.

[0181] Application may be repeated, for example, once to twice daily for one or more days, and generally over an extended period of at least 4 weeks or even 4 to 15 weeks, with one or more rest periods, where appropriate.

[0182] According to one embodiment, application is daily (once a day) and generally over an extended period of at least 4 weeks or even 4 to 15 weeks, with one or more rest periods, where appropriate.

[0183] According to one embodiment, the cosmetic treatment method according to the invention may comprise a single application.

[0184] Throughout the specification including the claims, the terms "between and" and "ranging from to" should be understood to mean inclusive limits unless specifically defined otherwise.

[0185] The following examples illustrate the invention without limiting its scope.

[0186] In the examples, unless otherwise specifically defined, the temperature is room temperature (20° C.) and is expressed in degrees Celsius, and the pressure is atmospheric pressure. Example Materials and methods Strain origin, CNCM name and culture method A total of eight selected Staphylococcus epidermidis strains were collected from healthy subjects. Samples were obtained using the swabbing method, as previously described, for example in Leung, MHY et al., Changes of the human skin microbiota upon chronic exposure to polycyclic aromatic hydrocarbon pollutants. Microbiome 8, 100 (2020). The collected bacteria were isolated on trypticase soy agar (TSA) and stored as frozen stocks.

[0187] The eight strains are as follows: Staphylococcus epidermidis strain (I-5689) deposited by Laya Company in CNCM under the retrieval number CNCM I-5689 on June 3, 2021, Staphylococcus epidermidis strain (I-5904) deposited by Laya Company in CNCM under the retrieval number CNCM I-5904 on September 21, 2022, Staphylococcus epidermidis strain (I-5691) deposited by Laya Company in CNCM under the retrieval number CNCM I-5691 on June 3, 2021, Staphylococcus epidermidis strain (I-5693) deposited by Laya Company in CNCM under the retrieval number CNCM I-5693 on June 3, 2021, Staphylococcus epidermidis strain (I-5693) deposited by Laya Company in CNCM under the retrieval number CNCM I-5694 Staphylococcus epidermidis strain (I-5694) deposited in CNCM and the Staphylococcus epidermidis strain (I-5695) deposited in CNCM by L'Aquila Company on June 7, 2021 under the retrieval number CNCM I-5695.

[0188] Bacterial strains were cultured in TSB (Tryptic Soy Broth) or KSFM (Keratinocyte Serum-Free Medium) using conventional microbiological methods.

[0189] Keratinocyte culture and treatment Normal neonatal human primary epidermal keratinocytes (NHEKs) (CellnTec) were cultured at 37°C and 5% CO2 in CnT-57 (CellnTec) medium supplemented with bovine pituitary extract (BPE). 24 hours prior to treatment, NHEKs were cultured to approximately 90% confluence in Keratinocyte-SFM medium (Gibco, Life Tech. Corp., Grand Island, USA) supplemented with 0.035 μg / μl EGF and 12.4 mg / ml BPE (Gibco). For treatments using bacterial supernatants, NHEKs were treated with 50% (v / v) final concentration of sterilized bacterial supernatant in KSFM medium and incubated for 14 hours before harvesting for RNA extraction. At the end of treatment, the culture medium was collected for IL-8 quantification (IL-8 DuoSet ELISA, R&D Systems) and cytotoxicity assay (CyQuantTM LDH Cytotoxicity Assay, ThermoFisher), and the cells were harvested for real-time quantitative PCR assay.

[0190] Real-time quantitative PCR Total RNA was extracted from keratinocytes using the RNeasy Micro kit (Qiagen, Hilden, Germany) following the manufacturer's protocol and additionally treated with DNase (RNase-Free DNase Set, Qiagen). RNA concentration was determined using a Nanodrop™ (Nanodrop 1000, Thermo Scientific). cDNA was synthesized using iScript cDNA Synthesis (Biorad). PCR was performed using the StepOnePlus™ Real-Time PCR system (Applied Biosystems). TM ) and SYBR Green Master Mix (Biorad). Data from quantitative PCR (qPCR) were analyzed using the 2-ΔΔCt quantification method, using eukaryotic GAPDH (glyceraldehyde-3-phosphate dehydrogenase) and Staphylococcal GyrB (DNA gyrase subunit B) as endogenous controls. Primers for FLG, IVL, KLK7, DSG1, CDSN, Ki67, DEFB4, STAT6, OVOL1, and OVOL2 were provided by Biorad. Other primer sequences are shown below: Target gene CYP1A1: sense primer (5'-3') of SEQ ID NO: 1: CAGCTCAGCTCAGTACCTCA (SEQ ID NO: 1) and antisense primer (3'-5') of SEQ ID NO: 2: CTTGAGGCCCTGATTACCCA (SEQ ID NO: 2).

[0191] Target gene GyrB Se: sense primer (5'-3') of SEQ ID NO: 3: GTTGTAATTGAGAAAGACAATTG (SEQ ID NO: 3) and antisense primer (3'-5') of SEQ ID NO: 4: TACAGTTAAGATAACTTCGACAG (SEQ ID NO: 4).

[0192] Quantification of AHR metabolites / ligands Preparation: 5-Hydroxyindoleacetic acid-d5, 5-hydroxytryptamine-d4, indole-3-acetic acid-d4, kynurenic acid-d5, melatonin-d4, piconilic acid-d3, tryptamine-d4, and xanthurenic acid-d4 were purchased from Santa Cruz Biotechnology. 3-Hydroxy-2-aminobenzoic acid-d4, 3-hydroxykynurenine-13C2-15N, 5-hydroxytryptophan-d4, indole-3-acetamide-d5, kynurenine-d4, and tryptophan-d5 were purchased from Toronto Research Chemicals.

[0193] Stock solutions of labeled analytes were prepared in water containing 0.1% formic acid, and final concentrations were chosen to correspond to the estimated concentrations of endogenous metabolites.

[0194] Metabolite extraction: Metabolites were extracted from 50 μl of culture medium collected as described above. After adding the above-mentioned preparation (100 μl) and 300 μl of MeOH, the sample was mixed for 15 seconds and homogenized at -20°C for 30 minutes. After centrifugation at 5000 rpm and -4°C for 10 minutes, 350 μl of supernatant was collected and concentrated under a stream of N2. The residue was reconstituted in 100 μl of MeOH / H2O (1:9) and transferred to a 96-well plate for LC-HRMS.

[0195] Instrumentation: The analysis was performed as previously described in Lefèvre, A. et al. Talanta 195, 593–598 (2019). Briefly, 2 μl was injected into the LC-MS (XEVO-TQ-XS, A Kinetex C18xb column (1.7 μm x 150 mm x 2.1 mm, temperature 55° C.) was used with a flow rate of 0.4 ml / min associated with a gradient of two mobile phases (phase A: water + 0.5% formic acid; phase B: MeOH + 0.5% formic acid).

[0196] For each metabolite, a calibration curve was used to determine the concentration of each metabolite in the sample.

[0197] Statistical analysis All experiments were performed with at least three biological replicates. Data are presented as mean ± SEM. GraphPad Prism (version 7.0; GraphPad Software, La Jolla, California) was used to analyze the data using the Kruskal-Wallis test followed by the Dunn's test. Results were considered statistically significant when p < 0.05.

[0198] Example 1: Selection of six Staphylococcus epidermidis strains based on their indole secretion in culture supernatants The S. epidermidis strain was selected based on its secretion of indole in the culture supernatant when cultured alone, and the ability of the supernatant to activate the AHR pathway and skin barrier function genes.

[0199] Following the protocol detailed above, multiple unique strains were cultured in TSB for 16 hours and supernatants were collected to first quantify indole metabolites and then to process keratinocytes and perform Rt-qPCR analysis of targeted genes.

[0200] result Quantification of the indole concentration in the culture supernatant showed a concentration of more than 443 pmol / ml of total indole - that is, the sum of the concentrations of ILA (indole-3-lactic acid), IAld (indole-3-carboxaldehyde), IAA (indole-3-acetic acid) and tryptamine - for 6 of the strains tested, namely the strains previously indicated with the numbers I-5689, I-5904, I-5691, I-5693, I-5694 and I-5695 (see Tables 1 and 2 below). Figure 1 ).

[0201] [Table 1] Table 1 Compared to untreated cells, supernatants from each of these strains resulted not only in overexpression of CYP1A1 (>2.7-fold), but they also resulted in overexpression of OVOL1.

[0202] [Table 2] Table 2 [Table 3] Table 3 Example 2: Specific indole compositions that mimic the presence of bacteria and maintain skin barrier function The examples describe indole compositions that activate the AHR pathway and maintain skin barrier function.

[0203] The potent indole mixture is a composition that leads to overexpression of genes for AHR pathway activation (specifically the genes CYP1A1 and OVOL1 described by Furue et al. Int. J. Mol. Sci. 20, (2019)) and leads to stimulation of differentiation (FLG-Filaggrin).

[0204] Neither cytotoxicity nor inflammation (IL-8) was measured with any of the indoles or indole mixtures tested.

[0205] A. Different concentrations of the four individual indoles were first tested according to the protocol previously indicated, namely: 0.005 μM; 0.5 μM; 5 μM; 50 μM; or 250 μM for ILA, IAld, and tryptamine; 0.005 μM; 5 μM; 50 μM; or 250 μM for IAA.

[0206] The expression of markers of the AHR pathway (CYP1A1) and barrier function (FLG) in keratinocytes stimulated by indole alone was shown in Figure 2 (ILA), Figure 3 (IAld), Figure 4 (IAA) and Figure 5 (tryptamine).

[0207] Thus, with the exception of ILA, which had a minimum active concentration of approximately 50 μM, the other three indoles each had a minimum active concentration of 250 μM when used alone.

[0208] B. Additional tests were performed on different mixtures of these indoles according to the previously indicated protocol.

[0209] a. First, a 1:1:1:1 mixture of ILA, IAld, IAA, and tryptamine was dosed at 0.5, 5, or 50 μM of each compound (ie, 3 experiments with total indole concentrations of 2, 20, and 200 μM).

[0210] The results obtained are shown in Figure 6 middle.

[0211] Unexpectedly, the lowest active concentration of the mixture was observed from 20 μM (5 μM ILA + 5 μM IAld + 5 μM IAA + 5 μM tryptamine).

[0212] The concentrations stated are those required to obtain activity with only the individual compounds starting from 50 μM for ILA and 250 μM for the three other indoles.

[0213] Therefore, it is surprising to observe that the combination outperforms the individual compounds.

[0214] b. Different mixtures containing ILA, IAld and IAA were also tested according to the previously indicated protocol.

[0215] Therefore, two compositions were tested, comprising (i) 5 μM ILA, 0.5 μM IAld and 0.5 μM IAA, or (ii) 5 μM ILA, 0.5 μM IAld and 5 μM IAA.

[0216] The results obtained are shown in Figure 7 middle.

[0217] Surprisingly, the lowest active concentration of the mixture was observed at 10.5 μM (5 μM ILA + 0.5 μM IAld + 5 μM IAA sodium salt form), the concentration required to obtain activity, which was obtained only with the individual compounds starting from 50 μM for ILA and 250 μM for the three other indoles. Furthermore, the activity was obtained despite the absence of tryptamine.

[0218] Therefore, it is surprising to observe that the combination outperforms the individual compounds.

Claims

1. A composition, in particular a cosmetic composition, in particular for the care of keratin materials, comprising in a physiologically acceptable medium: - at least indole-3-lactic acid and / or its salts, indole-3-carboxaldehyde and / or its salts and indole-3-acetic acid and / or its salts; and at least one adjuvant chosen from fatty substances; organic solvents chosen from lower monoalcohols having 1 to 5 carbon atoms, such as ethanol, isopropanol, tert-butanol; polyols, such as propylene glycol, 1,2-pentanediol, caprylyl glycol, hexylene glycol (or 2-methyl-2,4-pentanediol) and polyethylene glycol; polyol ethers, such as dipropylene glycol monomethyl ether; ionic or nonionic, hydrophilic or lipophilic, thickeners; softeners; opacifiers; stabilizers; silicones; antifoaming agents; fragrances; preservatives; anionic, cationic, nonionic, zwitterionic or amphoteric surfactants; fillers; polymers; propellants; and mixtures thereof.

2. The composition according to claim 1, further comprising tryptamine and / or its salt.

3. The composition according to claim 1 or 2, characterized in that it comprises: - a content of indole-3-lactic acid and / or its salts of at least 0.00001% by weight relative to the total weight of the composition, in particular at least 0.0001% by weight relative to the total weight of the composition; and - a content of indole-3-carboxaldehyde and / or its salts of at least 0.00001% by weight relative to the total weight of the composition, in particular at least 0.0001% by weight relative to the total weight of the composition; and - a content of indole-3-acetic acid and / or its salts of at least 0.000002% by weight relative to the total weight of the composition, in particular at least 0.00001% by weight relative to the total weight of the composition.

4. Composition according to any one of claims 1 to 3, wherein the sum of the contents of indole-3-lactic acid, indole-3-carboxaldehyde and indole-3-acetic acid and / or one of their salts corresponds to at least 0.0001% by weight relative to the total weight of the composition.

5. The composition according to any one of claims 1 to 4, characterized in that it comprises: - a content of indole-3-lactic acid and / or a salt thereof in a range from 0.00001% to 10% by weight relative to the total weight of the composition, in particular from 0.0001% to 1%, more particularly in a range from 0.0001% to 0.1%, even more particularly in a range from 0.0001% to 0.01% by weight relative to the total weight of the composition, in particular from 0.0001% to 10% by weight relative to the total weight of the composition; - a content of indole-3-carboxaldehyde and / or its salts in a range from 0.00001% to 10% by weight relative to the total weight of the composition, in particular in a range from 0.0001% to 1%, more particularly in a range from 0.0001% to 0.1%, even more particularly in a range from 0.0001% to 0.01% by weight relative to the total weight of the composition, in particular 0.0001% by weight relative to the total weight of the composition; and - a content of indole-3-acetic acid and / or its salts in a range from 0.000002% to 10% by weight relative to the total weight of the composition, in particular in a range from 0.00001% to 1% by weight, more particularly in a range from 0.00001% to 0.1% by weight, even more particularly in a range from 0.00001% to 0.01% by weight, in particular 0.00001% by weight relative to the total weight of the composition.

6. The composition according to any one of claims 2 to 5, wherein the content of tryptamine and / or its salt is at least 0.00001% by weight relative to the total weight of the composition, and more particularly at least 0.0001% by weight relative to the total weight of the composition.

7. The composition according to any one of claims 1 to 6, characterized in that The weight ratio [indole-3-lactic acid and / or its salt / indole-3-carboxaldehyde and / or its salt] is 0.5 to 50, particularly 1 to 10, and particularly 1.

8. The composition according to any one of claims 1 to 7, characterized in that The weight ratio [indole-3-carboxaldehyde and / or its salt / indole-3-acetic acid and / or its salt] is 0.5 to 150, particularly 1 to 100, more particularly 1 to 10, particularly 1 or 10.

9. The composition according to any one of claims 1 to 8, characterized in that The weight ratio of [indole-3-lactic acid and / or its salt / indole-3-acetic acid and / or its salt] is 0.5 to 50, particularly 1 to 10, particularly 1.

10. The composition according to any one of claims 1 to 9, characterized in that The weight ratio of [indole-3-lactic acid and / or its salt / indole-3-carboxaldehyde and / or its salt / indole-3-acetic acid and / or its salt] is 1:1:1 to 10:10:

1.

11. The composition according to any one of claims 2 to 10, characterized in that The weight ratio of [indole-3-lactic acid and / or its salt / indole-3-carboxaldehyde and / or its salt / indole-3-acetic acid and / or its salt / tryptamine and / or its salt] is 1:1:1:1 to 10:10:1:10, preferably 1:1:1:1 to 10:10:1:

1.

12. Composition according to any one of claims 1 to 11, comprising a culture supernatant or a fraction of a culture supernatant of at least one bacterial strain of the species Staphylococcus epidermidis, chosen from the bacteria deposited at the CNCM under numbers 1-5689, 1-5904, 1-5691, 1-5693, 1-5694 and 1-5695.

13. The composition of any one of claims 1 to 12, which is suitable for topical administration.

14. Cosmetic use of the composition according to any one of claims 1 to 13 for preventing a decrease in the skin barrier function of an individual and / or strengthening the skin barrier function of an individual, in particular for topical cosmetic use.

15. Cosmetic use of the composition according to any one of claims 1 to 13 for improving skin moisturizing, especially for topical cosmetic use.

16. Cosmetic use, in particular topical cosmetic use, of a composition according to any one of claims 1 to 13 for improving the quality of skin, in particular dry skin.

17. Non-therapeutic cosmetic use, in particular topical non-therapeutic cosmetic use, of a composition according to any one of claims 1 to 13 for preventing and / or treating cosmetic manifestations associated with dry skin, in particular chosen from sensations of tightness, itching, discomfort, dull complexion, rough skin and pronounced micro-reliefs of the skin.

18. Non-therapeutic cosmetic use, in particular topical non-therapeutic cosmetic use, of a composition according to any one of claims 1 to 13 for the prevention and / or treatment of pruritus, in particular pruritus of the skin affected by dermatological conditions such as atopic dermatitis.

19. The composition according to any one of claims 1 to 13, for use in preventing and / or treating atopic dermatitis.

20. The cosmetic use according to any one of claims 14 to 18 or the composition for use according to claim 19, wherein the composition is suitable for topical application.

21. Non-therapeutic cosmetic method for caring for keratin materials, in particular skin, in particular dry skin, comprising topically applying to these keratin materials a composition according to any one of claims 1 to 13.

Images